Mohamed Mlih1, Jason Karpac1. 1. Department of Molecular and Cellular Medicine, Texas A&M University, College of Medicine, Bryan, Texas, United States of America.
Abstract
Balancing cellular demise and survival constitutes a key feature of resilience mechanisms that underlie the control of epithelial tissue damage. These resilience mechanisms often limit the burden of adaptive cellular stress responses to internal or external threats. We recently identified Diedel, a secreted protein/cytokine, as a potent antagonist of apoptosis-induced regulated cell death in the Drosophila intestinal midgut epithelium during aging. Here, we show that Diedel is a ligand for RGD-binding Integrins and is thus required for maintaining midgut epithelial cell attachment to the extracellular matrix (ECM)-derived basement membrane. Exploiting this function of Diedel, we uncovered a resilience mechanism of epithelial tissues, mediated by Integrin-ECM interactions, which shapes cell death spreading through the regulation of cell detachment and thus cell survival. Moreover, we found that resilient epithelial cells, enriched for Diedel-Integrin-ECM interactions, are characterized by membrane association of Catalase, thus preserving extracellular reactive oxygen species (ROS) balance to maintain epithelial integrity. Intracellular Catalase can relocalize to the extracellular membrane to limit cell death spreading and repair Integrin-ECM interactions induced by the amplification of extracellular ROS, which is a critical adaptive stress response. Membrane-associated Catalase, synergized with Integrin-ECM interactions, likely constitutes a resilience mechanism that helps balance cellular demise and survival within epithelial tissues.
Balancing cellular demise and survival constitutes a key feature of resilience mechanisms that underlie the control of epithelial tissue damage. These resilience mechanisms often limit the burden of adaptive cellular stress responses to internal or external threats. We recently identified Diedel, a secreted protein/cytokine, as a potent antagonist of apoptosis-induced regulated cell death in the Drosophila intestinal midgut epithelium during aging. Here, we show that Diedel is a ligand for RGD-binding Integrins and is thus required for maintaining midgut epithelial cell attachment to the extracellular matrix (ECM)-derived basement membrane. Exploiting this function of Diedel, we uncovered a resilience mechanism of epithelial tissues, mediated by Integrin-ECM interactions, which shapes cell death spreading through the regulation of cell detachment and thus cell survival. Moreover, we found that resilient epithelial cells, enriched for Diedel-Integrin-ECM interactions, are characterized by membrane association of Catalase, thus preserving extracellular reactive oxygen species (ROS) balance to maintain epithelial integrity. Intracellular Catalase can relocalize to the extracellular membrane to limit cell death spreading and repair Integrin-ECM interactions induced by the amplification of extracellular ROS, which is a critical adaptive stress response. Membrane-associated Catalase, synergized with Integrin-ECM interactions, likely constitutes a resilience mechanism that helps balance cellular demise and survival within epithelial tissues.
The evolution of organ systems and specified tissues in metazoans has been accompanied by unique mechanisms that enable these tissues to limit damage caused by external or internal threats. Most tissues thus employ mechanisms to both resist and tolerate such threats. While adaptive cellular stress responses are initiated to antagonize (or resist) these threats, tolerance (or resilience) is a strategy to reduce the negative impact of the same responses. Many cellular stress responses (such as inflated temperature, oxidative stress, or elevated protein folding stress) therefore operate at the cost of normal tissue function and can elicit damage. Resilience mechanisms, which limit the burden of these adaptive stress responses, can in part enhance tolerance to tissue damage through protection and/or repair [1]. These same resilience mechanisms can also be hijacked by cancer cells to promote their survival [2] and by viruses to enhance replication/abundance [3].Unique tissues have unique tolerance capacities. Epithelial tissues, which act as a barrier to the external environment and are often capable of renewal, generally have a high tolerance capacity and employ wide-ranging resilience mechanisms to limit damage [4,5]. Cells within these tissues are also more sensitive to various types of regulated (or programmed) cell death (RCD). RCD helps to aid in balancing cellular survival and demise, often in concert with tissue renewal processes, to promote tissue maintenance and attenuate tissue damage [6-9]. Many adaptive cellular stress responses impinge on these cell death pathways. Thus, RCD is a critical retort to irreversible cellular damage and must be precisely modulated to ensure proper epithelial tissue architecture and function in response to external or internal threats.RCD and epithelial cell demise are often driven by the caspase-dependent apoptosis signaling pathway [9,10] and is governed by a balance of positive and negative inputs. Cellular stresses, such as reactive oxygen species (ROS)-induced oxidative stress, can lead to irreversible damage, intrinsic activation of apoptosis, and execution of RCD. Importantly, cells undergoing autonomous RCD will subsequently influence the local extracellular microenvironment by stimulating a local proinflammatory response (such as promoting the accumulation of extracellular ROS) [11]. These changes in the extracellular microenvironment can perturb stress responses and homeostasis in “neighbor” cells, leading to a propagation of cell death through secondary spreading of apoptosis-induced RCD (i.e., cell death promoting more cell death [12,13]). Changes in the extracellular microenvironment of epithelial tissues will also have a profound impact on the basement membrane, the extracellular matrix (ECM) that supplies a structural (cell attachment) and biochemical (signaling) platform for surrounding cells [14]. To this end, ECM–cell interactions have a critical impact on cell death regulation. Balancing cellular demise and survival, likely in coordination with the ECM, thus constitutes a key feature of resilience mechanisms that underlie the control of epithelial tissue damage.The adult intestinal midgut of the arthropod Drosophila melanogaster provides an invaluable genetic model to explore ancestral resilience mechanisms of epithelial tissues. A simple (monolayer) barrier epithelium, the Drosophila midgut employs conserved stress responses to combat extrinsic (such as pathogens) or intrinsic (such as aging) threats, often through the coordination of cell death and tissue renewal. Our previous work identified Diedel, a protein secreted from peripheral tissues, as a potent antagonist of apoptosis-induced RCD in the intestinal midgut epithelium during aging, highlighting the integration of autonomous, local, and systemic responses in the control of cell death that shapes tissue damage [15]. Here, we show that Diedel is actually a ligand for RGD-binding Integrins, transmembrane receptors of epithelial cells that link the ECM with the cytoskeleton. Diedel thus shapes epithelial cell death by regulating cell–ECM interactions and cell attachment to the basement membrane. We also exploited Diedel function, as an in vivo genetic model, to explore ECM- and cell death–centric resilience mechanisms. Consequently, we uncovered a role for membrane-associated Catalase in preserving or repairing integrin–ECM interactions to maintain epithelial integrity. Intracellular Catalase, the ancient enzyme that is essential for quenching the ROS hydrogen peroxide, can relocalize to the extracellular membrane and limit ECM damage induced by the amplification of extracellular ROS after stress. This mechanism likely aids in maintaining epithelial structure and limits cell death spreading within the tissue. Membrane-associated Catalase can thus reduce the negative impact of adaptive cellular stress responses to limit epithelial tissue damage through preserving ECM–Integrin interactions and balancing cellular demise and survival.
Results
Diedel localizes at the basement membrane of the Drosophila midgut and shapes epithelial structure
We previously identified Diedel as a potent antagonist (inhibitor) of apoptosis-induced RCD both in vivo (in the adult Drosophila intestinal [midgut] barrier epithelium) and in vitro [15]. Diedel-dependent control of cell death significantly impacts both intestinal tissue aging and organismal lifespan [15] and possibly influences pathogen (virus)-mediated host defense mechanisms within the intestine [15,16]. As a secreted protein from peripheral (non-gastrointestinal) tissues (mainly produced and secreted from fat body/adipose tissue), Diedel represents a relatively unique molecule that can, likely, inhibit cell death extracellularly (adipose-to-midgut; [15]). Thus, we wanted to identify Diedel target proteins/receptors that could shape apoptosis and RCD in the Drosophila midgut epithelium. To this end, we first generated Diedel mutant fly lines using CRISPR-Cas9 genome engineering. Using this technology, 2 mutant lines were selected and characterized (S1A–S1D Fig). Mutant die contains a single nucleotide (I) deletion and (II) mismatch that leads to a frameshift in translation (S1A and S1B Fig). This mutant is viable, generating homozygote adults and fertile females, but sterile males (S1C and S1D Fig). A second line (die) contains a 5-nucleotide deletion that also leads to a frameshift in translation (S1A and S1B Fig), but these flies are not able produce viable homozygote adults due to lethality during development (during eclosion; S1C and S1D Fig). die/die trans-heterozygotes are viable, and additional analysis has revealed that the deletion in die likely impacts expression of a neighboring gene (CG2310), which influences developmental viability [16].We next used these mutant lines to explore Diedel’s role in shaping midgut epithelial architecture and integrity. This adult midgut epithelial layer in Drosophila mainly contains 4 types of cells: intestinal stem cells (ISCs), enterocytes (ECs), secretory enteroendocrine cells (EEs), and enteroblasts (EBs, a postmitotic cell that can differentiate as an EC). The presence of ISCs promotes midgut regeneration of functional enterocytes after damage and enterocyte cell death [7,17-19]. Enterocytes, which are large, polyploid cells that project microvilli into the lumen, drive both nutrient absorptive functions and defense mechanisms. Toward the basement membrane (opposite the lumen), the epithelium is surrounded by visceral muscle exposed to circulating hemolymph (arthropod blood) [20]. Eliminating Diedel (die/die or die/die) leads to a defect in the adult midgut epithelium characterized by enterocyte detachment from the basement membrane (Fig 1A and 1B, additionally characterized in S1E Fig). We also observed a defect in visceral muscle fusion/attachment associated with the midgut and hindgut (Fig 1C). Attenuating Diedel secretion from adipose (fat body) utilizing DiedelRNAi (CGGal4>UAS-DieRNAi) also promotes enterocyte detachment from the basement membrane (Fig 1D and 1E). Diedel is inducible (actively secreted) in response to external or internal (such as aging) threats in order to regulate tissue damage [15,16,21-23], and these data show that Diedel is likely also required for the proper development and maintenance of midgut epithelial structure.
Fig 1
Diedel is required for enterocyte attachment to the basement membrane.
(A) Dissected Drosophila posterior midgut cross sections from control (WT, revertant [rev.]), Diedel mutant homozygote (dieΔ1/dieΔ1), and Diedel mutant trans-heterozygote (dieΔ1/dieΔ2) flies; stained with Phalloidin (Phall.; purple) and DAPI (blue). (B) Distance quantification between posterior midgut enterocyte nuclei (identified as large nuclei; DAPI; blue) and visceral muscle (Phalloidin) from above genotypes; WT, revertant [rev.] n = 80; dieΔ1/dieΔ1, n = 119; dieΔ1/dieΔ2, n = 58. (C) Phalloidin staining (Phall.; red) of midgut and hindgut visceral muscle dissected from WT, dieΔ1/dieΔ1, and dieΔ1/dieΔ2 flies. (D) Dissected posterior midgut cross sections from control flies (w1118; CGGal4) and flies with fat body attenuation of Diedel (w1118; CGGal4 / UAS-Die RNAi); stained with Phalloidin (Phall.; purple) and DAPI (blue). (E) Distance quantification between posterior midgut enterocyte nuclei (identified as large nuclei; DAPI; blue) and visceral muscle (Phalloidin) from above genotypes; w1118; CGGal4, n = 45; w1118; CGGal4 / UAS-Die RNAi, n = 85. (F) Die-V5 localization in dissected Drosophila midguts from controls (negative control; w1118) and w1118; DieP-Die-V5 / DieP-Die-V5 transgenic flies; stained with anti-V5 antibody (Die-V5; red) and DAPI (blue). (G) Schematic of Drosophila midgut organization (basement membrane). (H) Integrin Mys immunostaining of dissected posterior midguts from control (WT, revertant [rev.]) and Diedel mutant (dieΔ1/dieΔ1) flies; bottom panel represents cross-section (apical–basal polarity is highlighted with arrow); stained with anti-Mys (green), Phalloidin (Phall.; purple), and/or DAPI (blue).(I) Integrin Mys immunostaining of dissected posterior midguts from control flies (w1118; CGGal4) and flies with fat body attenuation of Diedel (w1118; CGGal4 / UAS-Die RNAi); top panels represent cross-sections (apical–basal polarity is highlighted with arrow); stained with anti-Mys (green), Phalloidin (Phall.; purple), and/or DAPI (blue). Data information: Data in panels B and E are presented as mean ± SD, n = 45–109. *P ≤ 0.05 (Student t test). The data underlying the graphs shown in Fig 1B and 1E can be found in S1 Data.
Diedel is required for enterocyte attachment to the basement membrane.
(A) Dissected Drosophila posterior midgut cross sections from control (WT, revertant [rev.]), Diedel mutant homozygote (dieΔ1/dieΔ1), and Diedel mutant trans-heterozygote (dieΔ1/dieΔ2) flies; stained with Phalloidin (Phall.; purple) and DAPI (blue). (B) Distance quantification between posterior midgut enterocyte nuclei (identified as large nuclei; DAPI; blue) and visceral muscle (Phalloidin) from above genotypes; WT, revertant [rev.] n = 80; dieΔ1/dieΔ1, n = 119; dieΔ1/dieΔ2, n = 58. (C) Phalloidin staining (Phall.; red) of midgut and hindgut visceral muscle dissected from WT, dieΔ1/dieΔ1, and dieΔ1/dieΔ2 flies. (D) Dissected posterior midgut cross sections from control flies (w1118; CGGal4) and flies with fat body attenuation of Diedel (w1118; CGGal4 / UAS-Die RNAi); stained with Phalloidin (Phall.; purple) and DAPI (blue). (E) Distance quantification between posterior midgut enterocyte nuclei (identified as large nuclei; DAPI; blue) and visceral muscle (Phalloidin) from above genotypes; w1118; CGGal4, n = 45; w1118; CGGal4 / UAS-Die RNAi, n = 85. (F) Die-V5 localization in dissected Drosophila midguts from controls (negative control; w1118) and w1118; DieP-Die-V5 / DieP-Die-V5 transgenic flies; stained with anti-V5 antibody (Die-V5; red) and DAPI (blue). (G) Schematic of Drosophila midgut organization (basement membrane). (H) Integrin Mys immunostaining of dissected posterior midguts from control (WT, revertant [rev.]) and Diedel mutant (dieΔ1/dieΔ1) flies; bottom panel represents cross-section (apical–basal polarity is highlighted with arrow); stained with anti-Mys (green), Phalloidin (Phall.; purple), and/or DAPI (blue).(I) Integrin Mys immunostaining of dissected posterior midguts from control flies (w1118; CGGal4) and flies with fat body attenuation of Diedel (w1118; CGGal4 / UAS-Die RNAi); top panels represent cross-sections (apical–basal polarity is highlighted with arrow); stained with anti-Mys (green), Phalloidin (Phall.; purple), and/or DAPI (blue). Data information: Data in panels B and E are presented as mean ± SD, n = 45–109. *P ≤ 0.05 (Student t test). The data underlying the graphs shown in Fig 1B and 1E can be found in S1 Data.To further highlight a role for Diedel at the basement membrane, we generated transgenic flies that express a V5-tagged Diedel under the control of a 1,000-base pair region of the Diedel promotor (DieP-DieV5, inserted as an additional copy). Immunostaining confirmed that Diedel protein is present in the fat body/adipose (S1F Fig) but also localizes at the basement membrane of the Drosophila midgut epithelium (Fig 1F). To confirm this, we assessed Diedel localization (utilizing DieP-DieV5 flies) within a genetic background that endogenously expresses a multi-tag-GFP Laminin B1 (LanB1; [24]). The basal lamina is the layer of the ECM that is in direct contact with epithelial cells; it is formed by a self-assembling network of Laminin heterotrimers consisting of an alpha, beta, and gamma subunit [25,26]. Immunostaining confirmed colocalization of DieV5 with LanB1 at the midgut epithelium basement membrane (S1G Fig).In totality, these data suggest that secreted Diedel is necessary to maintain midgut epithelial integrity by enabling enterocyte (and potentially muscle cell) attachment to the basement membrane and that Diedel maybe is a critical component of the ECM associated with the basement membrane.
Diedel is an Integrin ligand, with a functional RGD domain, required for attaching epithelial cells to the ECM
The basement membrane of the midgut epithelium is comprised of various ECM components, including laminins, collagens, and proteoglycans [27-31]. Integrins are highly conserved transmembrane receptors, functioning as heterodimers of alpha and beta chains, which molecularly link the ECM to cell membranes through interactions with cytoskeletons (Fig 1G) [28,32]. These receptors are thus essential for epithelial cell attachment to the basement membrane. Drosophila enterocytes express 1 main integrin beta chain (Mys; Myospheroid) and 4 different alpha chains (Mew, If, Scb, and ItgaPS4) [33]. Focusing on Mys, Integrins are normally localized at the basal side (toward the basement membrane [ECM]) of enterocytes (Fig 1H and S2A Fig). However, when Diedel is eliminated (die/die) or cell-specifically attenuated (CGGal4>UAS-DieRNAi), Mys is delocalized from the enterocyte–ECM boundary (Fig 1H and 1I), suggesting that Diedel is necessary for Mys basal localization and maintaining apical–basal polarity (related to Integrin–ECM interactions) of enterocytes. Similar results were obtained utilizing a temperature sensitive driver to attenuate Diedel cell-specifically in the adult fly (PplGal4,TubGal80ts> UAS-DieRNAi; S2B Fig).Furthermore, utilizing DieP-DieV5 transgenic flies in a die/die mutant background, we found that Die-V5 binds to the basal side of enterocytes and colocalizes with the Integrin Mys (Fig 2A). This transgenic construct also shows that reexpressing Diedel (DieV5) can rescue the loss of Mys polarity in Diedel mutant flies (Fig 2A) and highlights that these Integrin delocalization phenotypes are, indeed, influenced by Diedel function.
Fig 2
Diedel is a ligand for RGD-binding Integrins.
(A) Integrin Mys and anti-V5 immunostaining of dissected posterior midguts from w1118; DieP-Die-V5 / DieP-Die-V5; dieΔ1/dieΔ1 transgenic flies; bottom panel represents cross-section (apical–basal polarity is highlighted with arrow); stained with anti-Mys (green), anti-V5 antibody (Die-V5; red), and DAPI (blue). (B) Diedel protein sequence and topology with RGD domain highlight in red. (C) Die-V5 and DieRGE-V5 protein sequences and nucleotide sequence alignment; nucleotide and amino acid substitution highlighted in blue (top panel). Bottom panel; western blot with anti-V5 antibody of conditioned media (supernatant) from S2R+ cells either nontransfected (Mock), transfected with Die-V5, or transfected with DieRGE-V5. (D) Transfection of S2R+ cells (control; pmT empty) with Inflated Integrin (pMT Inflated), plated on conditioned media (supernatant) containing Mock (control), Die-V5, or DieRGE-V5; cells stained with Phalloidin (Phall.; white). (E) Quantification of “cell spreading” assay in S2R+ cells plated on various conditioned medias. The percentage of “spread” cells is shown, and bars indicate mean ± SD from n = 3 independent experiments (approximately 100 cells counted in each experiment). *P ≤ 0.05 (Student t test). (F) Integrin Mys immunostaining of dissected posterior midguts from control flies (w1118; CGGal4) and flies with fat body expression of either wild-type Diedel (w1118; CGGal4 / UAS-Die) or Diedel RGE (w1118; CGGal4 / UAS-DieRGE#1), stained with anti-Mys (green), Phalloidin (Phall.; red), and/or DAPI (blue). The data underlying the graphs shown in Fig 2E can be found in S1 Data.
Diedel is a ligand for RGD-binding Integrins.
(A) Integrin Mys and anti-V5 immunostaining of dissected posterior midguts from w1118; DieP-Die-V5 / DieP-Die-V5; dieΔ1/dieΔ1 transgenic flies; bottom panel represents cross-section (apical–basal polarity is highlighted with arrow); stained with anti-Mys (green), anti-V5 antibody (Die-V5; red), and DAPI (blue). (B) Diedel protein sequence and topology with RGD domain highlight in red. (C) Die-V5 and DieRGE-V5 protein sequences and nucleotide sequence alignment; nucleotide and amino acid substitution highlighted in blue (top panel). Bottom panel; western blot with anti-V5 antibody of conditioned media (supernatant) from S2R+ cells either nontransfected (Mock), transfected with Die-V5, or transfected with DieRGE-V5. (D) Transfection of S2R+ cells (control; pmT empty) with Inflated Integrin (pMT Inflated), plated on conditioned media (supernatant) containing Mock (control), Die-V5, or DieRGE-V5; cells stained with Phalloidin (Phall.; white). (E) Quantification of “cell spreading” assay in S2R+ cells plated on various conditioned medias. The percentage of “spread” cells is shown, and bars indicate mean ± SD from n = 3 independent experiments (approximately 100 cells counted in each experiment). *P ≤ 0.05 (Student t test). (F) Integrin Mys immunostaining of dissected posterior midguts from control flies (w1118; CGGal4) and flies with fat body expression of either wild-type Diedel (w1118; CGGal4 / UAS-Die) or Diedel RGE (w1118; CGGal4 / UAS-DieRGE#1), stained with anti-Mys (green), Phalloidin (Phall.; red), and/or DAPI (blue). The data underlying the graphs shown in Fig 2E can be found in S1 Data.Integrin heterodimer receptors bind to specific Integrin ligands [31,34,35]. Integrin ligands are diverse but are required, in part, for maintaining functional ECM–Integrin–epithelial cell connectivity (i.e., maintaining cell attachment to the basement membrane). Integrin ligands are thus often components of the ECM. A motif analysis of the Diedel protein sequence revealed an RGD (Arg-Gly-Asp) domain within an accessible epitope in the Diedel protein (Fig 2B; [36]). In Drosophila, ECM proteins with an RGD domain have been shown to bind specifically to the Integrin heterodimer Myospheroid-Inflated (Mys-If; [37-40]). To determine if Diedel is an Integrin ligand, we turned to an in vitro “cell spreading” assay utilizing Drosophila S2R+ cells [39,41], as we had previously used these cells to inform on Diedel function [15]. First, we constructed in vitro expression plasmids containing either wild-type V5-tagged Diedel (DieRGD-V5) or a Diedel protein where the RGD sequence was replaced by an RGE (Arg-Gly-Glu) sequence (1 amino acid substitution, DieRGE-V5). This substitution is commonly used to inhibit the interaction between RGD domain ligands and Integrins [42]. Transfection of expression plasmids containing tagged RGD or RGE Diedel proteins in S2R+ cells revealed that these proteins are readily secreted into media (Fig 2C). Using conditioned media enriched with DieRGD-V5 or DieRGE-V5, we found that S2R+ cells transfected with Integrin Inflated are able to “spread” on a coated cover slip in the presence of DieRGD-V5 conditioned media, indicative of cell attachment and cytoskeletal rearrangement (Fig 2D and 2E) However, replacing the RGD domain with RGE in abolishes this “spreading” (DieRGE-V5; Fig 2D and 2E).To confirm the function of this Diedel RGD domain in vivo, we generated transgenic flies that express UAS-linked Diedel containing the RGD-to-RGE substitution used in vitro (UAS-DieRGE). Overexpression of DiedelRGE from the fat body (CGGal4>UAS-DieRGE) induced disorganization of the midgut epithelium characterized by enterocyte detachment and integrin (Mys) delocaliztion (Fig 2F, and additional transgenic line is characterized in S2C Fig). This phenotype is characteristic of Diedel mutants, suggesting that DiedelRGE can competitively antagonize normal Diedel (DiedelRGD) function.Taken together, these data show that Diedel is an ECM protein and an Integrin ligand, with a functional RGD domain. Diedel–Integrin–ECM interactions are thus required to maintain midgut epithelial tissue integrity through regulating epithelial cell attachment to the basement membrane.
Diedel–Integrin–ECM interactions antagonize cell death spreading by promoting cell survival
Next, we wanted to explore the connection between Diedel, the ECM, and Integrins in governing cell death in the midgut epithelium. Our previous work highlighted the ability of Diedel overexpression to robustly inhibit apoptosis-induced RCD in vitro and in vivo [15]. Apoptosis-induced RCD is highly conserved in Drosophila [9,10], as various apoptotic responses are mediated by initiator caspases (Dronc; Cas-9-like) [43] and effector caspases (DrICE [44] and Dcp-1 [45]; Cas-3-like), as well as a family of IAP (Inhibitor of apoptosis; DIAP1) antagonists (Hid [46], Reaper (Rpr) [47], and Grim [48]) governed by Jun-N-terminal kinase (JNK) activity (S3A Fig). In the Drosophila midgut, enterocyte cell death initiates tissue renewal (stem cell division/differentiation) in response to intrinsic and extrinsic cues. Our previous analysis of Diedel function in the control of apoptosis exclusively utilized endpoint analysis of RCD (measuring effector caspase activation and DNA fragmentation) [15]. Additionally, we were unable to find evidence that Diedel can regulate canonical intrinsic cell death responses during fly development (examples provided in S3B–S3F Fig). Thus, we hypothesized that Diedel is not able to inhibit apoptosis in cells that have already initiated regulated cell death. Instead, due to its presence in the ECM, Diedel may inhibit the propagation of cell death (cell death spreading via the extracellular environment) to neighboring cells. To test this, we exploited an in vitro trans-well cell culture system where damaged/dying cells are separated from undamaged cells via a 3-μm mesh membrane that permits small molecule transfer. First, we established that Diedel (using conditioned media with Die-V5) can bind membranes of Drosophila S2R+ cells after UV treatment (a stimuli that induces apoptosis; S2A Fig), again highlighting Diedel’s ability to associate with the ECM in cell culture (Fig 3A). Utilizing the trans-well culture system (Fig 3B), we found that UV-induced cell death can “spread” to non-UV-treated “neighbor” cells to induce RCD (assayed by Annexin V staining), and the secreted Diedel (conditioned media with Die-V5) can block these cell death responses transmitted via the extracellular microenvironment (Fig 3C). Furthermore, while Diedel cannot inhibit cell death that is stimulated directly by genetic induction of intrinsic caspase activation (through RNAi-mediated inhibition of DIAP [49]), it can potently block the spreading of cell death responses initiated by these irreversibly damaged (dying) apoptotic cells (Fig 3D).
Fig 3
Diedel prevents cell death spreading initiated by loss of Integrin–ECM interactions.
(A) Anti-V5 immunostaining of S2R+ cells before and after UV exposure (100 mJ/cm2); cells treated with Die-V5 conditioned media (supernatant); stained with anti-V5 antibody (Die-V5; red) and Phalloidin (Phall.; green). (B) Schematic representing coculture system to study cell death spreading in vitro. (B) UV-induced (100 mJ/cm2; +/− exposure) cell death spreading; quantified by percentage of Annexin V–positive cells. S2R+ cells treated with conditioned media (supernatant) containing Mock (control) or Die-V5. (C) Caspase (apoptosis)-induced (dsRNA targeting DIAP; dsRNA RFP as control) cell death spreading; quantified by percentage of Annexin V–positive cells. S2R+ cells treated with conditioned media (supernatant) containing Mock (control) or Die-V5. (D) Schematic of the ECM–Integrin–Talin complex; Cher (Cheerio) is an additional adaptor protein. (E) Talin immunostaining of dissected posterior midguts from control (WT, revertant [rev.]) and Diedel mutant (dieΔ1/dieΔ1 and dieΔ1/dieΔ2) flies; stained with anti-Talin (green) and DAPI (blue). (F) Talin immunostaining of dissected posterior midgut from control flies (w1118; CGGal4) and flies with fat body attenuation of Diedel (w1118; CGGal4 / UAS-Die RNAi); stained with anti-Talin (green), DAPI (blue), and Phalloidin (Phall.; red); bottom panel represents cross-section (apical–basal polarity is highlighted with arrow). (G) Integrin Mys and Caspase (cleaved Dcp-1) immunostaining of dissected posterior midguts from control (WT, revertant [rev.]) and Diedel mutant (dieΔ1/dieΔ1) flies; stained with anti-Mys (green), anti-Dcp-1 (Cleaved Dcp-1; red), and DAPI (blue). (H) Integrin Mys and Caspase (cleaved Dcp-1) immunostaining of dissected posterior midguts from control flies (w1118; CGGal4) and flies with fat body attenuation of Diedel (w1118; CGGal4 / UAS-Die RNAi); stained with anti-Mys (green), anti-Dcp-1 (Cleaved Dcp-1; red), and DAPI (blue). (I) Posterior midgut cross sections (apical–basal polarity is highlighted with arrow) from control (WT, revertant [rev.]) and Diedel mutant (dieΔ1/dieΔ1 and dieΔ1/dieΔ2) flies; stained with anti-cleaved Cas3 (green), DAPI (blue), and Phalloidin (Phall.; red). Strong staining of Cas3 (revealing cells detaching from the basement membrane) are highlighted by solid white arrowhead). Data information: Data in panels C and D are presented as mean ± SD, n = 3–5. *P ≤ 0.05 (Student t test). The data underlying the graphs shown in Fig 3C and 3D can be found in S1 Data.
Diedel prevents cell death spreading initiated by loss of Integrin–ECM interactions.
(A) Anti-V5 immunostaining of S2R+ cells before and after UV exposure (100 mJ/cm2); cells treated with Die-V5 conditioned media (supernatant); stained with anti-V5 antibody (Die-V5; red) and Phalloidin (Phall.; green). (B) Schematic representing coculture system to study cell death spreading in vitro. (B) UV-induced (100 mJ/cm2; +/− exposure) cell death spreading; quantified by percentage of Annexin V–positive cells. S2R+ cells treated with conditioned media (supernatant) containing Mock (control) or Die-V5. (C) Caspase (apoptosis)-induced (dsRNA targeting DIAP; dsRNA RFP as control) cell death spreading; quantified by percentage of Annexin V–positive cells. S2R+ cells treated with conditioned media (supernatant) containing Mock (control) or Die-V5. (D) Schematic of the ECM–Integrin–Talin complex; Cher (Cheerio) is an additional adaptor protein. (E) Talin immunostaining of dissected posterior midguts from control (WT, revertant [rev.]) and Diedel mutant (dieΔ1/dieΔ1 and dieΔ1/dieΔ2) flies; stained with anti-Talin (green) and DAPI (blue). (F) Talin immunostaining of dissected posterior midgut from control flies (w1118; CGGal4) and flies with fat body attenuation of Diedel (w1118; CGGal4 / UAS-Die RNAi); stained with anti-Talin (green), DAPI (blue), and Phalloidin (Phall.; red); bottom panel represents cross-section (apical–basal polarity is highlighted with arrow). (G) Integrin Mys and Caspase (cleaved Dcp-1) immunostaining of dissected posterior midguts from control (WT, revertant [rev.]) and Diedel mutant (dieΔ1/dieΔ1) flies; stained with anti-Mys (green), anti-Dcp-1 (Cleaved Dcp-1; red), and DAPI (blue). (H) Integrin Mys and Caspase (cleaved Dcp-1) immunostaining of dissected posterior midguts from control flies (w1118; CGGal4) and flies with fat body attenuation of Diedel (w1118; CGGal4 / UAS-Die RNAi); stained with anti-Mys (green), anti-Dcp-1 (Cleaved Dcp-1; red), and DAPI (blue). (I) Posterior midgut cross sections (apical–basal polarity is highlighted with arrow) from control (WT, revertant [rev.]) and Diedel mutant (dieΔ1/dieΔ1 and dieΔ1/dieΔ2) flies; stained with anti-cleaved Cas3 (green), DAPI (blue), and Phalloidin (Phall.; red). Strong staining of Cas3 (revealing cells detaching from the basement membrane) are highlighted by solid white arrowhead). Data information: Data in panels C and D are presented as mean ± SD, n = 3–5. *P ≤ 0.05 (Student t test). The data underlying the graphs shown in Fig 3C and 3D can be found in S1 Data.These data show that Diedel likely limits the propagation of cell death, preventing secondary spreading of apoptosis-induced RCD, and highlights a putative extrinsic mechanism to control RCD in insects. Since we found that Diedel is an ECM protein and can bind Integrins, we hypothesized that dying cells induce remodeling of the extracellular microenvironment, leading to the loss of ECM–Integrin interactions, epithelial cell detachment, and cell death [50]. To begin to address this complex hypothesis, we first explored the ability of Diedel to dictate Talin localization in the midgut epithelium in vivo. Functional interactions between Integrins and the ECM can be assessed by the recruitment of Talin at the cellular membranes, as Talin (along with other cofactors) is essential for ECM–Integrin–cytoskeleton attachments (Fig 3E) [51,52]. However, when Integrins are unligated (unable to interact with the basement membrane ECM), this can lead to mislocalization of Talin, which has been linked to cell detachment–mediated cell death [53]. Using immunostaining, we found that when Diedel is eliminated (die/die or die/die) or cell-specifically attenuated (CGGal4>UAS-DieRNAi), Talin is mislocalized to the cytoplasm of enterocytes (losing apical–basal polarity; Fig 3G; ctrl.) and can be also found in the nucleus (Fig 3F and 3G).Despite this significant loss of ECM–Integrin–cytoskeleton attachments, Diedel mutant midguts maintain barrier function and overall midgut cellular architecture (S3G Fig; assayed by midgut permeability [54,55]), while also displaying heightened renewal responses (ISC proliferation; S3H Fig). Expressly, it appears that not all epithelial cells execute apoptosis-induced RCD, something we had also discovered previously [15], despite significant increases in cell death markers and the breakdown in cell polarity (S3I Fig). Thus, we wanted to further explore extracellular-mediated cell death linked to ECM–Integrin function. Utilizing immunostaining in the Drosophila midgut, we found that loss of Integrin–ECM interactions, established by Diedel loss-of-function, is associated with the activation (cleavage) of the effector Caspase Dcp-1 in midgut enterocytes (Fig 3H and 3I). Cleaved Dcp-1 can be found enterocyte nuclei, suggesting that active Dcp-1 is translocated from the cytoplasm into the nucleus during progression through apoptosis, similar to Caspase-3 in mammalian cells [56]. Although, loss of nuclear membrane integrity leading to this phenotype cannot be excluded. Moreover, we also found cleaved Dcp-1 at the cellular plasma membrane (likely intracellular membranes, as Dcp-1 is not secreted). To this end, a focused analysis revealed that cleaved Dcp-1 does not colocalize at the basement membrane (with Mys) in Diedel mutant epithelial cells (S4A Fig) and instead appears to localize to enterocyte cell junctions (at intracellular enterocyte membranes). To confirm this, we found that cleaved Dcp-1 colocalizes with Dlg1 (Discs large 1) at enterocyte cell–cell junctions (S4B Fig). Dlg1 is a marker for septate junctions of epithelial cells, is required for enterocyte cell polarity [57], and is associated with cell death induced by cell detachment (anoikis) [58]. Recruitment of effector Caspases to cell junctions could limit the spread of cell death within epithelial tissues, attenuating or delaying the activation of terminal Caspases that lead to irreversible cellular demise as part of resistance mechanisms to limit tissue damage. Our data suggest that cell–cell interactions may be involved to prevent the execution of the apoptosis-induced cell death [59] by recruiting/retaining effector caspases at septate junctions. A similar mechanism was identified in vitro using a human colon epithelial cell line, where Cadherins (important for cell–cell adherens junctions) are involved in cell death protection by preventing activation/execution of the Caspase pathway [58]. Accordingly, we uncovered that in Diedel mutants (die/die or die/die), strong activation (cleavage) of Cas-3 in enterocytes (an indication of dying cells) is mainly revealed in epithelial cells that are detached (shedding) from the basement membrane and shifting apically toward the lumen (Fig 3J).To additionally characterize the role of Diedel–Integrin–ECM interactions in cell death and cell death spreading, we generated chimeric Integrin receptors that express the extracellular domain of Murine CD8 alpha conjugated to the transmembrane and intracellular domain of the Drosophila Integrin Mys (S5A Fig). Expression of these types of chimeric receptors were shown to mimic loss of Integrin–ECM interactions and can lead to cell death [60,61]. However, using this biochemical model, we were not able to show any direct cell death induction in Drosophila S2R+ cells (S5A–S5C Fig), suggesting at least that Diedel-and-Integrin–mediated loss of cell attachment to the basement membrane may not initiate cell death spreading or directly activate RCD. Alternatively, Integrin–membrane interactions are well known to preserve cell viability in response to stress through the activation of Raf / MEK (mitogen-activated ERK kinase) / ERK (extracellular signal–related kinase) signaling pathway (MAPK; [62,63]). Activation of the MAPK pathway in Drosophila was shown to specifically inhibit caspase activation [64]. Utilizing a temperature sensitive driver to attenuate or overexpress Diedel cell-specifically in the adult fly (PplGal4,TubGal80ts), we assessed MAPK pathway activation in the midgut epithelium using an antibody directed against phospho-ERK (immunostaining). Diedel overexpression (PplGal4,TubGal80ts>UAS-Die) leads to enhanced phospho-ERK immunostaining in midgut enterocytes (large nuclei; S5D Fig). This suggests that Diedel–Integrin–ECM interactions likely shape the balance of cell death and survival in epithelial tissues. Coupled with our previous work showing that Diedel is also essential to properly regulate midgut epithelial regeneration/renewal after stress [15], these findings highlight that Diedel–Integrin–ECM interactions promote resilience of epithelial tissues, i.e., the ability of epithelial tissues to endure stress and recover.In totality, by exploring Diedel function, our data show that Diedel, an Integrin ligand, is critical to promote resilience mechanisms that support the protection of epithelial tissues and poise cell death and survival.
Membrane-associated Catalase is necessary to prevent cell death spreading associated with Diedel–Integrin–ECM interactions
The ECM is a network of macromolecules that both provides cellular scaffolding and initiates critical biochemical and mechano-sensing cues that determine various cellular dynamics. This network is in perpetual transformation through the action of enzymes that build or disassemble the matrix and allow for cell migration, proliferation, or shedding, as well as directing signaling pathway activity, in order to coordinately promote epithelial tissue renewal/maintenance, and balance cellular demise and survival. To this end, we exploited Diedel’s role in cell survival, and its function as an Integrin ligand associated with extracellular membranes, to better characterize the response of resilient epithelial cells to stress-induced changes in the extracellular environment. First, we utilized S2R+ cells and unbiased mass spectrometry to explore the more complex interactome associated (directly or indirectly) with Diedel–Integrin–ECM interactions at cell membranes. UV treatment was used to induce Diedel localization (conditioned media with Die-V5) to cellular membranes of S2R+ cells followed by crosslinking (with paraformaldehyde), and Die-V5 was subsequently pulled down with putative membrane/ECM-associated proteins and separated through gel electrophoresis (Fig 4A). Crosslinking will create covalent bonds between proteins, driving the pulldown of putative direct interacting targets, but also indirectly associated proteins present at membranes (based on proximity) when Diedel–Integrin–ECM interactions are enriched. Mass spectrometry protein identification identified that the antioxidant enzyme Catalase (Cat) and Inositol-3-phosphate synthase (Inos) are associated at membranes when Diedel is also enriched (Fig 4A). To confirm these associations, since crosslinking likely creates large protein complexes that can be difficult to gel-separate, we repeated this pulldown, but instead of gel separation, we analyzed the entire elution fraction (again using mass spectrometry; Fig 4B and 4C, S1 Table). These data confirmed the presence of Catalase and Inos at cellular membranes enriched for Diedel–Integrin–ECM interactions and identified other putative membrane-associated proteins linked to antioxidant function (CaBP1; [65]) or Integrin function (Rack1; [66,67]).
Fig 4
Catalase associates with cellular membranes/ECM after stress.
(A) Mass spectrometry of gel-based pulldown analysis. Protein identification (gel elutions provided) after Die-V5 pulldown from S2R+ cells treated with control (Mock) or with Die-V5 conditioned media (supernatant); after stress (UV exposure; 100 mJ/cm2). Table represents Mass-Spec protein identification with percent protein coverage. (B) Mass spectrometry of gel-free pulldown analysis (Diedel-interacting proteins). Venn diagrams showing overlap of proteins after Die-V5 pulldown from S2R+ cells treated with control (Mock) or with Die-V5 conditioned media (supernatant); after stress (UV exposure; 100 mJ/cm2). The threshold for proteins included in the analysis was at least 2 different fragments identified/sequenced. (C) Histogram plotting percentage of protein enrichment in S2R+ cells treated with Die-V5 conditioned media after UV exposure. The analysis included only cytoplasmic and membrane proteins with at least 2 different fragments identified/sequenced. (D) Catalase and anti-V5 immunostaining of S2R+ cells after UV exposure (100 mJ/cm2); cells treated with Die-V5 conditioned media (supernatant) or Mock (control); stained with anti-V5 antibody (Die-V5; red) and anti-Catalase (green). Cells were not permeabilized (nonpermeabilized) with detergent in order to visualize membrane/ECM proteins. (E) Catalase localization in primary cells expressing endogenous catalase tagged with GFP (green) after UV exposure (100 mJ/cm2); cells treated with Die-V5 conditioned media (supernatant) or Mock (control); stained with anti-V5 antibody (Die-V5; red). (F) UV-induced (100 mJ/cm2; +/− exposure) cell death quantification by percentage of TUNEL-positive cells. S2R+ cells were treated with dsRNA control (RFP) or dsRNA Catalase (cat), then exposed to UV (100 mJ/cm2) and treated with Die-V5 conditioned media (supernatant) or Mock (control). Data information: Data in panel F are presented as mean ± SD, n = 8–14. *P ≤ 0.05 (Student t test). The data underlying the graphs shown in Fig 4B can be found in S1 Table, and the data underlying the graphs shown in Fig 4C and 4F can be found in S1 Data.
Catalase associates with cellular membranes/ECM after stress.
(A) Mass spectrometry of gel-based pulldown analysis. Protein identification (gel elutions provided) after Die-V5 pulldown from S2R+ cells treated with control (Mock) or with Die-V5 conditioned media (supernatant); after stress (UV exposure; 100 mJ/cm2). Table represents Mass-Spec protein identification with percent protein coverage. (B) Mass spectrometry of gel-free pulldown analysis (Diedel-interacting proteins). Venn diagrams showing overlap of proteins after Die-V5 pulldown from S2R+ cells treated with control (Mock) or with Die-V5 conditioned media (supernatant); after stress (UV exposure; 100 mJ/cm2). The threshold for proteins included in the analysis was at least 2 different fragments identified/sequenced. (C) Histogram plotting percentage of protein enrichment in S2R+ cells treated with Die-V5 conditioned media after UV exposure. The analysis included only cytoplasmic and membrane proteins with at least 2 different fragments identified/sequenced. (D) Catalase and anti-V5 immunostaining of S2R+ cells after UV exposure (100 mJ/cm2); cells treated with Die-V5 conditioned media (supernatant) or Mock (control); stained with anti-V5 antibody (Die-V5; red) and anti-Catalase (green). Cells were not permeabilized (nonpermeabilized) with detergent in order to visualize membrane/ECM proteins. (E) Catalase localization in primary cells expressing endogenous catalase tagged with GFP (green) after UV exposure (100 mJ/cm2); cells treated with Die-V5 conditioned media (supernatant) or Mock (control); stained with anti-V5 antibody (Die-V5; red). (F) UV-induced (100 mJ/cm2; +/− exposure) cell death quantification by percentage of TUNEL-positive cells. S2R+ cells were treated with dsRNA control (RFP) or dsRNA Catalase (cat), then exposed to UV (100 mJ/cm2) and treated with Die-V5 conditioned media (supernatant) or Mock (control). Data information: Data in panel F are presented as mean ± SD, n = 8–14. *P ≤ 0.05 (Student t test). The data underlying the graphs shown in Fig 4B can be found in S1 Table, and the data underlying the graphs shown in Fig 4C and 4F can be found in S1 Data.We decided to focus on Catalase, since metazoan Catalase is normally found within the cytoplasm in order to decompose intracellular hydrogen peroxide (ROS), and identifying Catalase at cellular membranes was unexpected. Although, extracellular Catalase has been linked with transformation of cancer cells [68] and characterization of purified Catalase from Drosophila suggested a significant fraction may be membrane bound [69]. We confirmed in vitro that Catalase colocalize at cellular membranes of Diedel-positive cells after stress (Fig 4D). Using a Catalase antibody, Catalase can be uncovered intracellularly in S2R+ cells before and after stress (UV treatment; S6A Fig). However, in the absence of cell permeabilization (sequestering antibodies outside of the cell), we found Catalase at cellular membranes after stress (Fig 4D). We confirmed these results, in vitro, utilizing primary embryonic Drosophila cells derived from flies containing an endogenously tagged (GFP) Catalase within the genome [70] (Cat-GFP; Fig 4E and S5B Fig). While Catalase is present at membranes enriched for Diedel–Integrin–ECM interactions, co-immunoprecipitations in native (non-crosslinking) conditions revealed that Diedel and Catalase do not directly interact (S5C Fig), and thus Catalase is likely part of a larger membrane interactome, associated with Integrin–ECM interactions, which may shape cell death and survival responses. To this end, we also found that Catalase is required for the ability of Diedel to prevent cell death in vitro (Fig 4F).In Drosophila, dying epithelial cells (midgut enterocytes) increase ROS generation [11]. Thus, ROS (likely extracellular ROS such as hydrogen peroxide) may promote cell death spreading and ECM remodeling/degradation through oxidation to drive cell detachment from the basement membrane. It is probable that extracellular ROS generation needs to be tightly controlled to avoid cell death spreading from the dying cells within epithelial tissues. We hypothesized that membrane-associated Catalase could play a critical role in reestablishing Redox (ROS-mediated reduction/oxidation) balance to prevent cell death spreading, repair/preserve ECM–Integrin interactions, and promote tissue resilience after stress. To test this, we first confirmed that Catalase can localize to membranes in vivo. Using a Catalase antibody, we found extracellular Catalase in the midgut epithelium after DSS treatment/feeding (Fig 5A). DSS (a derivative of dextran) induces ROS, as well as alter the basement membrane and promote tissue damage in the Drosophila midgut [71]. Membrane-associated Catalase was visualized by utilizing nonpermeable conditions. To determine if membrane-associated Catalase can be found nonautonomously in response to epithelial cell death, we generated RFP-marked clones (using MARCM [mosaic analysis with a repressible cell marker] in the Cat-GFP genetic background) in the midgut expressing both the proapoptotic caspase initiator Reaper (UAS-Rpr; see also S3A Fig) and an inhibitor of apoptosis (UAS-P35) [72,73]. Coexpression of Reaper and the baculovirus P35 creates “undead” cells; cells initiating, but not completing, apoptosis [11,73-75]. This MARCM clonal analysis was performed within transgenic flies containing the endogenously tagged Catalase-GFP (S5B Fig). Indeed, immunostaining revealed Catalase relocalizing to membranes in cells adjacent (“neighbor”) to “undead” midgut clones (Fig 5B), suggesting that membrane-associated Catalase may be critical in regulating cell death spreading in synergy with Integrin–ECM interactions.
Fig 5
Catalase relocalization to membranes is integrated with cell death spreading and extracellular ROS after epithelial tissue damage.
(A) Catalase immunostaining of dissected posterior midguts from control (w1118, Ctrl.) flies with DSS treatment/feeding (4% DSS) or mock treatment; stained with anti-Catalase (green) and DAPI (blue). Flies were fed (or Mock treated) DSS for 2 days. Immunostaining was performed in both permeabilized (to visualize intracellular Catalase) and nonpermeabilized (to visualize extracellular Catalase) conditions. (B) Cat-GFP immunostaining in dissected midguts from control (Ctrl.) MARCM clones and “Undead” MARCM clones 5 days after heat shock. Clones are marked with nuclear RFP (red), endogenously GFP-tagged Catalase (Catalase-GFP/+) are marked with GFP (green). White arrows highlight membrane localized Catalase in adjacent (“neighbor”) cells of “undead” MARCM clones. (C) Catalase localization and membrane/ECM cysteine oxidation of dissected posterior midguts from w1118, Catalase-GFP / Catalase-GFP (endogenously tagged) flies; DSS treatment/feeding (4% DSS), or mock treatment, or cotreatment/feeding with a Catalase inhibitor (DSS + 3-AT); stained with anti-Catalase (green), anti-Cysteine (oxidized, Cys. Ox; red), and DAPI (blue). Immunostaining was performed in nonpermeabilized conditions to visualize membrane/ECM cysteine oxidation. Panels represent cross-sections (apical–basal polarity is highlighted with arrow). Flies were fed (or Mock treated) DSS or DSS + 3-AT for 2 days. ECM, extracellular matrix; MARCM, mosaic analysis with a repressible cell marker; ROS, reactive oxygen species.
Catalase relocalization to membranes is integrated with cell death spreading and extracellular ROS after epithelial tissue damage.
(A) Catalase immunostaining of dissected posterior midguts from control (w1118, Ctrl.) flies with DSS treatment/feeding (4% DSS) or mock treatment; stained with anti-Catalase (green) and DAPI (blue). Flies were fed (or Mock treated) DSS for 2 days. Immunostaining was performed in both permeabilized (to visualize intracellular Catalase) and nonpermeabilized (to visualize extracellular Catalase) conditions. (B) Cat-GFP immunostaining in dissected midguts from control (Ctrl.) MARCM clones and “Undead” MARCM clones 5 days after heat shock. Clones are marked with nuclear RFP (red), endogenously GFP-tagged Catalase (Catalase-GFP/+) are marked with GFP (green). White arrows highlight membrane localized Catalase in adjacent (“neighbor”) cells of “undead” MARCM clones. (C) Catalase localization and membrane/ECM cysteine oxidation of dissected posterior midguts from w1118, Catalase-GFP / Catalase-GFP (endogenously tagged) flies; DSS treatment/feeding (4% DSS), or mock treatment, or cotreatment/feeding with a Catalase inhibitor (DSS + 3-AT); stained with anti-Catalase (green), anti-Cysteine (oxidized, Cys. Ox; red), and DAPI (blue). Immunostaining was performed in nonpermeabilized conditions to visualize membrane/ECM cysteine oxidation. Panels represent cross-sections (apical–basal polarity is highlighted with arrow). Flies were fed (or Mock treated) DSS or DSS + 3-AT for 2 days. ECM, extracellular matrix; MARCM, mosaic analysis with a repressible cell marker; ROS, reactive oxygen species.We next wanted to assay Catalase-dependent changes in extracellular ROS in the midgut epithelium. Directly measuring extracellular ROS and H2O2 specifically in vivo is challenging, so we choose an indirect approach. Cysteine-rich proteins, such as Laminins, Secreted protein acidic and rich in cysteine (SPARC), and even Diedel, are abundant in the intestinal epithelium ECM. Thus, cysteine disulfide bond plays an important role in ECM protein–protein interactions and cohesion. The thiol group of cysteine is sensitive to ROS (or Redox balance) in the extracellular microenvironment. Exploiting a dimedone-based chemical probe, coupled with an antibody, to explore changes in thiol oxidation [76], we can indirectly measure extracellular ROS. Although dimedone is permeable, we performed secondary immunostaining in nonpermeable conditions to sequester antibodies extracellularly and thus visualize the oxidation status of extracellular thiol-cysteines. Using transgenic flies containing the endogenously tagged Cat-GFP (S5B Fig), we found that DSS treatment/feeding leads to increases oxidized cysteines at the ECM/membrane of enterocytes, which also correlates with Catalase localization to membranes (Fig 5C).Furthermore, cotreatment/feeding with 3-amino-1,2,4-triazole (3-AT), an irreversible Catalase inhibitor [77], enhances DSS-mediated increases in extracellular oxidation of cysteines and promotes enterocyte detachment (Fig 5C and S5D Fig). This increase in staining likely represents, in part, changes in extracellular ROS and suggests that Catalase (putatively membrane-associated Catalase) dictates Redox balance within the ECM/membranes of epithelial tissues. Accordingly, Catalase inhibition attenuates the recovery of the midgut epithelium, as the presence of oxidized cysteines is still prevalent 48 hours posttreatment/feeding of DSS (Fig 6A). Even when Catalase function is inhibited, which drives increases in intracellular and extracellular ROS, Catalase still relocalizes at midgut enterocyte membranes, suggesting that these molecular changes underly resilience mechanisms in epithelial tissues. Membrane-associated Catalase is thus likely required to limit the burden of adaptive stress responses that generate extracellular ROS and subsequently limit tissue damage.
Fig 6
Membrane-associated Catalase is necessary to promote ECM preservation / repair and prevent cell death spreading in concert with Diedel–Integrin–ECM interactions.
(A) Membrane/ECM cysteine oxidation of dissected posterior midguts from w1118 (Ctrl.) flies; DSS treatment/feeding (4% DSS), or mock treatment, or cotreatment/feeding with a Catalase inhibitor (DSS + 3-AT), as well as 48 hours posttreatment (recovery after DSS feeding); stained with anti-Cysteine (oxidized, Cys. Ox; red) and DAPI (blue). Immunostaining was performed in nonpermeabilized conditions to visualize membrane/ECM cysteine oxidation. Flies were fed (or Mock treated) DSS or DSS + 3-AT for 2 days. (B) Integrin Mys and Caspase (cleaved Dcp-1) immunostaining of dissected posterior midguts from control (w1118) flies after DSS treatment/feeding (4% DSS), or mock treatment, or cotreatment/feeding with a Catalase inhibitor (DSS + 3-AT); stained with anti-Mys (green), anti-Dcp-1 (Cleaved Dcp-1; red), and DAPI (blue). Flies were fed (or Mock treated) DSS or DSS + 3-AT for 2 days. (C) Coculture system to study cell death spreading in vitro. UV-induced (100 mJ/cm2) cell death spreading; quantified by percentage of TUNEL-positive cells. S2R+ cells treated with conditioned media (supernatant) containing Mock (control) or Die-V5, and Catalase (3-AT), (D) Images of TUNEL immunostaining from cocultured S2R+ cells; UV-induced (100 mJ/cm2) cell death spreading. Cells treated with conditioned media (supernatant) containing Mock (control) or Die-V5, and Catalase inhibitor (3-AT). TUNEL (nuclear, green), DAPI (blue), phalloidin (membrane, red). Data information: Data in panel C are presented as mean ± SD, n = 9. *P ≤ 0.05 (Student t test). The data underlying the graphs shown in Fig 6C can be found in S1 Data.
Membrane-associated Catalase is necessary to promote ECM preservation / repair and prevent cell death spreading in concert with Diedel–Integrin–ECM interactions.
(A) Membrane/ECM cysteine oxidation of dissected posterior midguts from w1118 (Ctrl.) flies; DSS treatment/feeding (4% DSS), or mock treatment, or cotreatment/feeding with a Catalase inhibitor (DSS + 3-AT), as well as 48 hours posttreatment (recovery after DSS feeding); stained with anti-Cysteine (oxidized, Cys. Ox; red) and DAPI (blue). Immunostaining was performed in nonpermeabilized conditions to visualize membrane/ECM cysteine oxidation. Flies were fed (or Mock treated) DSS or DSS + 3-AT for 2 days. (B) Integrin Mys and Caspase (cleaved Dcp-1) immunostaining of dissected posterior midguts from control (w1118) flies after DSS treatment/feeding (4% DSS), or mock treatment, or cotreatment/feeding with a Catalase inhibitor (DSS + 3-AT); stained with anti-Mys (green), anti-Dcp-1 (Cleaved Dcp-1; red), and DAPI (blue). Flies were fed (or Mock treated) DSS or DSS + 3-AT for 2 days. (C) Coculture system to study cell death spreading in vitro. UV-induced (100 mJ/cm2) cell death spreading; quantified by percentage of TUNEL-positive cells. S2R+ cells treated with conditioned media (supernatant) containing Mock (control) or Die-V5, and Catalase (3-AT), (D) Images of TUNEL immunostaining from cocultured S2R+ cells; UV-induced (100 mJ/cm2) cell death spreading. Cells treated with conditioned media (supernatant) containing Mock (control) or Die-V5, and Catalase inhibitor (3-AT). TUNEL (nuclear, green), DAPI (blue), phalloidin (membrane, red). Data information: Data in panel C are presented as mean ± SD, n = 9. *P ≤ 0.05 (Student t test). The data underlying the graphs shown in Fig 6C can be found in S1 Data.Disulfide bond formation is also critical to integrate Laminin to basement membrane and thus maintain ECM architecture and interactions with Integrins [78]. To confirm a role for Catalase in ECM–Laminin incorporation, we isolated Drosophila midgut ECM proteins by decellularizing the gut (S7A Fig) and resolving ECM/extracellular proteins on a gel. Treatment/feeding of the Catalase inhibitor 3-AT leads to a decrease of LanB2 incorporation into the ECM of midgut epithelium (S7B and S7C Fig). DSS-mediated changes in ECM structure correlate with delocalization of the Integrin Mys from the enterocyte–ECM boundary, as well as activation (cleavage) of the effector Caspase Dcp-1 in midgut enterocytes (Fig 6B). These data were confirmed using genetic inhibition (RNAi) of Catalase in enterocytes (NP1G4, TubG80ts>UAS-CatRNAi; S7D and S7E Fig).Finally, in order to explore the synergy between Diedel–Integrin–ECM interactions and membrane-associated Catalase in the regulation of cell death spreading, we returned to our trans-well cell culture system (Fig 3A–3C). Diedel’s ability to block the extracellular propagation of UV-induced cell death to non-UV treated “neighbor” cells (and promote survival) is significantly limited when Catalase function is inhibited (using the 3-AT inhibitor; Fig 6C and 6D). These data show that Catalase, and likely extracellular and/or membrane-associated Catalase, is necessary to prevent cell death spreading and promote cell survival driven by Diedel–Integrin–ECM interactions (S7F Fig).
Discussion
Taken together, these data highlight the synergy between Diedel–Integrin–ECM interactions and membrane-associated Catalase in promoting resilience of epithelial tissues through balancing cellular demise and survival. This synergy prevents the accumulation extracellular ROS (maintaining Redox balance), thus preserving or repairing ECM–Integrin interactions and attenuating the spread of cell death by maintain epithelial cell attachment to the basement membrane. Diedel–Integrin–ECM interactions are therefore critical to limit the burden of adaptive stress responses and mitigate epithelial tissue damage.Cell death by cell detachment (or anoikis) was originally discovered in vitro using human umbilical vein endothelial cells [79,80]. It was shown that cells grown in suspension undergo cell death that was initiated by a loss of ECM–Integrin interactions. Highlighting the importance of this type of cell death mechanism, resistance to anoikis is likely a vital step during cancer progression within tissues and metastatic colonization [81]. Although this mechanism can be identified in vivo in mammalian epithelial models, it remains difficult to characterize in vivo. The Drosophila intestinal (midgut) epithelium provides a reliable genetic model to mechanistically explore epithelial tissue homeostasis. A recent study in Drosophila identified the NF-kB–dependent innate immune pathway as a critical regulator of midgut enterocyte shedding (cell detachment) after enteric bacterial infection [82]. Through the identification of secreted Diedel as an ECM protein, present at the basement membrane of epithelial cells, our data highlight a role for ECM–Integrin interactions in the regulation of cell detachment and cell death. We showed that Diedel can bind to Drosophila Integrins Mys/If through its RGD domain, and the loss of these interactions can lead to cell detachment and initiation of a Caspase-dependent apoptotic pathway. Although loss of Integrin–ECM interactions leads to the activation of the Caspases, we found that the execution of the cell death occurs only when cells detach from the basement membrane and leave the epithelial layer. This distinct mode of cell death likely aids in the balance of cellular demise and survival, enables tissue resilience, and promotes epithelial tissue integrity (prevents excessive cell death and tissue damage).Furthermore, using Diedel mutants as a model to mimic the loss of epithelial cell–ECM interaction, we uncovered resilience mechanisms utilized by epithelial tissues to maintain tissue integrity. We found that intracellular Catalase is able to relocalize to the membrane and/or extracellular environment of epithelial enterocytes, likely preventing cell death spreading through elimination of extracellular ROS. In another recent study exploiting Drosophila genetics, it was shown that certain midgut enterocytes (“transiently undead” cells that allow for segregation of apoptotic and nonapoptotic functions of Caspases) can recruit Dronc (through Myo1D) to the NADPH oxidase Duox at the membrane, which drives extracellular ROS production [11]. NADPH oxidases are one of the major generators of cellular/extracellular ROS across taxonomic kingdoms. Additionally, Duox localization at the membrane after Caspase activation can likely lead to cell death spreading through enhancing extracellular ROS [74]. Coupled with our findings presented here, these data suggest that equilibrating extracellular ROS accumulation induced by dying cells (adaptive stress responses) with quenching of extracellular ROS in nearby cells, potentially through membrane-associated Catalase, is critical to promote resilience of epithelial tissues and balance cell death/survival. A similar mechanism was observed in vitro in cancer cells, where translocation of Catalase to the outside of the cell membranes was associated with cellular transformation and tumor progression [68]. Thus, it is likely that resilience mechanisms, such as those driven by membrane-associated Catalase, can be hijacked by cancer cells to resist anoikis and maintain cell–ECM interactions and cell attachment to basement membranes.Overall, our data shed light on the plasticity of epithelial tissues, where resistance and resilience mechanisms cooperate to maintain tissue integrity and prevent damage. Fundamentally, these mechanisms are crucial when epithelial tissues are presented with internal or external threats (and when cell death is elevated as part of adaptive stress responses) but are also likely to represent mechanisms that partly underlie the etiology of certain diseases (such as cancer).
Materials and methods
Drosophila melanogaster husbandry and strains
The following strains were obtained from the Bloomington Drosophila Stock Center: w1118, Actin-Cas9 (#54590), UAS-Rpr (#5824), Catalase-GFP(#60212), DaGal4 (#55851), GmrGal4 (#1104), UAS-Egr (#51283), UAS-p35 (#5072), UAS-RedStinger (#8545), PplGal4 was a gift from M. Pankratz, NP1Gal4 was a gift from D. Ferrandon, CGGal4 was a gift from C. Thummel, UAS-HepAct, and Sep-Gal4 was a gift from H. Jasper. LanB1-GFP (# v318180) was obtained from Vienna Drosophila Resource Center. UAS-DieRNAi and UAS-Die were previously generated in our lab [15]. Diedel mutant flies (die and die), Diedel gRNA flies, DieP-DieV5, UAS-DieRGE#1, and UAS-DIeRGE#2 transgenic flies were generated for this study.All flies (expect for Diedel mutants) used in this study were backcrossed ×10 into the w1118 background, with continued backcrossing every 6 to 8 months to maintain isogenecity. Diedel mutant flies (die and die) were compared to a revertant strain (WT) without underlying changes in gene sequence after CRISPR-Cas9 to match genetic background. All flies were reared on and feed a standard yeast- and cornmeal-based diet at 25°C and 65% humidity on a 12-hour light/dark cycle, unless otherwise indicated. The diet was made with the following protocol: 14 g agar/ 165.4 g malt extract/ 41.4 g dry yeast/ 78.2 g cornmeal/ 4.7 ml propionic acid/ 3 g methyl 4-hydroxybenzoate/ 1.5 L water. Progeny of crosses were reared in standard fly bottles using this diet. Emerging adult flies were mated and maintained on this diet in standard fly vials (approximately 20 female flies per vial) before dissection or analysis.For 3-Amino-1,2,4-triazole (3-AT, Acros Organics) feeding/treatment, 3-AT was mixed into the standard lab diet, resulting in a final concentration of 10 μM.For DSS (dextran sulfate sodium salt colitis grade [MW 36,000 to 50,000]; MP Biomedicals) feeding/treatment, a 4% solution of DSS (dissolved in 5% sucrose) was thatched on top of standard lab food vials. Mock controls were fed just a 5% sucrose solution.Female flies were used for all experiments due to sex-specific differences in midgut regeneration. All adult flies were aged 7 to 10 days before dissection/analysis.
Generation of transgenic Drosophila
die and die mutant Drosophila were generated using CRISPR-Cas9. Briefly, a transgenic fly line expressing Cas9 protein using the ubiquitous promoter actin was crossed to a second fly line expressing a custom Diedel guide RNA (gRNA). The cross produces offspring with an active Cas9–gRNA complex, which cleaves and mutates the target site. The following gRNA sequence was used for Diedel mutant flies: GTCAGCCTGCTTCTCGTCGG. To confirm the absence of Diedel protein with underlying base pair changes in die and die mutants, Diedel mutant genomic loci were cloned into the pAC5.1 V5 (using standard Die cloning primers; S2 Table) and transfected/expressed in S2R+ cells. Immunoblotting with anti-V5 was used to confirm the absence of tagged protein in vitro in cell homogenate and the supernatant (secreted).To generate DieP-DieV5 transgenic Drosophila, we used the plasmids pB-DieP-RFP and pAC5.1-DieV5 from our previous study [15] and replaced RFP sequence from pB-DieP-RFP with Diedel cDNA tagged with V5-His from pAC5.1-DieV5. The new plasmid pB-DieP-DieV5 was injected into w1118 embryos; attp40 embryos with a phiC31 integrase helper plasmid (Rainbow Transgenic Flies).To generate UAS-DieRGE#1 and UAS-DieRGE#2 transgenic Drosophila, we used the pAC5.1 DieRGE plasmid generated for this study (see Cf Plasmid Construction section below) and subcloned DieRGE-V5 sequence into the pUASt plasmid (DGRC #1000). The new plasmid pUASt-DieRGE was injected into w1118 embryos (Rainbow Transgenic Flies).
Conditional expression of UAS-linked transgenes
The NP1Gal4 or PplGal4 drivers were combined with a ubiquitously expressed temperature sensitive Gal80 inhibitor (TubGal80ts). Crosses and flies were kept at 18°C (permissive temperature), and 5-day-old females were shifted to 29°C for 2 days to allow expression of the transgenes and then fed for another 2 days with DSS or sucrose (as describe in Drosophila melanogaster husbandry and strains section) at 29°C.
MARCM analysis
To generate undead cells clones in the midgut, w;UAS-Rpr,UAS-p35;Cat-GFP,FRT82B/TM3 flies were crossed with y,w,hsFLP,UAS-RedStinger3;;tub-gal4, FRT82B,TubGal80/TM6B flies. For the Control clone, w;;Cat-GFP,FRT82B/TM3 flies were crossed with y,w,hsFLP,UAS-RedStinger3;;tub-gal4, FRT82B,TubGal80/TM6B flies. For midgut clone induction, progeny (4 to 5 days post-eclosion and after mating) of the correct genotype were heat shocked at 37°C for 45 minutes. Approximately 5 days after heat shock, midguts were dissected and MARCM clones were analyzed.
Intestinal permeability (“Smurf”) assay
Flies were aged on standard food until the day of the assay. Dyed food was prepared using a standard food recipe supplemented with blue dye no. 1 (Erioglaucine, ER120; Spectrum) at 2.5% (wt/vol). Flies were maintained on dyed food overnight. A fly was counted as a Smurf when the dye coloration could be observed outside the gastrointestinal tract.
Immunostaining and microscopy in vivo
Intact midguts (flies aged 7 to 10 days) were dissected and fixed at room temperature for 30 minutes in 100 mM glutamic acid, 25 mM KCl, 20 mM MgSO4, 4 mM sodium phosphate, 1 mM MgCl2, and 4% formaldehyde. All subsequent incubations were done in PBS, 0.5% BSA, and 0.1% Triton X-100 at 4°C. The following primary antibodies were used: mouse anti phospho-Histone 3 (Cell Signaling 9701, 1:1,000), cleaved Cas-3 (Cell Signaling 9661, 1:100), cleaved Dcp-1 (Cell Signaling 9578, 1:1,000), Phospho-ERK (Cell Signaling #4370; 1:1,000), His-tag (Cell Signaling #12698 1:1,000) Catalase H9 (Santa Cruz SC-271803, 1:100), and V5 tag (Sigma V8137, 1:500), Flag Tag M2 (F1804 Sigma, 1:500), anti-GFP 3E6 (Thermo Fisher # A-11120 1:100). Mouse anti-Mys CF.6G11 (1:100), Mouse Anti-Nub 2D4 (Pdm1) (1:100), and mouse anti-Dlg1 4F3 (1:100) were acquired form the Developmental Studies Hybridoma Bank. Fluorescent secondary antibodies were obtained from Jackson Immunoresearch. Hoechst (1:1,000) was used to stain DNA.For Talin immunostaining, intact midgut were dissected in PBS and fixed with 4% paraformaldehyde for 20 minutes at room temperature, washed 3 times with PBS containing 0.1% Triton X-100 (PBST), then midguts were incubated with boiled citrate buffer (10 mM sodium citrate, 0.05% Tween 20 (pH 6.0)) at room temperature for 15 minutes, washed 3 times with PBS then blocked in blocking buffer (5% BSA in PBST) for 1 hour. Primary antibody mouse anti-Talin A22A (1:100, acquired from Developmental Studies Hybridoma Bank) was applied overnight at 4°C. Alexa Fluor–conjugated secondary (Jackson Immunoresearch, 1:500) antibodies were incubated for 2 hours at room temperature. Hoechst was used to stain DNA, and Phalloidin (Alexa 633 or Rhodamin from Thermo Fisher [A22284, R415]) was used to stain F-Actin fibers.For extracellular thiol cysteine staining (cysteine oxidation), intact midguts were dissected in PBS+Dimedone (10 mM Dimedone), then incubated for 30 minutes at room temperature in PBS+Dimedone, washed 2 times with PBS then fixed with 4% paraformaldehyde for 20 minutes at room temperature, and then blocked with PBS+0.5% BSA for 1 hour. Primary cysteine (sulfonate) polyclonal antibody (ADI-OSA-820-D, Enzo, 1:500) was incubated overnight in PBS, 0.5% BSA at 4°C. Alexa Fluor–conjugated secondary (Jackson Immunoresearch, 1:500) antibody was incubated for 2 hours at room temperature. Hoechst was used to stain DNA, and Phalloidin (Alexa 633 from Thermo Fisher [A22284]) was used to stain F-Actin fibers.For midguts stained in nonpermeable conditions, Triton was omitted from buffers until the end of incubation with secondary antibodies. Triton was reintroduced to stain with Hoechst and Phalloidin.Confocal images were collected using a Nikon Eclipse Ti confocal system (utilizing a single focal plane) and processed using the Nikon software.
Developmental timing
Around 75 virgin flies were mated with 50 males from mutant lines, balanced with TM3, Act-GFP, and were allowed to lay eggs for less than 24 hours on apple agar (apple juice + agar) plates, supplemented with live yeast paste. After 24 hours, 50 L1 homozygote and heterozygote larva were sorted by genotype based on the expression of GFP and then transferred to apple agar plates with yeast. The number of pupa and adult flies was counted.
Cell culture, transfection, and coculture
Drosophila S2 cells R+ (S2R+, acquired from the Drosophila Genomics Resource Center) were maintained in Shields and Sang M3 + BPYE media supplemented with 10% FCS, 50 U/ml penicillin, and 50 μg/ml streptomycin at 25°C. To induce apoptosis/RCD, cell media was removed, and cells (2 × 106 cell/mL in petri dish) were treated with ultraviolet C light (UVC; dose as indicated and previously described in [15]). For immunostaining, cells were plated on coverglass coated with poly-L-lysine and treated as describe below.Coculture experiments were performed using 12-well plates with trans-well insert with a 3-μm pore size (VWR, 29442–080). For 3-AT (Acros Organics) treatment, 3-AT was added to the culture media, resulting in a final concentration of 10 μM.
Primary cell culture
Embryonic primary cell cultures were isolated from gastrulating Catalase-GFP (BDSC#60212) embryos as described previously [83]. Briefly, embryos were collected on apple agar (apple juice + agar) plates with yeast paste and incubated for another 3.5 hours at 25°C. Embryos were washed extensively with H2O, then dechorionized with bleach (3% sodium hypochlorite) for 3 minutes, and then washed with water to remove residual bleach and again washed with 75% ethanol. Embryos were then homogenized with a Dounce homogenizer in Schneider’s medium supplemented with 10% FBS, 50 U/ml penicillin, and 50 μg/ml streptomycin. Dissociated cells were filtrated through a 40-μm cell strainer, and then centrifuged at 2,000 rpm for 5 minutes. Cells were washed and centrifuge again, and then resuspended in medium. For immunostaining, cells were plated on coverglass coated with poly-L-lysine and treated as describe below.
In vitro immunostaining
Cells were plated on coverglass coated with poly-L-lysine overnight before treatment. For immunostaining, the cells were washed with PBS and then fixed with 4% formaldehyde for 20 minutes, followed by 2X PBS washes. All subsequent incubations were performed in PBS, 0.5% BSA, and 0.1% Triton X-100 at 4°C. The following primary antibodies were used; anti-V5 (Sigma V8137, 1:500) and anti-Catalase H9 (Santa Cruz SC-271803, 1:100). Fluorescent secondary antibodies were obtained from Jackson Immunoresearch. Phalloidin was used to stain membranes and Hoechst (1:1,000) was used to stain DNA.
Proteomic analysis
S2R+ cells (2 × 106 cell/mL in petri dish) were treated with UV (100 mJ/cm2) and subsequently cultured in the presence of conditioned media containing Die-V5-His (or Mock) for 5 hours. Media was removed and cells washed with cold PBS, then crosslinked with 4% paraformaldehyde for 5 minutes on ice, washed X3 with cold PBS, and then lysed with RIPA buffer. Proteins were pulled down using Pierce HisPur Ni-NTA Spin Columns. The elution fractions were electrophoresed in 12% SDS-PAGE, and protein bands were stained with Coomassie blue. Bands were excised and subjected to in-gel trypsin digestion followed by identification.All MS/MS samples were analyzed using Mascot (Matrix Science, London, UK; version 2.7.0) and X! Tandem (The GPM, thegpm.org; version CYCLONE (2010.12.01.1)). Mascot was set up to search the NCBIprot_20170227 database, assuming digestion with the enzyme trypsin. Mascot and X! Tandem were searched with a fragment ion mass tolerance of 0.80 Da and a parent ion tolerance of 20 PPM. Alternatively, the total elution fraction was subjected the same protocol.
Criteria for protein identification
Scaffold (version Scaffold_4.9.0, Proteome Software, Portland, Oregon) was used to validate MS/MS-based peptide and protein identifications. Peptide identifications were accepted if they could be established at greater than 95.0% probability by the Scaffold Local FDR algorithm. Protein identifications were accepted if they could be established at greater than 99.0% probability and contained at least 2 identified peptides. Protein probabilities were assigned by the Protein Prophet algorithm [84]. Proteins that contained similar peptides and could not be differentiated based on MS/MS analysis alone were grouped to satisfy the principles of parsimony.
Plasmid construction
pAC5.1 DieRGE-V5 plasmid was generated from the pAC5.1 Die-V5 using overlapping PCR. Briefly, 2 fragments were generated by PCR using pAC5.1 Die-V5 plasmid as template with the following primers: Fragment1 F1: taaggtaccatggcatccccagtagtc, R1: ctcgcactcgcctctgtccatc; Fragment2 F2: gatggacagaggcgagtgcgag, R2: taactcgagaaatggcagcctggt; introducing a mutation in the RGD domain of Diedel, the fragments were then gel purified and fused together using the overlap extension polymerase chain reaction with the Phusion enzyme (NEB, Ipswich, Massachusetts, USA). The fused fragment with the mutation in the RGD motif was isolated with electrophoresis and gel purified, then cloned into the pAC5.1 V5-His plasmid using the restriction enzymes XhoI and KpnI. Integrins Inflated (If) and Myospheroid (Mys) were amplified from cDNA of w1118 L3 larva using specific primers (see S2 Table) and cloned into pMT-puro (Addgene plasmid; #17923).pAC5.A Flag-Cat plasmid was generated by PCR amplification using specific primer with a Flag tag sequence in 5′ (see S2 Table). Chimeric receptors CD8a and Mys were generated by overlapping PCR (as describe below) using genomic DNA of flies expressing CD8a-mCherry (Bloomington #27391) and the Pmt-Myospheroid plasmid using specific primers (see S2 Table) and then cloned into pMT-Puro plasmid.
Integrin binding (“cell spreading”) assay
S2R+ cells were transfected with pmt-puro-If and selected with puromycin (2 μg/mL), and expression of Inflated (If) Integrin was induced with 2 mM CuSO4 for 24 hours. Cells were then collected and washed with PBS and treated with Trypsin for 30 minutes at room temperature to remove extracellular proteins; the cells were washed with PBS and were allowed to “spread” for 6 hours on coated coverglass with Mock, DieV5, or DieRGE-V5–treated conditioned media. Cells were then fixed for 30 minutes in 4% formaldehyde, permeabilized with PBS+Triton, and stained with Phalloidin and Hoescht. Experiments were done in triplicate with around 100 cells counted in each experiment.
In vitro dsRNA treatment
Regions of cDNA for Catalase, Diap-1, and RFP (control) were amplified by PCR from plasmids containing cDNA sequences. Each primer used in the PCR contained a T7 polymerase binding site (GAATTAATACGACTCACTATAGGG AGA) at the 5′ and 3′, followed by sequences specific for: Catalase (forward: ATCGCCTTCAGTCCCGCTCA, reverse: GGCCGAAGTTGTCCTCGGTGT), Diap-1 (GACGCTGGAGATGAGGGAGC, reverse: CTGGTGGGGCTTCTGTTTCAGGT), and RFP (forward: ATAGTCTTCTTCTGCATTAC, reverse: AGGACGTCATCAAGGAGTTC). The PCR products were gel purified, and complementary RNA strands were synthesized by in vitro transcription using the T7 Megascript Kit (Ambion Austin, Texas, USA). To obtain dsRNA, sense and antisense strands were annealed by heating to 65°C for 15 minutes and then allowed to cool to room temperature. The quality of the dsRNA was analyzed on an agarose gel and stored at −80°C. For knock-down experiments, S2R+ cells were seeded in 6-well plates in 2 ml of medium the day before the RNAi procedure. The following day, dsRNA (10 μg) transfected using Effectene Transfection Reagent (Qiagen, Hilden, Germany). The S2R+ cells were incubated for 2 days to induce posttranscriptional gene silencing.
Drosophila midgut decellularization and western blotting
Detergent-enzymatic treatment to decellularize intestine was previously established for rat small bowel [85,86] and was optimized for Drosophila in this study. Around 10 midguts were dissected in PBS and collected in Eppendorf tube. The midguts were decellularized with 4% sodium deoxycholate for 30 minutes at room temperature, and this was followed by 4 washes with Milli-Q water using a table centrifuge to pellet the midguts. The midguts were then incubated with Pierce Universal Nuclease (250 U/mL) in 1 M NaCl for 30 minutes at room temperature. The decellularized midguts were washed 2 times with Milli-Q Water and resuspend in 20 μL of Laemmli buffer with 1/10 2-mercaptoethanol and boiled for 10 minutes. Proteins were loaded onto 10% stain-free SDS polyacrylamide gels (Bio-Rad) that allow visualization of protein in gel, and then transferred onto nitrocellulose membranes and blocked for 1 hour in TBST (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.05% Tween 20) containing 5% BSA. Protein immunoblots were performed using antibodies against γ-Laminin (D-3) (Santa Cruz, sc-17751). The immobilized proteins were further incubated with StarBrightBlue 520 mouse secondary antibody (Bio-Rad Hercules, California, USA), and protein bands were visualized using a Chemidoc MP Imaging System (Bio-Rad).
In vitro cell death measurement
For TUNEL assay, S2R+ cells were fixed on a poly-L-lysine (VWR)-coated glass coverslip with 4% formaldehyde for 10 minutes and washed 2 times with PBS. Cell death was detected by using an In Situ Cell Death Detection Kit (Roche, Basel, Switzerland) according to manufacturer’s protocol.For Annexin V staining, S2R+ cells were washed twice with binding buffer (10 mM HEPES, 140 mM NaCl, 2.5 mM CaCl2 (pH 7.4)) and then incubated for 15 minutes in the dark with Annexin V FITC Conjugated (Thermo Fisher, #A13199), according to manufacturer’s protocol. After 2 washes with binding buffer, the cells were fixed with 4% PFA.
In vivo TUNEL (cell death) assay
Intact midguts were dissected (at indicated ages) in 1X PBS and fixed in 4% paraformaldehyde for 25 minutes at room temperature. Samples were washed with 1X PBT for 30 minutes. Cell death was detected by using an In Situ Cell Death Detection Kit (Roche) according to manufacturer’s instruction.
Pupal UV irradiation and phenotype quantification
Mid-aged pupae (24 hours after puparium formation) were collected and subjected to surgical removal of the pupal shell surrounding the head area. UV irradiation was carried out on larvae that were immobilized on the side, so that only one retina was exposed to UV. A UV crosslinker (Stratalinker, 1800) was used with energy set at 20 mJ/cm2. After irradiation, pupae were kept in the dark. The images of UV-damaged adult eyes were taken, and the boundary of each eye was outlined using Photoshop. The eye size was determined by measuring the number of pixels contained within this area. Ratios between the area of irradiated and non-irradiated eyes were then determined.
Immunoprecipitation assay
S2R+ cells were washed with ice-cold PBS and lysed for 20 minutes on ice in lysis buffer (0.1% SDS, 150 mM NaCl, 1% Triton, 10 mM HEPES, 2 mM EDTA, 50 mM NaF, 2 mM Na3VO4, 0.1% sodium deoxycholate, 1.33 mM Na2HPO4 (pH 7.4) with 10 mM NaH2PO4) supplemented with antiprotease. Lysates were precleared and then incubated overnight at 4°C with the indicated antibody and Recombinant Protein G—Sepharose 4B (Thermo Fisher #101241). Immunoprecipitates were washed twice with lysis buffer and then twice with Tris buffer (pH 7.5) containing 500 mM NaCl, 1% triton, followed by 2 washes with 10 mM Tris (pH 7.5) containing 250 mM NaCl. Proteins were eluted from beads with SDS sample buffer and boiled for 10 minutes, then separated by SDS polyacrylamide gel electrophoresis, transferred to nitrocellulose membrane, and blotted with the indicated antibody.
Diedel mutant analysis and tissue-specific Diedel production.
(A) Genomic DNA sequence alignment of wild-type (WT) Diedel and CRISPR-Cas9–induced Diedel mutants (dieΔ1 and dieΔ2). White box highlights gRNA sequence; nucleotides represented in blue highlight a mismatch; dashed lines highlight nucleotide deletions. (B) Western blot with anti-V5 antibody of cell lysate or conditioned media (supernatant) from S2R+ cells either nontransfected (Mock) or transfected with a plasmid containing Die-V5, or DieΔ1-V5, or DieΔ2-V5. Die-V5 band is highlighted by black arrow. (C) Histogram representing percentage of L1 larva (from different Diedel mutant genotypes) reaching pupariation. (D) Histogram representing percentage of L1 larva (from different Diedel mutant genotypes) reaching adult stage (eclosion). (E) Pdm1 immunostaining of dissected posterior midgut from control (WT, revertant [rev.]), Diedel mutant homozygote (dieΔ1/dieΔ1), and Diedel mutant trans-heterozygote (dieΔ1/dieΔ2) flies; stained with anti-Pdm1 (green), Phalloidin (Phall.; purple), and DAPI (blue). (F) Die-V5 levels in dissected Drosophila fat bodies from controls (negative control; w1118) and w1118; DieP-Die-V5 / DieP-Die-V5 transgenic flies; stained with anti-V5 antibody (Die-V5; red) and DAPI (blue). (G) Die-V5 and Laminin B1 (LanB1) immunostaining of dissected posterior midguts from endogenously tagged Laminin B1 (LanB1-GFP) transgenic flies and LanB1-GFP/DieP-Die-V5 flies; bottom panel represents cross-section (apical–basal polarity is highlighted with arrow); stained with anti-His (Red), anti-GFP (purple), and DAPI (blue). The data underlying the graphs shown in S1C and S1D Fig can be found in S1 Data.(TIF)Click here for additional data file.
Diedel-dependent control of Integrin Mys localization.
(A) Integrin Mys immunostaining of dissected posterior midgut from control (WT, revertant [rev.]) flies; panels represent cross-sections (apical–basal polarity is highlighted with arrow); stained with anti-Mys (green), Phalloidin (Phall.; purple), and/or DAPI (blue). (B) Integrin Mys immunostaining of dissected posterior midgut from control flies (w1118; PplGal4,TubG80ts) and flies with conditional (adult-specific) fat body attenuation of Diedel (w1118; PplGal4,TubG80ts / UAS-Die RNAi) after 7 days at 29°C; cross-sections (apical–basal polarity is highlighted with arrow); stained with anti-Mys (green), Phalloidin (Phall.; purple), and/or DAPI (blue). (C) Integrin Mys immunostaining of dissected posterior midguts from control flies (w1118; CGGal4) and flies with fat body expression of Diedel RGE (w1118; CGGal4 / UAS-DieRGE#2: transgenic line 2), stained with anti-Mys (green), Phalloidin (Phall.; red), and/or DAPI (blue).(TIF)Click here for additional data file.
Diedel in the regulation of cell death and intestinal barrier function.
(A) Schematic of the intrinsic and extrinsic (TNF) apoptosis-induced RCD pathway in Drosophila. (B) UV induced retinal apoptosis. Photomicrographs of adult eyes from control flies (w1118) or flies ubiquitously overexpressing Diedel (w1118; DaGal4 / UAS-Die) During pupal development, retina were either UV irradiated (20 mJ/cm2, right eye; black arrow) or not (left eye). (C) Histogram representing the ratio between the eye area of the irradiated eye (right, R) to the non-irradiated (untreated) eye (left, L) of the genotypes described above. Bars represent mean ± SE, n = 7. (D) Constitutive activation of JNKK (UAS-HepACT) in the developing fly retina (SepGal4; expressed in photoreceptors and cone cells) results in a “rough” eye phenotype induced by apoptosis. Overexpressing Diedel (w1118; SepGal4, UAS-HepACT / UAS-Die) does not change this phenotype compared to controls (w1118; SepGal4, UAS-HepACT). (E) Overexpression of Reaper (UAS-Rpr) in the developing fly retina (GMRGal4) results in an apoptosis-induced cell death. Overexpressing Diedel (w1118; GMRGal4, UAS-Rpr / UAS-Die) does not change this phenotype compared to controls (w1118; SepGal4, UAS-Rpr). (F) Overexpression of Eiger (UAS-Eiger) in the developing fly retina (GMRGal4) results in an apoptosis-induced cell death rescued by Eiger inhibition (GMRGal4, UAS-Eiger / UAS-Eiger RNAi). Overexpressing Diedel (w1118; GMRGal4, UAS-Eiger / UAS-Die) does not change this phenotype compared to controls (w1118; GMRGal4: UAS-Eiger). (G) Intestinal barrier dysfunction (“Smurf” assay) in control (WT, revertant [rev.]), Diedel mutant homozygote (dieΔ1/dieΔ1) during aging. ND, nondetected, n = 100 flies/group. (H) Quantification of ISC proliferation (mitoses per whole dissected midgut); assayed by anti-pH3 immunostaining in control (WT, revertant [rev.]), Diedel mutant homozygote (dieΔ1/dieΔ1) and Diedel mutant trans-heterozygote (dieΔ1/dieΔ2) flies. Bars represent mean ± SE, n = 10–15. *P ≤ 0.05 (Student t test). (I) Representative images of TUNEL immunostaining (posterior midgut) at indicated genotypes; TUNEL (nuclear, green), DAPI (blue). The data underlying the graphs shown in S3G and S3H Fig can be found in S1 Data. ISC, intestinal stem cell; RCD, regulated cell death; TNF, tumor necrosis factor; WT, wild type.(TIF)Click here for additional data file.
Caspase localization in the midgut epithelium.
(A) Integrin Mys and Caspase (cleaved Dcp-1) immunostaining of dissected posterior midgut of control (WT, revertant [rev.]) and Diedel mutant (dieΔ1/dieΔ1) flies; stained with anti-Mys (green), anti-Dcp-1 (Cleaved Dcp-1; red), and DAPI (blue). Images represent 3D Confocal Z-Stack representation of Integrin Mys and Cleaved Dcp-1 localization. Apical–basal polarity/arrangement in sections is highlighted. (B) Disc large 1 (Dlg1; septate junction marker) and Caspase (cleaved Dcp-1) immunostaining of dissected posterior midgut of control (WT, revertant [rev.]) and Diedel mutant (dieΔ1/dieΔ1) flies; stained with anti-Dlg (green), anti-Dcp-1 (Cleaved Dcp-1; red), and DAPI (blue).(TIF)Click here for additional data file.
Diedel promotes cell survival in the midgut epithelium.
(A) Schematic of CD8-alpha and Integrin Mys chimeric receptors. pMT CCM expresses the extracellular and transmembrane region of the mouse CD8-alpha and the intracellular region of Integrin Mys; pMT CMM expresses the transmembrane and intracellular region of Integrin Mys and the extracellular region of CD8-alpha (B-C) Cleaved DCP1 and CD8-alpha immunostaining of S2R+ cells transfected with chimeric receptors (B) pMT CCM and (C) pMT CMM. Chimeric receptor (plasmid) expression was induced by CuS04 at 3 concentrations, 2 mM, 4 mM, and 6 mM, and stained with anti-cleaved DCP1 (green), anti-CD8-alpha (Cleaved Dcp-1; red), and DAPI (blue). (D) phospho-ERK immunostaining of dissected posterior midgut from control flies (w1118; PplGal4,TubG80ts), flies with conditional (adult-specific) fat body attenuation of Diedel (w1118; PplGal4,TubG80ts / UAS-Die RNAi), or conditional (adult-specific) fat body overexpression of Diedel (w1118; PplGal4,TubG80ts / UAS-Die) after 5 days at 29°C; stained with anti-phoso-ERK (green), anti-Arm (armadillo; red), and DAPI (blue).(TIF)Click here for additional data file.(A) Catalase and anti-V5 immunostaining of S2R+ cells after UV exposure (100 mJ/cm2); cells treated with Die-V5 conditioned media (supernatant) or Mock (control); stained with anti-V5 antibody (Die-V5; red) and anti-Catalase (green). Cells were with detergent in order to visualize intracellular proteins. (B) Schematic representation of the EFGP-multiTAG insertion into the Drosophila Catalase gene loci. (C) Co-immunoprecipitation of Die-V5 and Cat-FLAG in S2R+ cells transfected with pAC.5.1 Cat-Flag or cotransfected with pAC.5.1 Cat-Flag and pAC5.1 Die-V5; +/− UV: 100 mJ/cm2. Western blot using anti-Flag antibody and anti-V5 antibody. Bottom panels display entire images of western blots. (D) Membrane/ECM cysteine oxidation of dissected posterior midguts of w1118 (Ctrl.) flies; DSS treatment/feeding (4% DSS), or mock treatment, or cotreatment/feeding with a Catalase inhibitor (DSS + 3-AT); stained with anti-Cysteine (oxidized, Cys. Ox; red) and DAPI (blue). Immunostaining was performed in nonpermeabilized conditions to visualize membrane/ECM cysteine oxidation. Flies were fed (or Mock treated) DSS or DSS + 3-AT for 2 days.(TIF)Click here for additional data file.
Membrane-associated Catalase is necessary for ECM preservation / repair after epithelial tissue damage.
(A) Brightfield microscopy images of w1118 (WT; control) Drosophila posterior midguts before and after decellularization. (B) Western blot with anti-Laminin B2 antibody (LanB2, top panel) and ECM protein composition shown by stain free gel (bottom panel); after midgut decellularization. w1118 (WT; control) midguts were dissected after DSS treatment/feeding (4% DSS, +), or mock treatment, or cotreatment/feeding with a Catalase inhibitor (DSS + 3-AT). Flies were fed (or Mock treated) DSS or DSS + 3-AT for 2 days. (C) Entire image of western blot; related to S7B Fig top panel. Western blot with anti-Laminin B2 antibody after midgut decellularization.(D) Catalase immunostaining of dissected posterior midgut of control flies (w1118; NP1Gal4, tubG80ts) or flies with adult enterocyte-specific inhibition of Catalase (w1118; NP1Gal4, tubG80ts / UAS-Catalase [Cat] RNAi); stained with anti-Catalase (green) and DAPI (blue). Immunostaining confirms RNAi efficacy. (E) Integrin Mys immunostaining of dissected posterior midgut of control flies (w1118; NP1Gal4, tubG80ts) or flies with adult enterocyte-specific inhibition of Catalase (w1118; NP1Gal4, tubG80ts / UAS-Catalase [Cat] RNAi); midguts were dissected after DSS treatment/feeding (+ 4% DSS) and stained with anti-Mys (green) and Phalloidin (Phall.; red). Panels represent cross-sections (apical–basal polarity is highlighted with arrow). (F) Proposed model depicting the role of Diedel–Integrin–ECM interactions and membrane-associated Catalase in the regulation of extracellular ROS to promote epithelium resilience.(TIF)Click here for additional data file.
Mass spectrometry protein identification after pulldown with Mock or Diedel-V5.
(XLSX)Click here for additional data file.
Primers.
(XLSX)Click here for additional data file.
Raw data.
(XLSX)Click here for additional data file.
Raw images.
(PDF)Click here for additional data file.2 Sep 2021Dear Dr Karpac,Thank you for submitting your manuscript entitled "Membrane-associated Catalase protects Integrin-ECM interactions and promotes resilience of the Drosophila intestinal epithelium" for consideration as a Update Article by PLOS Biology.Your manuscript has now been evaluated by the PLOS Biology editorial staff as well as by an academic editor with relevant expertise and I am writing to let you know that we would like to send your submission out for external peer review.However, before we can send your manuscript to reviewers, we need you to complete your submission by providing the metadata that is required for full assessment. To this end, please login to Editorial Manager where you will find the paper in the 'Submissions Needing Revisions' folder on your homepage. Please click 'Revise Submission' from the Action Links and complete all additional questions in the submission questionnaire.Please re-submit your manuscript within two working days, i.e. by Sep 06 2021 11:59PM.Login to Editorial Manager here: https://www.editorialmanager.com/pbiologyDuring resubmission, you will be invited to opt-in to posting your pre-review manuscript as a bioRxiv preprint. Visit http://journals.plos.org/plosbiology/s/preprints for full details. If you consent to posting your current manuscript as a preprint, please upload a single Preprint PDF when you re-submit.Once your full submission is complete, your paper will undergo a series of checks in preparation for peer review. Once your manuscript has passed all checks it will be sent out for review.Given the disruptions resulting from the ongoing COVID-19 pandemic, please expect delays in the editorial process. We apologise in advance for any inconvenience caused and will do our best to minimize impact as far as possible.Feel free to email us at plosbiology@plos.org if you have any queries relating to your submission.Kind regards,Ines--Ines Alvarez-Garcia, PhDSenior EditorPLOS Biologyialvarez-garcia@plos.org4 Oct 2021Dear Dr Karpac,Thank you for submitting your manuscript entitled "Membrane-associated Catalase protects Integrin-ECM interactions and promotes resilience of the Drosophila intestinal epithelium" for consideration as a Update Article at PLOS Biology. Your manuscript has been evaluated by the PLOS Biology editors, an Academic Editor with relevant expertise, and by three independent reviewers.You will see that the reviewers find your conclusions novel and interesting, however they also think that the experiments involving the interaction of Diedel with Catalase and how oxidative damage of ECM is regulated need to be strengthen in order for us to pursue the manuscript further for publication. They all propose several experiments to address these issues and other concerns that should be performed.In light of the reviews (attached below), we will not be able to accept the current version of the manuscript, but we would welcome re-submission of a revised version that takes into account the reviewers' comments. We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent for further evaluation by the reviewers.We expect to receive your revised manuscript within 3 months.Please email us (plosbiology@plos.org) if you have any questions or concerns, or would like to request an extension. At this stage, your manuscript remains formally under active consideration at our journal; please notify us by email if you do not intend to submit a revision so that we may end consideration of the manuscript at PLOS Biology.**IMPORTANT - SUBMITTING YOUR REVISION**Your revisions should address the specific points made by each reviewer. Please submit the following files along with your revised manuscript:1. A 'Response to Reviewers' file - this should detail your responses to the editorial requests, present a point-by-point response to all of the reviewers' comments, and indicate the changes made to the manuscript.*NOTE: In your point by point response to the reviewers, please provide the full context of each review. Do not selectively quote paragraphs or sentences to reply to. The entire set of reviewer comments should be present in full and each specific point should be responded to individually, point by point.You should also cite any additional relevant literature that has been published since the original submission and mention any additional citations in your response.2. In addition to a clean copy of the manuscript, please also upload a 'track-changes' version of your manuscript that specifies the edits made. This should be uploaded as a "Related" file type.3. Resubmission ChecklistWhen you are ready to resubmit your revised manuscript, please refer to this resubmission checklist: https://plos.io/Biology_ChecklistTo submit a revised version of your manuscript, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' where you will find your submission record.Please make sure to read the following important policies and guidelines while preparing your revision and fulfil the editorial requests:a) *Published Peer Review*Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details:https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/b) *PLOS Data Policy*Please note that as a condition of publication PLOS' data policy (http://journals.plos.org/plosbiology/s/data-availability) requires that you make available all data used to draw the conclusions arrived at in your manuscript. If you have not already done so, you must include any data used in your manuscript either in appropriate repositories, within the body of the manuscript, or as supporting information (N.B. this includes any numerical values that were used to generate graphs, histograms etc.). For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5c) *Blot and Gel Data Policy*Please provide the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require these files before a manuscript can be accepted so please prepare them now, if you have not already uploaded them. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirementsd) *Blurb*Please also provide a blurb which (if accepted) will be included in our weekly and monthly Electronic Table of Contents, sent out to readers of PLOS Biology, and may be used to promote your article in social media. The blurb should be about 30-40 words long and is subject to editorial changes. It should, without exaggeration, entice people to read your manuscript. It should not be redundant with the title and should not contain acronyms or abbreviations. For examples, view our author guidelines: https://journals.plos.org/plosbiology/s/revising-your-manuscript#loc-blurbe) *Protocols deposition*To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosbiology/s/submission-guidelines#loc-materials-and-methodsThank you again for your submission to our journal. We hope that our editorial process has been constructive thus far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.Sincerely,Ines--Ines Alvarez-Garcia, PhDSenior EditorPLOS Biologyialvarez-garcia@plos.org----------------------------------------------Reviewers’ commentsRev. 1:This study identifies a novel mechanism of the Drosophila gut tissue against apoptotic cell death. It revealed how Diedel secreted from the fat body protects enterocytes via its binding ability to Integrin through the RGD domain. Through the interactome analysis, the authors further identified that Catalase is bound at the membrane and preserve the gut tissue. This relocalisation of Catalase inhibits the spreading of the apoptosis by reducing ROS as an adaptive stress response. The study has been done well and the manuscript are carefully written honestly. Overall, the data provided support the conclusion, and their finding is interesting.Major comments,1, Throughout the manuscript, the authors use either whole body mutant (It is nice that the authors characterise the phenotype well) or RNAi, by which they cannot deny the possible effect on the development of the gut. They need to do some adult-specific manipulation, which would tell more how adult homeostasis is perturbed by the temporal loss of Diedel/Catalase function in the adult gut. The time course analysis would further strengthen the description of the phenotype.2, It is not clear for this reviewer how Diedel, Integrin, or catalase localisation is regulated.2-1, Fig.1F suggests the binding of Die to gut (in normal condition), but for S2 cells, the Die binding is UV-dependent (Fig. 3A, 4D). How has UV-stimulation enabled Die to be at the membrane?2-2, Why Integrin is not identified in the interactor of Die-V5? Related to 2-1, Is it because S2 cells do not express enough integrins? Please discuss this point.2-3, In Fig. 5, the authors claimed that Catalase is localised to the membrane upon DSS feeding, but it is interesting whether Die is required for this phenotype. Whether Die mutant fails to show this Catalase relocalisation is vital step to draw the conclusion.3, One of the most attractive points of the manuscript would lie in the "cell death spreading" protected by Die. In Fig. 3B-D, together with Fig. S2, the authors tried to show the non-cell-autonomous killing of the cell is affected by Die. However, it is not directly tested whether this is the case in the gut tissue. In S2 cells, the type of cell death induced here is not well understood (is it apoptosis? through what kind of secreted protein?). It is technically not difficult to test the contribution of cell death-inducing cell death by overexpressing rpr/hid in the gut in a clonal manner. Also, they can probably use the model of apoptosis-induced apoptosis in the wing discs (for example, Perez-Garijo et al., elife, 2013).4, Did the authors test the expression of Die in the gut? In Fig. 1F and S1E, they use DieP-DieV5, but they might use fat body Gal4 to express Die V5 to see whether Die is from the fat body. Also, they can use Die-/- plus FB>Die (and the negative control DieRGD) to beautifully show how fat body-derived Die is a key for their phenotype through its binding to Integrin.Rev. 2:This is a review of the manuscript "Membrane-associated Catalase protects Integrin-ECM interactions and promotes resilience of the Drosophila intestinal epithelium" by Mlih and Karpac. In this work, the authors begin by exploring the function of the secreted signal Diedel and end by looking at a potential stress-induced change in catalase localization.The first part of the paper, on Diedel function, is generally good, and appears well-done. They analyze a Diedel mutant they generated, and then go on to show that Diedel appears to function, at least in part, by binding integrins. I have no significant concerns about this section.The second part of the paper focuses on catalase localization and oxidative damage to epithelia, with which Diedel is supposed to interact. This part of the paper contains several interesting observations, but these appear to be held together by a series of untested assumptions. A large amount of experimental work would be required to bring the second section up to a publishable standard.Major issues:1. One of the major points of the second part of the paper is that the authors observe what appears to be extracellular catalase. The implicit assumption is that catalase is somehow being secreted by stressed epithelial cells. However, it's not clear that this is how this system would have to work: for example, catalase could end up in the extracellular space as a result of cell lysis. The microscopy shows what appears to be a vesicular localization of catalase under stress; this could be catalase being endocytosed or secreted.2. More proof is required that what we are observing in these figures really is extracellular catalase. All we now have is immunostaining on non-permeabilized tissue.3. The IP for Diedel-interacting proteins in Figure 4B/C and Table S1 is interesting, but there are clearly a very large number of false positives in this analysis. Without validation (for example, conventional co-IP followed by Western blot), this assay doesn't really support much inferential weight. The histogram in 4C also appears to be mislabeled, making its interpretation difficult.4. It's an important part of the authors' story that Diedel and catalase have a meaningful interaction after tissue damage. However, they don't assay whether the interaction they observe in Figure 4A depends on irradiation or not. This should be shown.5. Ultimately, the authors want to believe that the relocalization of catalase they observe from the intracellular to the extracellular space is functionally required for control of oxidative damage of ECM; this is explicitly stated in the abstract ("Intracellular Catalase can re-localize to the extracellular membrane and limit ECM damage induced by the amplification of extracellular ROS, a critical adaptive stress response"). However, the requirement for extracellular catalase is not demonstrated.Minor point:The majority of the figures are immunofluorescent images rendered in color-blind unfriendly palettes. Red-green colorblind readers cannot distinguish green from yellow or blue from purple.Rev. 3:In this manuscript, the authors characterize a secreted protein, Diedel (die), which they have identified in previous work, and link its activity to resilience of epithelial cells, mostly at the adult midgut. Diedel is secreted from fat body and inhibits apoptosis-induced regulated cell death (RCD). Here, they generate two mutants of die and find that the integrity of the epithelial architecture and integrity of the midgut is disrupted. By using a tagged transgene they localize Diedel to the basement membrane of the midgut. The authors then provide evidence that Diedel interacts with the integrin Mys via its RGD motif and is required for attaching epithelial cells to the extracellular matrix. The authors then move on to examine how Diedel links the integrity of the epithelium to its control of apoptosis-induced RCD. In a trans-well cell culture system they show that Diedel inhibits apoptosis-induced RCD through maintaining the ECM-integrin interaction. Finally, the authors identify Catalase as an interacting protein of Diedel in UV-treated S2 cells. What follows is - in my mind - a rather confusing attempt to link redox balance mediated by Catalase with tissue resilience after stress.Overall, this manuscript has strengths and weaknesses. A major strength is the finding that Diedel can act as a ligand for the integrin Mys. However, other sections of the manuscript are rather weak, vague and often confusing.1. In figure 1, the authors claim that Diedel localizes to the basement membrane. However, they never use any marker of the basement membrane to directly demonstrate this localization. They also claim that in die mutants, enterocytes detach from the basement membrane. Again, without proper markers, these conclusions are hard to justify.2. The description of the cleaved Dcp-1 staining in figure 3 was not well presented. First, the authors seem to believe that caspases are nuclear (see lines 319 and 328). Caspases can be nuclear, but they are largely cytosolic. So, the cDcp1 staining should by mostly cytosolic. The membrane localization of Dcp-1 is interesting and there is precedence for that, but to consider the possibility that a cytosolic protein can interact with the extracellular basement membrane (line 321) is rather strange. Second, although the authors show increased caspase activity in die mutants, they do not show whether there is more apoptosis. How does TUNEL labeling or other apoptosis assays look like in die mutants?3. The co-localization data of Dcp1 with Dlg1 in figure S3E was not present in my copy of the manuscript.4. The section about the characterization of Catalase is very confusing. The authors state that they identified cytosolic Catalase as an interacting protein of extracellular Diedel. I understand that similar to Dcp1 above, a cytosolic protein can be membrane localized under certain circumstances. However, how can extracellular Diedel interact with intracellular protein. In lines 391/2, they state that Catalase is extra-cellular and the non-permeabilized conditions of the experiments further supports the extracellular location. At another point in the manuscript (lines 415/6), the authors state that Catalase acts on extracellular ROS. How can that be? Can Catalase cross membranes? I also find the conclusion of this section that "these molecular changes underly resilience mechanisms in epithelial tissues" (lines 422/3) very vague and over-interpreted.5. The trans-well cell culture experiments are quite interesting. How is apoptosis transmitted from UV-treated cells to untreated cells? Is there a death signal? The authors must be aware of the work by Perez-Garijo et al. (2013) in eLife which describes apoptosis-induced apoptosis in imaginal discs. In that work, Eiger was identified as a death ligand. Does that apply here, too?28 Jan 2022Submitted filename: Response to Reviewers.docxClick here for additional data file.13 Mar 2022Dear Dr Karpac,Thank you for submitting a revised version of your manuscript entitled "Synergy between Integrin-ECM interactions and membrane-associated Catalase promotes resilience of the Drosophila intestinal epithelium" for consideration as a Update Article at PLOS Biology. This revised version of your manuscript has been evaluated by the PLOS Biology editors, the Academic Editor and the three original reviewers.As you will see, the reviewers appreciate the significant improvements you have made in the revision of the manuscript, hoewever they also raise several remaining issues that need to be addressed. To address these comments, especially those of Reviewer 2, you will need to provide a clearer description and interpretation of the "Diedel-interacting proteins" experiment in Figure 4A. You will also need to provide the controls requested by Reviewer 2 for the catalase neutralising antibody experiment in Figure S7. If this is not possible, it would be acceptable to submit a revised manuscript without the catalase neutralising antibody experiment. We also emphasize that, when revising the text, particular attention should be given to linking together properly the Diedel-integrin and extracellular catalase halves of the manuscript, including the abstract.In light of the reviews (attached below), we are pleased to offer you the opportunity to address the remaining points from Reviewers 2 and 3 in a revised version that we anticipate should not take you very long. We will then assess your revised manuscript and your response to the reviewers' comments and we may consult the reviewers again.We expect to receive your revised manuscript within 1 month.Please email us (plosbiology@plos.org) if you have any questions or concerns, or would like to request an extension. At this stage, your manuscript remains formally under active consideration at our journal; please notify us by email if you do not intend to submit a revision so that we may end consideration of the manuscript at PLOS Biology.**IMPORTANT - SUBMITTING YOUR REVISION**Your revisions should address the specific points made by each reviewer. Please submit the following files along with your revised manuscript:1. A 'Response to Reviewers' file - this should detail your responses to the editorial requests, present a point-by-point response to all of the reviewers' comments, and indicate the changes made to the manuscript.*NOTE: In your point by point response to the reviewers, please provide the full context of each review. Do not selectively quote paragraphs or sentences to reply to. The entire set of reviewer comments should be present in full and each specific point should be responded to individually.You should also cite any additional relevant literature that has been published since the original submission and mention any additional citations in your response.2. In addition to a clean copy of the manuscript, please also upload a 'track-changes' version of your manuscript that specifies the edits made. This should be uploaded as a "Related" file type.3. Resubmission ChecklistWhen you are ready to resubmit your revised manuscript, please refer to this resubmission checklist: https://plos.io/Biology_ChecklistTo submit a revised version of your manuscript, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' where you will find your submission record.Please make sure to read the following important policies and guidelines while preparing your revision and fulfil the editorial requests:a) *PLOS Data Policy*Please note that as a condition of publication PLOS' data policy (http://journals.plos.org/plosbiology/s/data-availability) requires that you make available all data used to draw the conclusions arrived at in your manuscript. If you have not already done so, you must include any data used in your manuscript either in appropriate repositories, within the body of the manuscript, or as supporting information (N.B. this includes any numerical values that were used to generate graphs, histograms etc.). Please also indicate in each figure legend where the data can be found. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5b) *Published Peer Review*Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details:https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/c) *Blot and Gel Data Policy*Please provide the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require these files before a manuscript can be accepted so please prepare them now, if you have not already uploaded them. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirementsd) *Protocols deposition*To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosbiology/s/submission-guidelines#loc-materials-and-methodsThank you again for your submission to our journal. We hope that our editorial process has been constructive thus far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.Sincerely,Ines--Ines Alvarez-Garcia, PhDSenior EditorPLOS Biologyialvarez-garcia@plos.org------------------------------------------------Reviewers' commentsRev. 1:The authors have attempted to solve many concerns I raised during the initial round of review. Thanks to the new data added to the manuscript, now it seems more convincing to conclude what authors tried to show.Rev. 2:This is a re-review of the manuscript now titled "Synergy between Integrin-ECM interactions and membrane-associated Catalase promotes resilience of the Drosophila intestinal epithelium" by Mlih and Karpac.The prior version of this manuscript was odd: the first part was a solid exploration of integrins as receptors for Diedel and the second part was a description of the claim that catalase is secreted under stress and interacts with Diedel to protect the epithelium. The connection between the two parts was tenuous. The connection between the two parts has now become more tenuous because the authors no longer think that Diedel and catalase physically interact. It is even less clear how we are to interpret the proteomic experiment in 4A given that the authors no longer believe that there is a direct physical interaction between Diedel and catalase. The figure legend here still reads "Mass spectrometry of gel-based pulldown analysis (Diedel-interacting proteins)".One of the most surprising parts of the first manuscript was the claim that catalase is present and required in the extracellular space to protect tissue from stress. This would be very important if shown. However, the experiments in the prior version of the paper were not strong in this regard and the authors do not give a significantly stronger reason to believe that this is the case. The added functional experiment (blocking extracellular catalase with an antibody) requires controls. The antibody used would not be predicted to interact strongly with Drosophila catalase, based on the location of the epitope, and it's unclear whether it would block catalase function even if it were bound. This experiment would require that these points be clarified. It would also require control treatment with an isotype control antibody to eliminate other kinds of artifacts.The oxidized cysteine experiments are interesting but also do not directly require extracellular catalase—this effect could be indirect.The most obvious way for catalase to end up in the extracellular space would be fusion of peroxisomes with the plasma membrane. This would be very interesting but is not explored. The references given in support of this possibility in the response to reviewers are not salient to this question, or to the larger question of how catalase ends up outside the cell; they all deal with proteins in the ER or Golgi (known secretory compartments) being secreted in a condition or cell-type dependent way.There may be something in the second half of this paper that is very important. It deserves to be analyzed carefully and thoroughly, not appended to a perfectly fine paper on Diedel receptors. Demonstration that integrins are Diedel receptors would appear to be a perfectly sufficient research update in its own right.Rev. 3:I am pleased with the revision of this manuscript. The authors have addressed all comments and weaknesses, the writing has improved and they have added new data to further support their statements. It is an interesting paper with important conclusions.However, I have a few corrections about the statements the authors made about reference 11: In the discussion (lines567-570), the authors state that ref. 11 used genetically induced 'undead' cells. That is not true. Ref. 11 postulates that dying enterocytes in the adult midgut undergo a transiently undead state in the course of dying. This state is not genetically induced (like by coexpression of p35). Furthermore, in the same context, the authors state that ref. 11 showed that Duox (via Myo1D) localizes to the basement membrane. Again, that was not shown in ref. 11. Duox is a transmembrane protein sitting in the plasma membrane. What was shown in ref 11 is that the caspase Dronc is localized to the plasma membrane via Myo1D. These incorrect statements need to by corrected by the authors.23 Mar 2022Submitted filename: Response to Reviewers.docxClick here for additional data file.8 Apr 2022Dear Dr Karpac,Thank you for submitting your revised Update Article entitled "Synergy between Integrin-ECM interactions and membrane-associated Catalase promotes resilience of the Drosophila intestinal epithelium" for publication in PLOS Biology. I have now obtained advice from the team of editors and the Academic Editor, who has checked the revision.Based on the reviews (attached below), we will probably accept this manuscript for publication, provided you satisfactorily address the policy-related requests stated below.In addition, we would like you to consider a suggestion to improve the title:"Integrin-ECM interactions and membrane-associated Catalase work together to promote resilience of the Drosophila intestinal epithelium"As you address these items, please take this last chance to review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the cover letter that accompanies your revised manuscript.We expect to receive your revised manuscript within two weeks.To submit your revision, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' to find your submission record. Your revised submission must include the following:- a cover letter that should detail your responses to any editorial requests, if applicable, and whether changes have been made to the reference list- a Response to Reviewers file that provides a detailed response to the reviewers' comments (if applicable)- a track-changes file indicating any changes that you have made to the manuscript.NOTE: If Supporting Information files are included with your article, note that these are not copyedited and will be published as they are submitted. Please ensure that these files are legible and of high quality (at least 300 dpi) in an easily accessible file format. For this reason, please be aware that any references listed in an SI file will not be indexed. For more information, see our Supporting Information guidelines:https://journals.plos.org/plosbiology/s/supporting-information*Published Peer Review History*Please note that you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details:https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/*Press*Should you, your institution's press office or the journal office choose to press release your paper, please ensure you have opted out of Early Article Posting on the submission form. We ask that you notify us as soon as possible if you or your institution is planning to press release the article.*Protocols deposition*To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocolsPlease do not hesitate to contact me should you have any questions.Sincerely,Ines--Ines Alvarez-Garcia, PhDSenior EditorPLOS Biologyialvarez-garcia@plos.org------------------------------------------------------------------------DATA POLICY:thank you for providing the data underlying all the graphs shown in the figures. Please also indicate in the figure legends where the underlying data can be found - for example, you can add "The data underlying the graphs shown in the figure can be found in S1_Data"-------------------------------------------------------------------------BLOT AND GEL REPORTING REQUIREMENTS:Please add the original, uncropped blot shown in Fig. 2CWe require the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require these files before a manuscript can be accepted so please prepare and upload them now. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements11 Apr 2022Submitted filename: Response to Reviewers.docxClick here for additional data file.19 Apr 2022Dear Dr Karpac,On behalf of my colleagues and the Academic Editor, Alex Gould, I am pleased to say that we can in principle accept your Update Article entitled "Integrin-ECM interactions and membrane-associated Catalase cooperate to promote resilience of the Drosophila intestinal epithelium" for publication in PLOS Biology, provided you address any remaining formatting and reporting issues. These will be detailed in an email that will follow this letter and that you will usually receive within 2-3 business days, during which time no action is required from you. Please note that we will not be able to formally accept your manuscript and schedule it for publication until you have completed any requested changes.Please take a minute to log into Editorial Manager at http://www.editorialmanager.com/pbiology/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production process.PRESSWe frequently collaborate with press offices. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximise its impact. If the press office is planning to promote your findings, we would be grateful if they could coordinate with biologypress@plos.org. If you have previously opted in to the early version process, we ask that you notify us immediately of any press plans so that we may opt out on your behalf.We also ask that you take this opportunity to read our Embargo Policy regarding the discussion, promotion and media coverage of work that is yet to be published by PLOS. As your manuscript is not yet published, it is bound by the conditions of our Embargo Policy. Please be aware that this policy is in place both to ensure that any press coverage of your article is fully substantiated and to provide a direct link between such coverage and the published work. For full details of our Embargo Policy, please visit http://www.plos.org/about/media-inquiries/embargo-policy/.Thank you again for choosing PLOS Biology for publication and supporting Open Access publishing. We look forward to publishing your study.Sincerely,Ines--Ines Alvarez-Garcia, PhDSenior EditorPLOS Biologyialvarez-garcia@plos.org