Literature DB >> 35527788

hsa_circ_0000523/miR-let-7b/METTL3 axis regulates proliferation, apoptosis and metastasis in the HCT116 human colorectal cancer cell line.

Yansheng Wang1, Baolei Zhang2, Yun Zhu3, Yong Zhang1, Li Li1, Tao Shen4, Hao Liu1, Yirong Teng5.   

Abstract

Circular RNAs (circRNAs/circs) have gained attention as a class of potential biomarkers for the early detection of multiple cancers. However, the functions and mechanisms of circRNAs in the oncogenesis of human colorectal cancer (CRC) remain to be elucidated. The present study aimed to investigate the roles of hsa_circ_0000523 and its parental gene methyltransferase-like 3 (METTL3) in regulating cell proliferation, apoptosis and invasion in the HCT116 human CRC cell line. To uncover the regulated function of hsa_circ_0000523 in HCT116 cells, a dual-luciferase reporter assay, flow cytometry, reverse transcription-quantitative PCR, Cell Counting Kit-8 assay, cell invasion and western blot assay were used. In HCT116 cells, hsa_circ_0000523 indirectly regulated METTL3 expression by suppressing the transcription of microRNA (miR)-let-7b. The expression of METTL3 promoted cell proliferation and suppressed apoptosis. In the present study, it was found that miR-let-7b promoted cell viability and inhibited apoptosis and invasion, while circ_0000523 exerted the opposite effects. Higher levels of METTL3 expression were associated with more aggressive tumor invasion. The present results suggest that circRNAs and METTL3 may be applied for highly sensitive diagnosis of CRC and for predicting prognosis in patients who have undergone therapy. Copyright: © Wang et al.

Entities:  

Keywords:  HCT116; colorectal cancer; hsa_circ_0000523; methyltransferase-like 3

Year:  2022        PMID: 35527788      PMCID: PMC9073585          DOI: 10.3892/ol.2022.13306

Source DB:  PubMed          Journal:  Oncol Lett        ISSN: 1792-1074            Impact factor:   3.111


Introduction

Colorectal cancer (CRC) is one of the most common malignancies worldwide (1,2). More than 1 million new cases of CRC were diagnosed worldwide in 2012, which accounts for ~10% of the global cancer burden (3). Currently, CRC is the fourth most common cause of cancer-related mortality (4,5). Although conventional treatments such as surgery, chemotherapy, radiotherapy and immunotherapy have improved the survival of patients with CRC, the mortality and relapse rates remain high (5,6). Therefore, more specific mechanism-based treatments are greatly needed. Circular RNAs (circRNAs/circs) have gained attention as a class of potential biomarkers for the early detection of CRC (7). circRNA is a newly discovered type of non-coding RNA, which is distinct from the traditional linear RNA that has 5′- and 3′-ends (8). circRNAs are formed by exon skipping or back-splicing events, during which the 5′-end of an upstream exon is spliced together with the 3′-end of the downstream exon to form a circular molecule of RNA (8,9). circRNAs have been demonstrated to serve an important role in post-transcriptional regulation by acting as microRNA (miRNA/miR) sponges to competitively inhibit RNA/miRNA transcriptional regulation (10,11). The abnormal expression of circRNA is closely associated with various diseases, including CRC (12–14). Jiang et al (15) identified a large set of differentially expressed circRNAs in a primary CRC cell line (SW480) and a metastatic CRC cell line (SW620), relative to a normal colon cell line (NCM460). hsa_circ_000984 has been reported to promote colon cancer growth and metastasis by sponging miR-106b (16). Furthermore, Bachmayr-Heyda et al (17) demonstrated a global reduction in circRNA abundance in CRC cell lines and clinical CRC specimens compared with normal tissues. The authors described five specific circRNAs (circ0817, circ3203, circ6229, circ7374 and circ7780) and proposed a potentially negative association between global circRNA abundance and cell proliferation. Among the five circRNAs identified, the present study focused on circ6229 (also known as circ_0000523) and its corresponding gene/linear mRNA, methyltransferase-like 3 (METTL3). As a major RNA N6-adenosine methyltransferase, METTL3 is widely implicated in mRNA biogenesis, decay and translation control (18). METTL3 has previously been demonstrated to promote the growth, survival and invasion of numerous human cancers (19), such as lung cancer (20), hepatocellular carcinoma (21), breast cancer (22) and pancreatic cancer (23). However, the precise role of METTL3 in the tumorigenesis and pathogenesis of CRC remains largely unknown. HCT116 cells are a population of malignant cells that were isolated from the primary cell culture of a single human colonic carcinoma (24). In present study, the regulatory role of hsa_circ_0000523 in HCT116 cells was explored in detail. Dual-luciferase reporter assay, reverse transcription-quantitative PCR (RT-qPCR) and some rescue experiments were applied to confirm the existence of the hsa_circ_0000523/miR-let-7b/METTL3 axis. FCM was used to count the apoptotic cells. Cell Counting Kit-8 (CCK-8) and invasion assays were performed to monitor the activities of the HCT116 cells. The present study suggests a potential role for the hsa_circ_0000523/miR-let-7b/METTL3 axis in the tumorigenesis and pathogenesis of human CRC.

Materials and methods

Cell culture

The HCT116 human CRC cell line (cat. no. CCL-247) was obtained from American Type Culture Collection. Cells were maintained in DMEM (Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Thermo Fisher Scientific, Inc.), 100 units/ml penicillin and 100 µg/ml streptomycin (Thermo Fisher Scientific, Inc.). Cells were grown in a humidified atmosphere with 5% CO2 at 37°C. Cells were cultured in 75-cm2 flasks or 10-cm plates (Corning, Inc.), with the confluence maintained below 80%. After digestion with 0.25% (w/v) trypsin and 0.5 mM EDTA (Thermo Fisher Scientific, Inc.), cells were passaged every 2–3 days with a subcultivation ratio between 1:3 and 1:8.

Plasmid constructs and small interfering RNA (siRNA) oligos

Total RNA was extracted from the HCT116 cells using TRIzol® reagent (Thermo Fisher Scientific, Inc.) and further purified with two phenol-chloroform treatments, and then treated with RQ1 DNase (Promega Corporation) to digest DNA. The quality and quantity of the purified RNAs were measured by a Nano Photometer spectrometer with the absorbance at 260/280 nm. The mixture was verified by 1.2% agarose gel electrophoresis. The cDNA was synthesized with random primers with the High-capacity cDNA Reverse-Transcription Kit (Takara Biotechnology Co., Ltd.) according to the manufacturer's instructions. The full-length cDNA for human METTL3 (GenBank accession no. NM_019852.5) was obtained from the cDNA library of HCT116 cells by PCR, using the following protocol: 98°C for 10 min, followed by 98°C for 10 sec, 55°C for 5 sec and 72°C for 2 min for 35 cycles, and then 72°C for 10 min. The primers are listed in Table I. The vector used to generate full-length wild-type (WT) METTL3 and hsa_circ_0000523 was mammalian expression vector pcDNA3.1 (Thermo Fisher Scientific, Inc.). The METTL3 coding sequence or circ_0000523 fragment was subcloned into the pcDNA3.1 vector via KpnI and BamHI double-enzymatic sites. Positive clones were selected, and the plasmid expressing METTL3 or hsa_circ_0000523 was verified by sequencing. The siRNA oligos used in the present study were designed and synthesized by Wuhan GeneCreate Biological Engineering Co., Ltd. The sequences for these siRNA oligos were as follows: Negative control siRNA oligo (METTL3-con) sense, 5′-GCUACUUCAGACGAGCAUUdTdT-3′; METTL3-specific siRNA oligo (METTL3-si) sense, 5′-GCUGCACUUCAGACGAAUUdTdT-3′; negative control oligo for hsa_circ_0000523 (circ-con) sense, 5′-CAACAGAGCAAGAAGUAGAUdTdT-3′; and circ_0000523-specific siRNA oligo (circ-si) sense, 5′-CAACAGAGCAAGAAGAUCUAdTdT-3′.
Table I.

Sequences of primers used for reverse transcription-quantitative PCR in the present study.

GenePrimer sequence (5′-3′)
hsa_circ-0000523 F: CAGCATCGGAACCAGCAAAG
R: CTGGGCTGTCACTACGGAAG
miR-let-7b F: GGGTGAGGTAGTAGGTTGT
R: CAGTGCGTGTCGTGGAGT
U6 F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT
METTL3 F: GTGTCGGAGGTGATTCCAGT
R: CTGCGCATCTCATCATCTGT
GAPDH F: GTCAGTGGTGGACCTGACCT
R: TGCTGTAGCCAAATTCGTTG

F, forward; R, reverse; circ, circular RNA; miR, microRNA; METTL3, methyltransferase-like 3.

Transfection of plasmids and siRNA oligos

HCT116 cells were transfected with the empty pcDNA3.1 vector (METTL3-EV), METTL3-expressing pcDNA3.1 vector (METTL3-OE), METTL3-con, METTL3-si, circ-EV, circ-OE, circ-con, circ-si, mimics, mimics NC, inhibitor and inhibitor NC using Lipofectamine® 2000 reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. miR-let-7b mimic sense (5′-UGAGGUAGUAGGUUGUGUGGUU-3′), its negative control (5′-UCACAACCUCCUAGAAAGAGUAGA-3′), inhibitor (5′-AACCACACAACCUACUACCUCA-3′) and inhibitor NC (5′-UCUACUCUUUCUAGGAGGUUGUGA-3′) were synthesized by Wuhan GeneCreate Biological Engineering Company. The RNA concentrations of mimics and inhibitor were 0.32 and 0.26 µg/µl, respectively. HCT116 cells (1×104) were seeded in 6-well plates and maintained at a confluence of 70–80% in complete culture medium. Then, 2.5 µg plasmid or 100 pmol siRNA oligo was added to 250 µl Opti-MEM (Thermo Fisher Scientific, Inc.), and 5 µl Lipofectamine 2000 reagent was added to 250 µl Opti-MEM. The diluted plasmid or siRNA oligo was mixed with diluted Lipofectamine 2000 reagent and kept at room temperature for 20 min. After 500 µl serum-free medium was added to each well, the Opti-MEM mixture was added. After transfected cells were incubated at 37°C for 4 h, the culture medium was changed to regular DMEM supplemented with 10% FBS. After 48 h, the subsequent experiments were performed.

RNA isolation and reverse transcription

Total RNA was extracted from cells using TRIzol reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols. Briefly, after treatment, cell pellets were resuspended in 1 ml TRIzol and mixed well. Then, 0.2 ml chloroform was added to the cell suspension, which was shaken vigorously for 15 sec and then incubated for 3 min at room temperature. After centrifugation of the suspension at 12,000 × g for 10 min at 4°C, supernatant was collected and subjected to RNA precipitation by adding 0.5 ml isopropanol at 4°C. The RNA pellet was obtained by centrifugation at 12,000 × g for 10 min at 4°C, and then washed with 75% ethanol. The appropriate amount of RNase-free distilled water was used to dissolve extracted RNA. The concentration of RNA was measured with a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, Inc.). For each sample, 1 µg RNA was reverse transcribed into cDNA using the ReverTra Ace qPCR RT Kit (cat. no. FSQ-101; Toyobo Life Science) according to the specifications in the product manual.

RT-qPCR

For RT-qPCR, SYBR Green Realtime PCR Master Mix (cat. no. QPK-212; Toyobo Life Science) was used to measure the expression of targeted genes according to the manufacturer's protocol. For quantification of hsa_circ_0000523 and let-7b, U6 was used as an internal reference gene. GAPDH was used as an internal reference gene for the quantification of METTL3. The conditions for PCR were set as follows: Pre-denaturation at 95°C for 1 min, followed by 40 cycles of denaturation at 95°C for 15 sec, and annealing and elongation at 60°C for 30 sec. The 7900HT Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.) was used to perform the assay. The 2−ΔΔCq method was used to calculate differences in target gene expression between the experimental and control groups. The calculation formula was as follows: ΔΔCq=ΔCqexperimentalgroup-ΔCqnormalgroup, ΔCq=Cqtargetgene-Cqinternalreference (25). The sequences of primers used for RT-qPCR are presented in Table I.

Western blot (WB) assay

HCT116 human CRC cells with various treatments were washed twice using PBS buffer. Total protein was extracted from the treated cells using NE-PER Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols and then measured using a BCA assay. Briefly, the tube was vigorously vortexed for 15 sec. Then, ice-cold cytoplasmic extraction reagent II was added to the tube and the tube was vortexed for another 5 sec. The tube was centrifuged at 16,000 × g for 5 min at 4°C, and then the supernatant was collected. The insoluble (pellet) fraction was suspended in ice-cold nuclear extraction reagent. Subsequently, the collected fraction was vortexed for 15 sec and the tube was centrifuged at 16,000 × g (15 min, 4°C). Lastly, the supernatant fraction was transferred to a clean tube and stored at −80°C until use. Proteins were quantified by the BCA method. The proteins (50 µg) were separated on 12% gels using SDS-PAGE (Beyotime Institute of Biotechnology), and then quickly transferred onto a PVDF membrane.. The membrane was blocked with 5% skimmed milk for 45 min at 37°C, and then probed with primary antibodies for 12 h at 4°C. The membrane was washed three times and probed with the secondary antibodies for 1 h at 25°C. The signal was detected using an ECL system (MilliporeSigma) and the gray level was assessed using ImageJ 1.8.0 software (National Institutes of Health). The primary antibodies were: Anti-METTL3 antibody (EPR18810; 1:2,000 dilution; cat. no. ab195352; Abcam) and GAPDH monoclonal Antibody (1:10,000 dilution; catalog no. 60004-1-Ig; ProteinTech Group, Inc.). The secondary antibody was HRP-conjugated Affinipure Goat Anti-Rabbit IgG(H+L) (1:10,000 dilution; catalog no. SA00001-2; ProteinTech Group, Inc.). All antibodies used in the WB assay were diluted in 5% skimmed milk powder.

Dual-luciferase reporter assay

The binding sites among miR-let-7b, circ_0000523 and METTL3 were predicted by Bielefeld Bioinformatics Service online software (https://bibiserv.cebitec.uni-bielefeld.de/prevres.jsf). The WT miR-let-7b along with the 3′-UTR of METTL3 that contained the predicted miR-let-7b binding site or a sequence with mutations (MUT) were amplified and inserted into the pmirGLO vector (Promega Corporation), resulting in the WT luciferase reporter construct. The vectors (miR-let-7b-WT, miR-let-7b-MUT, METTL3-WT or METTL3-MUT), miR-let-7b mimics and negative control mimics, which were synthesized by Wuhan GeneCreate Biological Engineering Company, were transfected into CRC cells using Lipofectamine 3000 (Thermo Fisher Scientific, Inc.). After 48 h, the luciferase activity was measured using a luciferase reporter system (Promega Corporation), with Renilla luciferase activity as an internal control. The sequences of mimics miR-let-7b and mimics NC were as follows: miR-let-7b mimic sense, 5′-UGAGGUAGUAGGUUGUGUGGUU-3′; NC sense, 5′-UCACAACCUCCUAGAAAGAGUAGA-3′.

CCK-8 assay to measure cell proliferation

After transfection of empty pcDNA3.1 vector, METTL3-expressing pcDNA3.1 vector, METTL3-con oligo or METTL3-si oligo, HCT116 cells were seeded into flat-bottomed 96-well plates at a density of 3×103−6×103 cells per well in 100 µl culture medium. Each treatment condition was replicated in nine wells. Cells were incubated for 24, 48 or 72 h in an incubator with 5% CO2 at 37°C. Cell proliferation was analyzed with a CCK-8 assay (Beyotime Institute of Biotechnology) according to the manufacturer's protocol. Briefly, 20 µl CCK-8 reagent (5 mg/ml) was added to the culture medium, and cells were cultured for an additional 4 h. The optical density values of all wells were measured with a plate reader (Thermo Fisher Scientific, Inc.) at 450 nm.

Cell apoptosis

HCT116 cells seeded in 6-well plates were transfected with empty pcDNA3.1 vector, METTL3-expressing pcDNA3.1 vector, METTL3-con oligo or METTL3-si oligo, as aforementioned. At 48 h after transfection, cells were detached by incubation with 0.25% trypsin-EDTA solution (Thermo Fisher Scientific, Inc.) and were harvested. Flow cytometry analysis was performed to detect apoptosis using the Annexin V-FITC/PI apoptosis kit (Beyotime Institute of Biotechnology) according to the manufacturer's protocol. Briefly, after one wash in PBS and one wash in binding buffer, cells were stained with Annexin V-FITC/PI for 20 min at room temperature in the dark. After another wash in binding buffer, labelled cells were detected immediately using a flow cytometer (CytoFLEX S; Beckman Coulter, Inc.). Data were analyzed with CytExpert 2.0 Software (Beckman Coulter, Inc.).

Cell invasion

The cellular potential for invasion was determined using a 24-well Transwell plate with 8.0-µm Pore Polyester Membrane Inserts (Corning, Inc.). Matrigel (Corning, Inc.) was melted overnight at 4°C and diluted to a final concentration of 1 mg/ml in pre-cooled serum-free medium. Then, 100 µl diluted Matrigel was added to the bottom of the upper chamber. The plate was then incubated at 37°C for 4–5 h to dry the Matrigel. At 24 h after transfection, HCT116 cells in the logarithmic growth phase were seeded in triplicate at a density of 1×106 cells/chamber. Cells were seeded on top of the Transwell plate in 100 µl DMEM supplemented with 0.1% bovine serum albumin (Thermo Fisher Scientific, Inc.). Then, 0.8 ml DMEM supplemented with 10% FBS (Thermo Fisher Scientific, Inc.) was added to the lower chamber as a chemoattractant. After 24 h of incubation at 37°C, cells on the top surface of the insert were removed with a cotton swab. Cells that had invaded the lower surface of the membrane were fixed with 4% paraformaldehyde at 37°C for 15 min and stained with 800 µl Giemsa solution at 37°C for 20 min (Beyotime Institute of Biotechnology). Cells were visualized using a light microscope (CKX-41; Olympus Corporation). Cell counts were obtained from three randomly selected optical fields.

Statistical analysis

All data were analyzed using SPSS Version 21.0 software (IBM Corp.). All values are presented as the mean ± SD. Three independent experiments were performed Quantitative data were compared using the χ2 test. For only two comparisons, statistically significant differences between means were determined using an unpaired Student's t-test. For multiple comparisons, the significance was identified by simple one-way ANOVA followed by a Tukey's post-hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

hsa_circ_0000523 regulates METTL3 expression by modulating levels of miR-let-7b in HCT116 cells

To explore the role of hsa_circ_0000523 circRNA in the tumorigenesis and pathogenesis of CRC, an in vitro model was established by manipulating the expression of hsa_circ_0000523 in the HCT116 human CRC cell line. As shown in Fig. 1A, the mRNA expression levels of circ_0000523 were successfully increased more than 20-fold in the circ overexpression (circ-OE) group compared with cells transfected with empty vector (circ-EV). Next, this circRNA was knocked down in HCT116 cells. Efficient knockdown of hsa_circ_0000523 was observed in HCT116 cells transfected with hsa_circ_0000523-specific siRNA oligo (circ-si), in which hsa_circ_0000523 expression was 80% less than that in HCT116 cells transfected with control siRNA oligo (circ-con) (Fig. 1A). Next, the effect of hsa_circ_0000523 expression on METTL3 and miR-let-7b, a microRNA that may be a target of hsa_circ_0000523, was evaluated in HCT116 cells. A negative association between the expression of hsa_circ_0000523 and miR-let-7b was observed (Fig. 1B). Among the various treatment conditions, HCT116 cells transfected with hsa_circ_0000523-expressing plasmid (circ-OE) displayed the highest level of hsa_circ_0000523 expression and the lowest level of miR-let-7b expression.
Figure 1.

hsa_circ_0000523 indirectly regulates METTL3 expression by suppressing transcription of miR-let-7b in HCT116 cells. (A-C) HCT116 cells are untreated or transfected with hsa_circ_0000523-expression plasmid, empty pcDNA3.1 vector plasmid, hsa_circ_0000523-specific siRNA oligo or control siRNA oligo. At 48 h after transfection, HCT116 cells were harvested and transcriptional levels of (A) hsa_circ_0000523, (B) miR-let-7b and (C) METTL3 are quantified by RT-qPCR. (D) RT-qPCR verifies the successful transfection of miR-let-7b mimics and inhibitor. (E) Protein levels of METTL3 were measured using western blot analysis. (F) Schematic representation of miR-let-7b and predicted target site in circ_0000523 and METTL3. (G) Interaction between miR-let-7b and METTL3 was detected using a luciferase reporter assay. n=3 for each group. *P<0.05 and ***P<0.001. WT, untreated wild-type HCT116 cells; circ-OE, HCT116 cells with overexpression of hsa_circ_0000523; circ-EV, HCT116 cells transfected with empty vector; circ-si, HCT116 cells transfected with hsa_circ_0000523-specific siRNA oligo; circ-con, HCT116 cells transfected with negative control siRNA oligo; inhibitor, inhibitor-treated groups; inhibitor NC, the control of inhibitor-treated groups (PBS-treated groups); mimics, miR-let-7b overexpression groups; mimics NC, the control of mimics groups; METTL3, methyltransferase-like 3; RT-qPCR, reverse transcription-quantitative PCR; siRNA, small interfering RNA.

Among all treatment groups, the circ-si group had the highest expression of miR-let-7b (Fig. 1B). Expression of METTL3, one of the targets of miR-let-7b, was upregulated in circ-OE group, while knockdown of hsa_circ_0000523 exerted an inhibitory effect (Fig. 1C). Next, the regulatory effect of miR-let-7b on METTL3 was verified. A mimic and an inhibitor of miR-let-7b were synthesized and then transfected into HCT116 cells. The transfection efficiency was validated by RT-qPCR (Fig. 1D). The reduction of METTL3 was not significant in miR-treated cells, but the miRNA inhibitor increased the protein level of METTL3 (Fig. 1E). The binding sequence of miR-let-7b in the 3′UTR of METTL3 mRNA and circ_0000523 that was predicted by BiBiserv prediction software is shown in Fig. 1F. Lastly, a luciferase reporter assay was implemented to verify the regulatory effect of miR-let-7b on METTL3. As shown in Fig. 1G, luciferase activity was reduced in the mimics and METTL3-WT groups relative to that in the mimics NC and METTL3-WT groups. Furthermore, transfection of mimics NC or mimics had almost no impact on luciferase activity in the METTL3-MUT group, demonstrating that miR-let-7b directly binds to METTL3. A hsa_circ_0000523/miR-let-7b/METTL3 axis was thus identified in HCT116 cells.

Positive association between METTL3 expression and proliferation in HCT116 cells

As METTL3 was the endpoint effector molecule for the hsa_circ_0000523/miR-let-7b/METTL3 axis, it was important to elucidate the effects of METTL3 expression on proliferation, apoptosis and invasion of HCT116 cells in the present study. Similarly, HCT116 cells with overexpression or knockdown of METTL3 were generated by transfection of a METTL3-expressing pcDNA3.1 plasmid or a METTL3-specific siRNA oligo, respectively. The levels of METTL3 mRNA were quantified using RT-qPCR and WB analysis. The results demonstrated that METTL3 overexpression resulted in a >200-fold increase in METTL3 transcript levels. The WB results were consistent with the RT-qPCR findings. Compared with the METTL3-con group, the METTL3-si group exhibited a >70% decrease in METTL3 transcript levels (Fig. 2A).
Figure 2.

METTL3, miR-let-7b and circ_0000523 regulate proliferation of HCT116 cells. (A) METTL3 levels were quantified by reverse transcription-quantitative PCR or western blotting. (B-C) Cell Counting Kit-8 assays were performed to examine the role of (B) METTL3 and (C) miR-let-7b in cell proliferation. (D) CCK-8 assays were used to detect the cell viability in each group. n=3 for each group. *P<0.05, **P<0.01 and ***P<0.001. WT, untreated wild-type HCT116 cells; METTL3-OE, HCT116 cells with overexpression of METTL3; METTL3-EV, HCT116 cells transfected with empty vector; METTL3-si, HCT116 cells transfected with METTL3-specific siRNA oligo; METTL3-con, HCT116 cells transfected with negative control siRNA oligo; inhibitor, inhibitor-treated group; inhibitor NC, the control of inhibitor-treated group (PBS-treated group); mimics, miR-let-7b overexpression groups; mimics NC, the control of mimics group; circ-OE, circ_0000523 overexpression group; circ-EV, the control of circ-OE group; circ-OE + mimics, circ_0000523 overexpressing vector and mimics co-transfected into HCT116 cells; METTL3, methyltransferase-like 3; siRNA, small interfering RNA; OD, optical density.

After transfection with plasmids or siRNA oligos, HCT116 cells were further cultured for 24, 48 or 72 h. Cell proliferation was measured at these time points using the CCK-8 assay. There were no significant differences in cell proliferation among the untreated WT, empty vector-transfected and negative control siRNA oligo-transfected HCT116 cells (Fig. 2B). Compared with the empty vector-transfected HCT116 cells (METTL3-EV group), HCT116 cells with ectopic expression of METTL3 (METTL3-OE group) exhibited a significantly higher rate of proliferation at each time point. Cell proliferation was decreased in HCT116 cells with knockdown of METTL3 compared with cells transfected with negative control siRNA oligos (Fig. 2B). Furthermore, the effects of miR-let-7b and circ_0000523 on HCT116 cell proliferation were evaluated. Compared with the mimic NC groups, proliferation was obviously inhibited in the mimic groups. By contrast, cell viability was significantly promoted in inhibitor groups (Fig. 2C). As shown in Fig. 2D, overexpression of circ_0000523 promoted HCT116 cell proliferation at all time points. Furthermore, miR-let-7b reversed the effects of circ_0000523 overexpression on human HCT116 cell characteristics. Taken together, these results indicated that hsa_circ_0000523 may regulate proliferation of CRC cells via miR-let-7b.

METTL3 regulates apoptosis in HCT116 cells

An important question was whether and how the expression of METTL3 impacts apoptosis in HCT116 cells; therefore, this was evaluated using Annexin V and PI staining. There were no significant differences in apoptotic rates among the untreated WT, empty vector-transfected and negative control siRNA oligo-transfected HCT116 cells, all of which exhibited an apoptotic rate of ~15% (Fig. 3A and B). The rate of apoptosis was significantly decreased in HCT116 cells with ectopic expression of METTL3 compared with HCT116 cells transfected with empty vector (12% vs. 15%, respectively). The rate of apoptosis was higher in HCT116 cells with knockdown of METTL3 than in cells transfected with negative control siRNA oligos (20% vs. 15%, respectively; Fig. 3A and B). Therefore, a negative association between METTL3 expression and the apoptotic rate was observed, which suggests that METTL3 inhibits apoptosis in HCT116 cells. In addition, the effect of circ_0000523 and miR-let-7b on HCT116 cell apoptosis was investigated by flow cytometry. Overexpression of circ_0000523 significantly reduced apoptosis of CRC cells (Figs. 3C and S1A). Compared with that in the mimics NC group, the number of apoptotic cells was increased in the mimics group. By contrast, adding an inhibitor suppressed HCT116 cell apoptosis (Figs. 3D and S1B). As shown in Figs. 3E and S1C, circ_0000523 reversed the antitumor effects of miR-let-7b on human CRC cell line characteristics.
Figure 3.

METTL3, miR-let-7b and circ_0000523 mediate apoptosis of HCT116 cells. (A) Flow cytometry was used to detect apoptosis following knockdown or overexpression of METTL3. (B-D) Summarized data show the rate of apoptosis in HCT116 cells following interference with (B) METTL3, (C) miR-let-7b and (D) circ_0000523. (E) Representative flow cytometry apoptosis data for each group of CRC cells are shown. Annexin V-positive cells were considered to be apoptotic. n=3 for each group. **P<0.01 and ***P<0.001. WT, untreated wild-type HCT116 cells; METTL3-OE, HCT116 cells with overexpression of METTL3; METTL3-EV, HCT116 cells transfected with empty vector; METTL3-si, HCT116 cells transfected with METTL3-specific siRNA oligo; METTL3-OE, METTL3 overexpression group; METTL3-con, the control of METTL3-OE group; inhibitor, inhibitor-treated group; inhibitor NC, the control of inhibitor-treated group (PBS-treated group); mimics, miR-let-7b overexpression groups; mimics NC, the control of mimics group; circ-OE, HCT116 cells with overexpression of hsa_circ_0000523; circ-EV, HCT116 cells transfected with empty vector; circ-EV + mimics, empty vector and mimics were co-transfected into HCT116 cells; circ-OE + mimics, circ_0000523 overexpressing vector and mimics co-transfected into HCT116 cells; METTL3, methyltransferase-like 3; siRNA, small interfering RNA.

Higher METTL3 expression is associated with more aggressive tumor invasion in HCT116 cells

To explore the role of METTL3 in regulating CRC metastasis, Transwell assays were performed to examine the invasion of HCT116 cells with various levels of METTL3 expression. After plasmid (overexpression) or siRNA oligo (knockdown) transfection, the number of cells that had migrated to the surface of the lower chamber (filled with DMEM containing 10% FBS) was used as an index for the metastatic ability of HCT116 cells. As shown in Fig. 4A, a higher number of Giemsa-positive stained cells were observed in the group with METTL3 overexpression compared with the group with METTL3 knockdown.
Figure 4.

METTL3, miR-let-7b and circ_0000523 mediate invasion of HCT116 cells. (A-C) Transwell assays reveal the invasion of HCT116 cells regulated by (A) METTL3, (B) miR-let-7b and (C) circ_0000523. (D) Transwell assays show the invasion abilities in each group. Scale bar, 800 µm. n=3 for each group; *P<0.05, **P<0.01 and ***P<0.001. WT, untreated wild-type HCT116 cells; METTL3-OE, HCT116 cells with overexpression of METTL3; METTL3-EV, HCT116 cells transfected with empty vector; METTL3-si, HCT116 cells transfected with METTL3-specific siRNA oligo; METTL3-con, the control of METTL3-si; inhibitor, inhibitor-treated groups; inhibitor NC, the control of inhibitor-treated groups; mimics, miR-let-7b overexpression groups; mimics NC, the control of mimics groups; circ-OE, HCT116 cells with overexpression of hsa_circ_0000523; circ-EV, HCT116 cells transfected with empty vector; circ-EV + mimics, empty vector and mimics co-transfected into HCT116 cells; circ-OE + mimics, circ_0000523 overexpressing vector and mimics co-transfected into HCT116 cells; METTL3, methyltransferase-like 3; siRNA, small interfering RNA.

Statistical analysis confirmed the positive association between METTL3 expression and the invasion of HCT116 cells. There were no significant differences in invasion among the untreated WT, empty vector-transfected and negative control siRNA oligo-transfected HCT116 cells (Fig. 4A). Compared with empty vector-transfected HCT116 cells (METTL3-EV group), HCT116 cells with ectopic expression of METTL3 (METTL3-OE group) exhibited significantly higher invasion. Consistently, invasion was decreased in HCT116 cells with METTL3 knockdown compared with cells transfected with negative control siRNA oligos (Fig. 4A). These results suggest that higher expression of METTL3 is associated with more aggressive tumor invasion in HCT116 cells. Next, it was examined whether circ_0000523 and miR-let-7p mediate CRC cell invasion. Compared with those in the circ-EV group, cells in the lower chamber were increased by 43.2% in the circ-OE group, suggesting significant levels of invasion in CRC cells (Fig. 4B). The cell invasion of miR-let-7b-transfected cells (mimics group) obviously decreased compared with the control group (mimics NC group), while inhibitor treatment resulted in an obvious increase in CRC cell invasion ability (Fig. 4C). Furthermore, transfection of miR-let-7b mimics reduced the invasion of CRC cells; however, this was restored by circ_0000523 overexpression (Fig. 4D).

Discussion

circRNAs modulate the expression of parental genes by regulating alternative splicing or transcription and acting as competitive sponges for endogenous RNA or miRNA (26). circRNAs may provide more comprehensive information on the key genes involved in oncogenesis and the development of numerous cancers (27,28). circRNAs are easily accessible and noninvasive biological markers for the early detection of CRC (29,30). However, few studies have reported on the specific functions of circRNAs in the tumorigenesis and pathogenesis of human CRC. In the present study, the expression patterns of hsa_circ_0000523 and its parental gene METTL3 were explored in the HCT116 human CRC cell line. The present results identified a potential hsa_circ_0000523/miR-let-7b/METTL3 axis. The results of gain-of-function and loss-of-function assays demonstrated that expression of METTL3 promoted cell proliferation and invasion and inhibited apoptosis in HCT116 cells. Rescue experiments were performed to confirm the regulatory effects of hsa_circ_0000523 on miR-let-7b. It was found that circ_0000523 reversed the antitumor effects of miR-let-7b on human CRC cell line characteristics. Accumulating evidence has demonstrated the abnormal expression and important biological functions of circRNAs in CRC (12–14). circRNA plays various roles in CRC, including in proliferation, metastasis and apoptosis (6). Notably, most circRNAs previously identified by bioinformatic approaches have been found to be downregulated in CRC cell lines and clinical CRC tissues (17). Huang et al (31). demonstrated that the expression of circRNA itchy E3 ubiquitin ligase (circ_ITCH) was lower in CRC tissues compared with adjacent noncancerous tissues. circ_ITCH was found to sponge tumorigenic miR-7 and miR-20a, which contribute to the malignancy of CRC (31). A positive association between transcription of circ-ITCH and the parental gene ITCH has been identified (31). Notably, expression of circ-ITCH was found to suppress proliferation in CRC cells (31). Similarly, Zhu et al (32) reported that circ-BANP was expressed in 35 CRC tissues, and knockdown of circ-BANP decreased the proliferation of CRC cells. Indeed, there have been some studies reporting the regulatory role of circRNAs in tumourigenesis and progression of human CRC in previous years (33,34). Jin et al (35) found a deficiency in hsa_circ_0000523 could activate the Wnt/β-catenin signaling pathway, which induced the development of CRC. To the best of our knowledge, the present study found for the first time that hsa_circ_0000523 successfully promotes CRC via the miR-let-7b/METTL3 axis. In addition, the expression levels of hsa_circ_0000523, its potential target miR-let-7b, and its parental gene METTL3 were evaluated in HCT116 cells. Similar to the expression patterns of circ-ITCH and ITCH, the transcript levels of hsa_circ_0000523 were positively associated with mRNA levels of linear METTL3 in HCT116 cells. Although the effects of hsa_circ_0000523 expression on cell proliferation were not measured, the ability of METTL3 expression to increase HCT116 cell proliferation suggests a similar proliferative role for hsa_circ_0000523. However, a previous report by Jin et al (35) demonstrated that hsa_circ_0000523 exerted anti-proliferative effects and promoted apoptosis in two other human CRC cell lines (SW480 and SW620). Therefore, although hsa_circ_0000523 can modulate METTL3 expression by acting on miR-let-7b, additional studies will be necessary to determine whether the expression of METTL3 can impact the transcription of hsa_circ_0000523 in HCT116 cells. circRNAs may regulate the proliferation of CRC by sequestering multiple miRNAs. For instance, circ-homeodomain interacting protein kinase 3 (circ-HIPK3) has been demonstrated to be upregulated in CRC tissue compared with normal tissue and regulates cell proliferation by sponging nine miRNAs with 18 potential binding sites (36). Specifically, circ-HIPK3 has been reported to bind to and inhibit the activity of miR-124, a tumor suppressor that is typically downregulated in CRC (37). Therefore, circRNAs may modulate the tumorigenic proliferation of CRC cells by diminishing the antitumor effects of certain tumor-suppressive miRNAs. miR-let-7b, shown here to be a potential target of hsa_circ_0000523, is also a tumor suppressor in multiple cancers (38). Human miR-let-7b has been demonstrated to be downregulated in various cancers, and the induction of tumorigenesis was revealed to be inhibited in normal cells by ectopic expression of miR-let-7b (39,40). Human miR-let-7 has been reported to inhibit cancer growth by targeting various oncogenes and inhibiting key regulators of several mitogenic pathways in cancer (38). These results point to a therapeutic potential for human miR-let-7 in cancer treatment (38). Therefore, high levels of hsa_circ_0000523 and low levels of miR-let-7 may contribute to tumorigenesis in CRC. On the other hand, circRNAs may regulate the proliferation of CRC by indirectly targeting oncogenes. METTL3, a target gene of miR-let-7b, was shown to promote growth, survival and invasion in human lung cancer (20). Furthermore, the oncogenic roles of METTL3 have been demonstrated in numerous solid tumors and hematopoietic malignancies (41,42). For instance, it was found METTL3 depletion inhibited tumorigenicity and sensitized lung cancer cells to bromodomain-containing protein 4 inhibition (42). To the best of our knowledge, the present study was the first report to describe the role of METTL3 in CRC cells. METTL3 expression in HCT116 cells was found to be positively associated with proliferation and cancer invasion and to be negatively associated with apoptosis. These findings suggest that METTL3 functions as an oncogene in CRC, potentially by promoting the translation of other oncogenes. By contrast, METTL3 has been found to be a tumor suppressor in renal cell carcinoma (43). METTL3 has been demonstrated to promote cell proliferation, invasion and invasion in two human renal cell carcinoma cell lines (CAKI-1 and CAKI-2). These effects are mediated by modulation of the epithelial-to-mesenchymal transition and the PI3K-Akt-mTOR signaling pathway (43). The molecular mechanisms underlying the diverse roles of METTL3 in renal cell carcinoma and CRC remain to be elucidated. Through gain-of-function and siRNA oligo mediated loss-of-function experiments, a potential hsa_circ_0000523/miR-let-7b/METTL3 axis, which contributed to tumorigenesis and pathogenesis in the HCT116 human CRC cell line, was identified. METTL3 was demonstrated to promote proliferation and invasion and to inhibit apoptosis in HCT116 cells. The present study on the hsa_circ_0000523/miR-let-7b/METTL3 axis may facilitate highly sensitive diagnosis of CRC and improved prognosis prediction in patients following therapy.
  43 in total

Review 1.  Circular RNA: an emerging key player in RNA world.

Authors:  Xianwen Meng; Xue Li; Peijing Zhang; Jingjing Wang; Yincong Zhou; Ming Chen
Journal:  Brief Bioinform       Date:  2017-07-01       Impact factor: 11.622

2.  MicroRNA let-7: an emerging next-generation cancer therapeutic.

Authors:  D Barh; R Malhotra; B Ravi; P Sindhurani
Journal:  Curr Oncol       Date:  2010-02       Impact factor: 3.677

3.  Natural RNA circles function as efficient microRNA sponges.

Authors:  Thomas B Hansen; Trine I Jensen; Bettina H Clausen; Jesper B Bramsen; Bente Finsen; Christian K Damgaard; Jørgen Kjems
Journal:  Nature       Date:  2013-02-27       Impact factor: 49.962

4.  Heterogeneity of malignant cells from a human colonic carcinoma.

Authors:  M G Brattain; W D Fine; F M Khaled; J Thompson; D E Brattain
Journal:  Cancer Res       Date:  1981-05       Impact factor: 12.701

5.  Suppression of non-small cell lung tumor development by the let-7 microRNA family.

Authors:  Madhu S Kumar; Stefan J Erkeland; Ryan E Pester; Cindy Y Chen; Margaret S Ebert; Phillip A Sharp; Tyler Jacks
Journal:  Proc Natl Acad Sci U S A       Date:  2008-02-28       Impact factor: 11.205

6.  Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012.

Authors:  Jacques Ferlay; Isabelle Soerjomataram; Rajesh Dikshit; Sultan Eser; Colin Mathers; Marise Rebelo; Donald Maxwell Parkin; David Forman; Freddie Bray
Journal:  Int J Cancer       Date:  2014-10-09       Impact factor: 7.396

7.  The epitranscriptome m6A writer METTL3 promotes chemo- and radioresistance in pancreatic cancer cells.

Authors:  Kosuke Taketo; Masamitsu Konno; Ayumu Asai; Jun Koseki; Masayasu Toratani; Taroh Satoh; Yuichiro Doki; Masaki Mori; Hideshi Ishii; Kazuhiko Ogawa
Journal:  Int J Oncol       Date:  2017-12-07       Impact factor: 5.650

8.  Circular RNA hsa_circ_000984 promotes colon cancer growth and metastasis by sponging miR-106b.

Authors:  Xiao-Wu Xu; Bo-An Zheng; Zhi-Ming Hu; Zhen-Yuan Qian; Chao-Jie Huang; Xi-Qiang Liu; Wei-Ding Wu
Journal:  Oncotarget       Date:  2017-10-10

Review 9.  RNA N6-methyladenosine modification in cancers: current status and perspectives.

Authors:  Xiaolan Deng; Rui Su; Hengyou Weng; Huilin Huang; Zejuan Li; Jianjun Chen
Journal:  Cell Res       Date:  2018-04-23       Impact factor: 25.617

Review 10.  Circular RNAs in cancer: opportunities and challenges in the field.

Authors:  L S Kristensen; T B Hansen; M T Venø; J Kjems
Journal:  Oncogene       Date:  2017-10-09       Impact factor: 9.867

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.