Literature DB >> 35530963

Regulating mitochondrial homeostasis and inhibiting inflammatory responses through Celastrol.

Zhenyu Tao1, Qingqing Xiao1, Xinyu Che1, Hengyuan Zhang1, Na Geng1, Qin Shao1,2.   

Abstract

Background: The high morbidity and mortality rate of coronary heart disease poses a serious threat to human health. Atherosclerosis, a chronic inflammation of the blood vessel wall, is a significant pathological process leading to coronary heart disease. Macrophage inflammation plays a crucial role in the occurrence and development of atherosclerosis.
Methods: Macrophage inflammation model was constructed by lipopolysaccharide (LPS), and macrophages were treated with Celastrol at different concentrations (0, 0.1, 1, 10, 100 ng/mL) and different time points (0, 1, 3, 6, 12 h). Real-time quantitative PCR (qPCR) and Western Blot were used to detect the expression of Nur77 mRNA and protein. Macrophages were then pretreated with 100 nmol/L tripterine for 40min and co-cultured with 100 ng/mL LPS. The expression levels of inflammatory factors and chemokines, phosphorylation of phospho-dynamin-related protein 1 (p-Drp1) at Ser637 and expression of mitochondrial fusion protein mitochondrial fusion protein mitofusin-2 (Mfn2) were detected by qPCR, Western blot and ELISA, respectively. The changes of mitochondrial membrane potential were detected by JC-1 probe.
Results: 100 nmol/L Celastrol can significantly inhibit LPS-induced inflammatory responses and down-regulate the expression levels of cytokines such as inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX2), tumor necrosis factor-α (TNF-α), chemokines (CCL-2, and CXCL-10), as well as chemokines. And Celastrol could regulate mitochondrial fission and fusion by promoting the phosphorylation of the Drp1 at the Ser637 site, thereby inhibiting mitochondrial fission. At the same time, by up-regulating the level of the Mfn2, Celastrol also promoted mitochondrial fusion. In addition, we found that the nuclear factor-k-gene binding (NF-κB), extracellular signal-regulated kinase 1/2 (ERK1/2), and p38 signaling pathways aided the drug's anti-inflammatory effects. We also explored the relationship between Celastrol and the nuclear receptor Nur77 and found that it could up-regulate the expression of Nur77. Conclusions: Our study found that Celastrol could reduce inflammation by regulating Drp1 dependent mitochondrial fission and fusion, as well as the ERK1/2, p38, NF-κB signaling pathways. This finding provides a strong direction for the development of new anti-inflammatory drugs for atherosclerosis. 2022 Annals of Translational Medicine. All rights reserved.

Entities:  

Keywords:  Celastrol; Nur77; dynamin-related protein 1 (Drp1); inflammation; mitochondrial fission and fusion

Year:  2022        PMID: 35530963      PMCID: PMC9073791          DOI: 10.21037/atm-21-7015

Source DB:  PubMed          Journal:  Ann Transl Med        ISSN: 2305-5839


Introduction

Coronary heart disease has become the leading cause of death worldwide (1). Atherosclerosis, a chronic inflammation of the blood vessel wall caused by lipid accumulation, is an important pathological mechanism leading to the formation of coronary heart disease (2). Macrophage, as an innate immune cell, plays a central role in all stages of atherosclerosis development. In the early stages of the disease, monocytes in the blood migrate to tissues and become macrophages under the presence of oxidized low-density lipoprotein (3). Macrophages convert into foam cells by using their scavenger receptors to take up oxidized low-density lipoproteins (ox-LDLs). This process leads to the release of a large number of pro-inflammatory factors and chemokines, resulting in a severe inflammatory response (4). As the disease progresses, characteristic manifestations of vulnerable plaque, which are called fibrous cap, contain a large amount of collagen fibers, elastic fibers, and proteoglycans, with infiltration of macrophages and T cells. It is generally believed that apoptotic macrophages are cleared by exocytosis. However, with the accumulation of ox-LDL, fatty acids, and cholesterol, a large number of macrophages undergo apoptosis in atherosclerotic vulnerable plaques. These apoptotic macrophages are unable to be cleared in time due to severe inflammatory responses and impaired exocytosis. Therefore, they remain in the intima of the artery (5). A large number of apoptotic macrophages in vulnerable plaques cause a persistent and severe inflammatory response, which will eventually trigger plaque rupture or bleeding, leading to acute coronary syndrome (6). Essentially, the inflammatory response induced by macrophages plays a key role in the formation and exacerbation of atherosclerosis. In recent years, compounds extracted from traditional Chinese herbal medicines have played an increasingly important role in the treatment of diseases. One of these compounds is Celastrol, a natural small molecule compound isolated from the root of the traditional Chinese herb “Thunder of God Vine” (Tripterygium wilfordii Hook F) (7). As early as 2007, Celastrol was listed with artemisinin, curcumin, capsaicin, and triptolide as 1 of the 5 most promising compounds to be developed into drugs in the 21st century. Recently, more and more studies have confirmed that Celastrol has a variety of pharmacological effects, including as an anti-oxidant, anti-cancer, and metabolism and immunity regulator (8-10). Based on the above pharmacological effects and a large amount of experimental data, Celastrol might be developed to treat autoimmune diseases, tumors, diabetes, and neurodegenerative diseases (9). Mitochondria are double-membrane-bound subcellular organelles that produce energy currency, adenosine triphosphate (ATP), and are the main place for cells to perform aerobic respiration. Mitochondrial fission and fusion, which is also called mitochondrial quality control, is very critical for maintaining the normal morphology, function, and distribution of mitochondria. If an imbalance of the homeostasis between these processes occurs, it can lead to cell or organ dysfunction and abnormal mitochondrial redistribution (10). Mitochondrial fission is necessary to create new mitochondria, but it also helps quality control by removing damaged mitochondria and promoting apoptosis during cellular stress. This process is mediated by a member of the cytosolic dynamin family [dynamin-related protein 1 (Drp1) in mammals and dynamin 1 (Dnm1) in yeast]. Mitochondrial fusion helps reduce stress by promoting complementation between damaged mitochondria (11). Mitochondrial fusion proteins contain outer mitochondrial membrane (OMM) proteins and inner mitochondrial membrane (IMM) proteins. The outer membrane protein optic atrophy factor 1 (OPA1) participates in the fusion of the outer membrane of the mitochondria, while the inner membrane proteins mitofusin1 (Mfn1) and mitofusin2 (Mfn2) are involved in the fusion of the mitochondria’s inner membrane (12). In this study, we found that Celastrol could significantly mitigate macrophage inflammation induced by the lipopolysaccharide (LPS) and reduce the release of pro-inflammatory cytokines and chemokines. In addition, we discovered for the first time that Celastrol could inhibit mitochondrial fission by promoting the phosphorylation of Drp1 at Ser637, and enhance mitochondrial fusion through the up-regulating of Mfn2 expression. At the same time, we also confirmed that Celastrol could up-regulate the expression of nuclear receptor Nur77, which may be related to its anti-inflammatory effect. Our current study reveals that Celastrol has an anti-inflammatory mechanism, which not only provides a theoretical basis for Celastrol to extenuate inflammation, but also provides a direction for the development of new natural compounds which reduce inflammation by regulating mitochondrial fission and fusion. We present the following article in accordance with the MDAR reporting checklist (available at https://atm.amegroups.com/article/view/10.21037/atm-21-7015/rc).

Methods

Materials

Our study was conducted using the following antibodies: rabbit polyclonal anti-iNOS, anti-GAPDH, anti-COX2, anti-Nur77, anti-LaminB1, anti-Drp1, anti-phospho-Drp1 (Ser637), and anti-Mfn2 purchased from Abcam (Cambridge, UK). We also used Rabbit polyclonal anti-p65, anti-phospho-p65, anti-ERK1/2, anti-phospho-ERK1/2, anti-JNK, anti-phospho-JNK, anti-p38, and anti-phospho-p38 purchased from Cell Signaling Technology Inc. (Danvers, MA, USA). The chemical agents used in our study included Dulbecco’s modified eagle medium (DMEM), fetal bovine serum (FBS), penicillin, and streptomycin (Hyclone Laboratories Inc., Logan, UT, USA); Celastrol (MedChemExpress, Monmouth Junction, NJ, USA); LPS (Sigma-Aldrich, St. Louis, MI, USA); horseradish peroxidase (HRP)-labeled goat anti-rabbit IgG (H + L) and polyvinylidene fluoride (PVDF) (Beyotime Biotech, Jiangsu, China). The following kits were also used: BeyoECL Plus, Nuclear and Cytoplasmic Protein Extraction, Primary Antibody Dilution Buffer, and Mitochondrial Membrane Potential Assay with JC-1 (Beyotime Biotech, Jiangsu, China).

Cell culture and treatment

RAW264.7 cells (murine macrophage cell line) were purchased from iCell Bioscience Inc. (Shanghai, China). The RAW264.7 cells were propagated using DMEM, which contained 10% FBS, 100 U/mL penicillin, and 100 µg/mL streptomycin, and were maintained at 37 ℃ in a humidified 5% CO2 atmosphere. Cells were seeded at a density of 1×105 cells in a 6-well plate and were grown for 24 h before the experiment. RAW264.7 cells were pretreated with Celastrol for 40 min and then co-stimulated with 100 ng/mL of LPS and another 100 nmol/L of Celastrol for 24 h.

ELISA kit

Supernatants of cultured cells were collected after treatment and the secretion of cytokines and chemokines was measured using a commercial Enzyme-Linked Immunosorbent Assay (ELISA) kit (Boster Bio, Pleasanton, CA, USA) according to the manufacturer’s instructions.

RNA preparation and reverse transcription polymerase chain reaction (RT-PCR) test

Total RNA was isolated from the RAW264.7 cells through TRI-Solution (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. Using 500 ng total RNA as raw material, complementary (cDNA) was synthesized by reverse transcription premix technology. A quantitative real-time PCR test was performed by using gene-specific primers () and the PCR premix.
Table 1

The specific primer sequences

NamePrimer sequences
TNF-α Forward: CTGAACTTCGGGGTGATCGG
Reverse: GGCTTGTCACTCGAATTTTGAGA
IL-1β Forward: GAAATGCCACCTTTTGACAGTG
Reverse: TGGATGCTCTCATCAGGACAG
IL-6 Forward: CTGCAAGAGACTTCCATCCAG
Reverse: AGTGGTATAGACAGGTCTGTTGG
iNOS Forward: GTTCTCAGCCCAACAATACAAGA
Reverse: GTGGACGGGTCGATGTCAC
CCL-2 Forward: TAAAAACCTGGATCGGAACCAAA
Reverse: GCATTAGCTTCAGATTTACGGGT
CXCL-10 Forward: CCAAGTGCTGCCGTCATTTTC
Reverse: GGCTCGCAGGGATGATTTCAA
COX-2 Forward: TGCACTATGGTTACAAAAGCTG
Reverse: TCAGGAAGCTCCTTATTTCC
Nur77 Forward: GAGTTCGGCAAGCCTACCAT
Reverse: GTGTACCCGTCCATGAAGGTG
GAPDH Forward: TGACCTCAACTACATGGTCTACA
Reverse: CTTCCCATTCTCGGCCTTG

TNF-α, tumor necrosis factor-α; IL-1β, interleukin-1β; IL-6, interleukin-6; iNOS, inducible nitric oxide synthase; CCL-2, chemokine (C-C motif) ligand 2; CXCL-10, chemokine (C-X-C motif) ligand 10; COX-2, cyclooxygenase 2; Nur77, nerve growth factor-induced gene B NGFI-B; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

TNF-α, tumor necrosis factor-α; IL-1β, interleukin-1β; IL-6, interleukin-6; iNOS, inducible nitric oxide synthase; CCL-2, chemokine (C-C motif) ligand 2; CXCL-10, chemokine (C-X-C motif) ligand 10; COX-2, cyclooxygenase 2; Nur77, nerve growth factor-induced gene B NGFI-B; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Western blot analysis

RAW264.7 cells were seeded in a 6-well plate in advance. After 24 h of drug treatment, the total protein was extracted from the cells with a phenylmethylsulphonyl fluoride (PMSF) lysis buffer (Roche, Basel, CH). After detecting the protein concentrations with a bicinchoninic acid (BCA) protein assay reagent (Thermo Fisher Scientific, Waltham, MA, USA), we separated proteins according to their different molecular weight with 8–12% sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred them onto a PVDF membrane. After blocking with 5% skim milk, we put the PVDF membrane into an antibody incubation box which contained various primary antibodies diluted at the correct proportions and according to the relevant instructions. It was left at 4 ℃ overnight to allow the antigen and antibody to fully bind. The next day, the membrane was washed 3 times by using Tris-buffered saline with Tween-20 (TBST) for 5 minutes and then incubated with an HRP-linked secondary antibody before being diluted in TBST for 1 hour at room temperature. The protein was finally detected using a LAS-4000 mini system (Fujifilm, Tokyo, Japan).

Immunofluorescence

For the immunofluorescence of the RAW264.7 cells, they were seeded in 6-well plates with slides and underwent the following process: 500 μL of 4% paraformaldehyde added to each well (blocked for 15 min at room temperature), 0.3% Triton X-100 added (30 min at room temperature), PBS washing 5 min × 3 times, 5% antigen blocking goat serum added (volume fraction 0.02% Triton X-100 preparation) (30 min), JC-1 primary antibody incubation (volume fraction 0.02% Triton X-100 1:50 dilution) (1 h at room temperature), PBS washing 5 min × 3 times, FITC-labeled goat anti-rabbit IgG secondary antibody incubation (1:200 dilution) (1 h at room temperature and avoided light), and lastly they were mounted with VECTASHIELD mounting tablets containing 4',6-diamidino-2-phenylindole (DAPI). We then observed, photographed, and detected the expression of JC-1 under a fluorescence microscope. The primary antibody was then replaced with PBS or affinity-purified normal rabbit IgG as a negative control. The concentration of the negative control antibody was the same as that of the primary antibody, and the incubation conditions were also the same.

Statistical analysis

Our experiment was independently repeated 3 times to obtain the results which were expressed as mean ± standard deviation (SD). The values were evaluated by one-way analysis of variance, followed by a Duncan’s multiple range test using GraphPad Prism 4.0 software (GraphPad Software, Inc., San Diego, CA, USA). Differences of P<0.05 were considered significant.

Results

Construction of macrophage inflammation model

LPS was used to construct a macrophage inflammation model, and the inflammatory factors and chemotaxis were detected at different concentration (0, 0.1, 1, 10, 100 ng/mL) and time (0, 1, 3, 6, 12 h) points to factor the expression. shows that LPS can down-regulate the expression of IL-6, TNF-α, COX-2, IL-1β, iNOS, CCL-2, and CXCL-10 genes; show that as the LPS concentration increases, the expression of the iNOS and COX-2 proteins increase; and show that with an increase in the LPS administration time, the expression of the iNOS and COX-2 proteins increase.
Figure 1

Expressions of IL-6, TNF-α, COX-2, IL-1β, iNOS, CCL-2, and CXCL-10. (A) The level of IL-6, TNF-α, COX-2, IL-1β, iNOS, CCL-2, and CXCL-10 were detected by qPCR; (B) the expressions of iNOS were detected by 0–100 ng/mL LPS induced; (C) the expressions of COX 2 were detected by 0–100 ng/mL LPS induced; (D) the expressions of iNOS were detected by 0, 1, 3, 6, 12 h LPS induced; (E) the expressions of COX2 were detected by 0, 1, 3, 6, 12 h LPS induced. *, P<0.05 compared with 0 h; **, P<0.01 compared with 0 h; NS represents P>0.05. IL, interleukin; TNF-α, tumor necrosis factor-α; COX-2, cyclooxygenase-2; IL-1β, interleukin-1β; iNOS, inducible nitric oxide synthase; CCL-2, chemokine (C-C motif) ligand 2; CXCL-10, chemokine (C-X-C motif) ligand 10; LPS, lipopolysaccharide; qPCR, real-time quantitative PCR.

Expressions of IL-6, TNF-α, COX-2, IL-1β, iNOS, CCL-2, and CXCL-10. (A) The level of IL-6, TNF-α, COX-2, IL-1β, iNOS, CCL-2, and CXCL-10 were detected by qPCR; (B) the expressions of iNOS were detected by 0–100 ng/mL LPS induced; (C) the expressions of COX 2 were detected by 0–100 ng/mL LPS induced; (D) the expressions of iNOS were detected by 0, 1, 3, 6, 12 h LPS induced; (E) the expressions of COX2 were detected by 0, 1, 3, 6, 12 h LPS induced. *, P<0.05 compared with 0 h; **, P<0.01 compared with 0 h; NS represents P>0.05. IL, interleukin; TNF-α, tumor necrosis factor-α; COX-2, cyclooxygenase-2; IL-1β, interleukin-1β; iNOS, inducible nitric oxide synthase; CCL-2, chemokine (C-C motif) ligand 2; CXCL-10, chemokine (C-X-C motif) ligand 10; LPS, lipopolysaccharide; qPCR, real-time quantitative PCR.

Celastrol inhibits LPS-induced inflammatory response

The structure of Celastrol in . After the intervention of 100 nmol/L Celastrol (), we found that inflammatory factors related to the cytokines IL-6, TNF-α, COX-2, IL-1β, and iNOS, as well as the chemokines CCL-2 and CXCL-10, were significantly down-regulated, suggesting that Celastrol could effectively reduce the inflammatory response of macrophages.
Figure 2

Celastrol inhibits LPS-induced inflammatory response. (A) The structure of Celastrol; (B) expressions of IL-6, CCL-2, and CXCL-10; (C) expressions of iNOS and COX-2; (D) expressions of IL-6, TNF-α, COX-2, IL-1β, iNOS, CCL-2, and CXCL-10. ##, P<0.01 compared with LPS without Cel; **, P<0.01 compared without LPS and Cel; NS represents P>0.05 compared with LPS without Cel. IL, interleukin; TNF-α, tumor necrosis factor-α; COX-2, cyclooxygenase-2; IL-1β, interleukin-1β; iNOS, inducible nitric oxide synthase; CCL-2, chemokine (C-C motif) ligand 2; CXCL-10, chemokine (C-X-C motif) ligand 10; LPS, lipopolysaccharide.

Celastrol inhibits LPS-induced inflammatory response. (A) The structure of Celastrol; (B) expressions of IL-6, CCL-2, and CXCL-10; (C) expressions of iNOS and COX-2; (D) expressions of IL-6, TNF-α, COX-2, IL-1β, iNOS, CCL-2, and CXCL-10. ##, P<0.01 compared with LPS without Cel; **, P<0.01 compared without LPS and Cel; NS represents P>0.05 compared with LPS without Cel. IL, interleukin; TNF-α, tumor necrosis factor-α; COX-2, cyclooxygenase-2; IL-1β, interleukin-1β; iNOS, inducible nitric oxide synthase; CCL-2, chemokine (C-C motif) ligand 2; CXCL-10, chemokine (C-X-C motif) ligand 10; LPS, lipopolysaccharide.

Study on the mechanism of Celastrol in regulating mitochondrial morphology and function

The mechanism of Celastrol in regulating mitochondrial morphology and function in . Celastrol promotes the phosphorylation modification of Drp1 at Ser637 (), inhibits mitochondrial division, reduces mitochondrial fragmentation, and exerts an anti-inflammatory effect. It can also promote mitochondrial fusion by up-regulating the expression of Mfn2 () while at the same time adjusting the mitochondrial membrane potential (), thus improving the damaged mitochondrial function and playing a role in inhibiting inflammation.
Figure 3

Study on the mechanism of Celastrol in regulating mitochondrial morphology and function. (A) Study on the mechanism of Celastrol in regulating mitochondrial morphology and function; (B) expressions of p-Drp1 and Drp1; (C) the expression of Mfn2; (D) immunofluorescence expression of JC-1 (×100). ##, P<0.01 compared with LPS without Cel; *, P<0.05 compared without LPS and Cel. p-Drp1, phospho-dynamin-related protein 1; Mfn2, mitochondrial fusion protein mitofusin-2; LPS, lipopolysaccharide; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Study on the mechanism of Celastrol in regulating mitochondrial morphology and function. (A) Study on the mechanism of Celastrol in regulating mitochondrial morphology and function; (B) expressions of p-Drp1 and Drp1; (C) the expression of Mfn2; (D) immunofluorescence expression of JC-1 (×100). ##, P<0.01 compared with LPS without Cel; *, P<0.05 compared without LPS and Cel. p-Drp1, phospho-dynamin-related protein 1; Mfn2, mitochondrial fusion protein mitofusin-2; LPS, lipopolysaccharide; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Research on the mechanism of Celastrol regulating related inflammatory signaling pathways

Our study found that Celastrol could inhibit inflammatory responses () by down-regulating both the phosphorylation level of extracellular signal-regulated kinase (ERK) and the p38 protein in the mitogen-activated protein kinase (MAPK) pathway, as well as the phosphorylation of the p65 protein in the nuclear factor-κB (NF-κB) pathway.
Figure 4

Research on the mechanism of Celastrol regulating related inflammatory signaling pathways. (A) Expressions of p-ERK/ERK, p-JNK/JNK, p-P38/P38; (B) expressions of p-P65/P65; (C) expression of p65. ##, P<0.01 compared with LPS without Cel; *, P<0.05 compared without LPS and Cel; **, P<0.01 compared without LPS and Cel. ERK, extracellular signal-regulated kinase; LPS, lipopolysaccharide; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Research on the mechanism of Celastrol regulating related inflammatory signaling pathways. (A) Expressions of p-ERK/ERK, p-JNK/JNK, p-P38/P38; (B) expressions of p-P65/P65; (C) expression of p65. ##, P<0.01 compared with LPS without Cel; *, P<0.05 compared without LPS and Cel; **, P<0.01 compared without LPS and Cel. ERK, extracellular signal-regulated kinase; LPS, lipopolysaccharide; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

The effect of Celastrol on the expression of the nuclear receptor Nur77

In this study, different Celastrol concentrations and time points were set to analyze how it acts on macrophages. Nur77 mRNA and protein expression changes were detected using a qPCR test () and Western blot analysis (). illustrates that Celastrol can not only induce the up-regulation of Nur77 mRNA and protein expression, but that its effect is dependent on concentrations and time points.
Figure 5

The effect of Celastrol on the expression of the nuclear receptor Nur77. (A) The expression of Nur77 after treating with different concentrations of Celastrol by qPCR; (B) the expression of Nur77 after treating with Celastrol in different time by qPCR; (C) the expression of Nur77 after treating with different concentrations of Celastrol by Western blot; (D) the expression of Nur77 after treating with Celastrol in different time by Western blot. *, P<0.05 compared with 0 h; **, P<0.01 compared with 0 h. qPCR, real-time quantitative PCR; Nur77, nerve growth factor-induced gene B NGFI-B; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

The effect of Celastrol on the expression of the nuclear receptor Nur77. (A) The expression of Nur77 after treating with different concentrations of Celastrol by qPCR; (B) the expression of Nur77 after treating with Celastrol in different time by qPCR; (C) the expression of Nur77 after treating with different concentrations of Celastrol by Western blot; (D) the expression of Nur77 after treating with Celastrol in different time by Western blot. *, P<0.05 compared with 0 h; **, P<0.01 compared with 0 h. qPCR, real-time quantitative PCR; Nur77, nerve growth factor-induced gene B NGFI-B; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Discussion

Previous studies have shown that Celastrol has anti-inflammatory and anti-oxidative effects, inhibiting cell proliferation and inducing apoptosis. As atherosclerosis is a chronic inflammatory process, many mechanisms are involved in its occurrence and development, among which inflammatory mechanisms have been proven to be the main cause for triggering and promoting the disease (13,14). Macrophages are the main inflammatory cells in atherosclerotic plaque (13,14). Studies have shown that in atherosclerotic plaques of patients with acute coronary syndrome, especially in the “shoulder” of plaques, there are more macrophages and foam cells, with the number of macrophages having increased exponentially (15-17) when compared with that of stable plaques. Macrophages can produce free radicals and many tissue degrading proteases, such as elastase and matrix metalloproteinase, which can degrade collagen in the fiber cap, resulting in plaque rupture and thrombosis (16). The number of macrophages in the atherosclerotic plaque is positively correlated with the risk of plaque rupture. The accumulation of macrophages is a heavy marker and intervention target of unstable plaque (17). The results of our study show that Celastrol can effectively alleviate the inflammatory response of RAW264.7 induced by LPS. Macrophages are the first line of defense against the invasion of exogenous pathogens. They can quickly identify pathogens and cause an immune inflammatory reaction to remove pathogens and maintain body homeostasis (18,19). With high plasticity and functional diversity, macrophages can polarize into cells with different phenotypes and functional states under different environmental stimuli. At present, they are widely recognized as classical activated macrophages (M1 macrophages) and alternative activated macrophages (M2 macrophages). LPS, as the main component of the cell wall of gram-negative bacteria, can be bound and recognized by the TLR4 protein. Previous studies (20-22) have shown that LPS stimulates macrophages to activate multiple inflammation-related signaling pathways, including MAPK, Janus kinase-signal transducer and activator of transcription (JAK-STAT), and the NF-κB. Some of the inflammatory factors these pathways produce include TNF-α, IL-6, iNOS, IL-1β, and so on. In human monocytes, stimulation of LPS activates NF-κB-p65, which then promotes the secretion of chemokines such as CCL-2, IL-8, and CCL-5. Studies (19-22) have shown that the activated protein kinase (AMPK) can pass NF-κB, while MAPK and JAK/STAT signaling pathways regulate inflammatory response. Swirski et al. (19) found that LPS, γ-interferon (INF)-γ, and microbial products such as granulocyte macrophage colony stimulating factors (GM-CSFs) can induce macrophages to polarize to a M1 phenotype, have stronger bactericidal and phagocytic power, and aggravate inflammatory reaction and tissue damage. Gordon et al. (20) also found that interleukin-4 (IL-4), TGF-β, and other immune-related complexes can stimulate macrophages to polarize to a M2 phenotype, down-regulate immune response, inhibit inflammatory response, and promote the repair of damaged tissue. Two polarizations run through the occurrence and development of as Dill et al. (21) found that in the early stage monocytes infiltrated into blood vessels and differentiated into M2 macrophages under the action of the macrophage colony stimulating factor (MCSF), promoting vascular remodeling and peripheral tissue repair. With the progress of inflammation, M1 macrophages gradually increase and dominate, inducing the production of the reactive oxygen species (ROS), promoting the secretion of NO, and accelerating TNF-α, IL-6, IL-1β, and other inflammatory factors. Woollard et al. (22) reported that Th2 cytokines can activate M2 macrophages, promote the formation of fibrous caps and improve the stability of plaques by driving the secretion of cytokines such as IL-4 and IL-13 in the plasma of advanced patients. Therefore, in order to further explore the anti-inflammatory activity and mechanism of Celastrol in the treatment of arteriosclerosis, this experiment used LPS to induce RAW264.7 cells to construct an in vitro inflammatory model, and observed the expression of M1/M2 macrophage-related inflammatory factors after Celastrol intervention by ELISA, real time PCR, and Western blot. It was found that Celastrol with different drug concentrations could significantly down-regulate the M1 macrophage pro-inflammatory factors IL-6 and TNF-α. The factors COX-2, IL-1 β, iNOS, CCL-2, and CXCL-10 also showed that Celastrol had good anti-inflammatory activity in vitro, which was confirmed by ELISA and real-time PCR. Mitochondria constantly change their reticular structure through continuous fusion and division, which is called mitochondrial dynamics. This dynamic change not only has important physiological meaning for the exertion of its own function, but is considered to be the power center of both cardiomyocytes and mitochondria. This is because it is both a semi-autonomous organelle and an important signal organelle that participates in a variety of life-activity processes such as gene expression and cell apoptosis. However, the specific mechanism of mitochondrial dynamics on arteriosclerosis is not clear. Mitochondrial fusion proteins mainly include the dynein family GTPase proteins Mfn1 and Mfn2, which are the key proteins of mitochondrial outer membrane fusion (22,23). The optic atrophy associated protein 1 (Opa1) is a key fusion protein located in the mitochondrial membrane gap and mitochondrial intima, while the GTPase Drp1 and mitochondrial fission 1 protein (FIS1) are key proteins of mitochondrial division. Drp1 aggregates on the outer membrane of mitochondria and controls division through chemotaxis. The mechanism of FIS1 is to guide the transfer of Drp1 to the outer membrane of mitochondria and divide mitochondria into 2 new mitochondria through a series of actions. Recent studies (22-24) have shown that mitochondrial dynamics plays a key role in maintaining energy metabolism and that the dysfunction of its function can reduce the amount of ATP synthesized by mitochondria. Furthermore, the expression of the MTF2 gene can increase mitochondrial membrane potential, enhance the oxidation reaction of glucose, and increase respiratory chain products. Mfn1/Mfn2 are also closely related to apoptosis. Their specific mechanism may be to regulate the bid-mediated apoptosis pathway by regulating back on the outer membrane of mitochondria, inhibiting the expression of Drp1, and reducing the damage of caspase-9 (CASP9) activation to the mitochondria which is caused by ROS (and which may also be one of the causes of arteriosclerosis) (24). Celastrol can regulate the Drp1 and Mfn2 proteins, inhibit mitochondrial division, and promote fusion so as to reduce mitochondrial fragmentation and inhibit inflammation. Mitochondria play an indispensable role in cell death, autophagy, immunity, and inflammation. Previous studies (25-28) have found that the orphan nuclear receptor Nur77 can induce apoptosis by targeting mitochondria. Because the characteristics of the vulnerable plaque of arteriosclerosis mainly include a large lipid core with thin fiber cap, an intense inflammatory response with increased apoptosis of vascular cells such as macrophages, etc., we believe that Nur77, which is highly up-regulated, may play an important regulatory role in promoting an inflammatory response and macrophage apoptosis. In recent years, Li et al. (25) found that under the induction of some apoptotic stimuli, Nur77 can combine with the retinoid X receptor (RXR) to form heterodimer, shift to the cytoplasm to target mitochondria, and then change the conformation of the Bcl-2 molecule from being an anti-apoptotic to pro-apoptotic molecule, thus promoting tumor cell apoptosis. Cheng et al. (26) also found that Nur77 can shift to mitochondria during myocardial ischemia-reperfusion injury, thus mediating cardiomyocyte apoptosis in the pathological process. At present, there are 2 opposing views on the effect of Nur77 on macrophage inflammatory responses in the pathological process of arteriosclerosis. Hanna et al. (27) believes that overexpressed Nur77 in macrophages can promote an inflammatory response (the researchers overexpressed Nur77 through lentivirus). However, according to the research results of Bonta et al. (28), Nur77 in macrophages can reduce lipid intake and the inflammatory reaction process. This study found that Celastrol can up-regulate the expression of Nur77 and be used as an Nur77 agonist, which provides a new direction for the study of Nur77 and the pathogenesis of arteriosclerosis. In conclusion, Celastrol can up-regulate the expression of the Nur77 mRNA and protein, stimulate the expression of Nur77, and be used as a Nur77 agonist. At the same time, it can also significantly reduce the inflammatory response of macrophages, inhibit the release of related inflammatory factors and chemokines, regulate MAPK and NF-κB inflammatory signaling pathways, promote mitochondrial fusion, and change the level of mitochondrial membrane potential to regulate mitochondrial stability. All these factors confirm and clarify the anti-inflammatory role Celastrol can play in the potential treatment of arteriosclerosis. The article’s supplementary files as
  27 in total

Review 1.  The interface between innate and adaptive immunity.

Authors:  Kasper Hoebe; Edith Janssen; Bruce Beutler
Journal:  Nat Immunol       Date:  2004-10       Impact factor: 25.606

Review 2.  New insights into the function and regulation of mitochondrial fission.

Authors:  Hidenori Otera; Naotada Ishihara; Katsuyoshi Mihara
Journal:  Biochim Biophys Acta       Date:  2013-02-20

Review 3.  Alternative activation of macrophages: mechanism and functions.

Authors:  Siamon Gordon; Fernando O Martinez
Journal:  Immunity       Date:  2010-05-28       Impact factor: 31.745

4.  Celastrol, a triterpene extracted from the Chinese "Thunder of God Vine," is a potent proteasome inhibitor and suppresses human prostate cancer growth in nude mice.

Authors:  Huanjie Yang; Di Chen; Qiuzhi Cindy Cui; Xiao Yuan; Q Ping Dou
Journal:  Cancer Res       Date:  2006-05-01       Impact factor: 12.701

Review 5.  Atherosclerotic plaque rupture: local or systemic process?

Authors:  Esther Lutgens; Robert-Jan van Suylen; Birgit C Faber; Marion J Gijbels; Petra M Eurlings; Ann-Pascale Bijnens; Kitty B Cleutjens; Sylvia Heeneman; Mat J A P Daemen
Journal:  Arterioscler Thromb Vasc Biol       Date:  2003-09-25       Impact factor: 8.311

6.  Mitofusin-2 is a major determinant of oxidative stress-mediated heart muscle cell apoptosis.

Authors:  Tao Shen; Ming Zheng; Chunmei Cao; Chunlei Chen; Jian Tang; Wanrui Zhang; Heping Cheng; Kuang-Hueih Chen; Rui-Ping Xiao
Journal:  J Biol Chem       Date:  2007-06-11       Impact factor: 5.157

Review 7.  Monocytes in atherosclerosis: subsets and functions.

Authors:  Kevin J Woollard; Frederic Geissmann
Journal:  Nat Rev Cardiol       Date:  2010-01-12       Impact factor: 32.419

8.  Inflammation and atherosclerosis: disease modulating therapies.

Authors:  Mahesh J Patel; Michael A Blazing
Journal:  Curr Treat Options Cardiovasc Med       Date:  2013-12

9.  Innate immunity and monocyte-macrophage activation in atherosclerosis.

Authors:  Joseph Shalhoub; Mika A Falck-Hansen; Alun H Davies; Claudia Monaco
Journal:  J Inflamm (Lond)       Date:  2011-04-28       Impact factor: 4.981

Review 10.  Drp1-Dependent Mitochondrial Fission Plays Critical Roles in Physiological and Pathological Progresses in Mammals.

Authors:  Chenxia Hu; Yong Huang; Lanjuan Li
Journal:  Int J Mol Sci       Date:  2017-01-13       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.