Qilong Cao1,2, Shaoshuai Liang2, Feng Lin2,3, Jun Cao4, Lin Wang2, Hui Li2, Mengyang Liu5, Yajuan Wang6, Lijun Zhao6, Xiaolong Cao7, Yan Guo8. 1. Biomedical Informatics & Genomics Center, Key Laboratory of Biomedical Information Engineering of Ministry of Education, School of Life Science and Technology, Xi'an Jiaotong University, Xi'an, Shaanxi, 710049, China. 2. Qingdao Haier Biotech Co. Ltd, Qingdao, 266109, China. 3. School of Medicine, Huaqiao University, Quanzhou, 362021, Fujian, China. 4. Hefei National Laboratory for Physical Sciences at the Microscale, School of Life Sciences, Division of Life Sciences and Medicine, University of Science and Technology of China, Hefei, 230026, China. 5. Department of Clinical Laboratory, The Affiliated Hospital of Qingdao University, 59 Haier Road, Qingdao, 266035, Shandong, China. 6. Dingzhou City People's Hospital, Heibei, 073099, China. 7. Beijing Changping Institute for Tuberculosis Prevention and Treatment, Beijing, 102200, China. caoxiaolong521jing@outlook.com. 8. Biomedical Informatics & Genomics Center, Key Laboratory of Biomedical Information Engineering of Ministry of Education, School of Life Science and Technology, Xi'an Jiaotong University, Xi'an, Shaanxi, 710049, China. guoyan253@xjtu.edu.cn.
Abstract
BACKGROUND: Haemophilus influenzae was the most aggressive pathogen and formed a major cause of bacterial meningitis and pneumonia in young children and infants, which need medical emergency requiring immediate diagnosis and treatment. However, From isolation to identification of H. influenzae, the traditional diagnose strategy was time-consuming and expensive. Therefore, the establishment of a convenient, highly sensitive, and stable detection system is urgent and critical. RESULTS: In this study, we used a combined method to detect H. influenzae. Six specific primers were designed on the basis of outer membrane protein P6 gene sequence of H. influenzae. The reaction condition such as the optimum temperature was 65℃, and the optimum reaction time was 30 min, respectively. Through the loop-mediated isothermal amplification (LAMP) in combination with nanoparticle-based lateral flow biosensor (LFB), the sensitivity of LAMP-LFB showed 100 fg was the lowest genomic DNA templates concentration in the pure cultures. Meanwhile, the specificity of H. influenzae-LAMP-LFB assay showed the exclusive positive results, which were detected in H. influenzae templates. In 55 clinical sputum samples, 22 samples were positive with LAMP-LFB method, which was in accordance with the traditional culture and Polymerase Chain Reaction (PCR) method. The accuracy in diagnosing H. influenzae with LAMP-LFB could reach 100%, compared to culture and PCR method, indicating the LAMP-LFB had more advantages in target pathogen detection. CONCLUSIONS: Taken together, LAMP-LFB could be used as an effective diagnostic approach for H. influenzae in the conditions of basic and clinical labs, which would allow clinicians to make better informed decisions regarding patient treatment without delay.
BACKGROUND: Haemophilus influenzae was the most aggressive pathogen and formed a major cause of bacterial meningitis and pneumonia in young children and infants, which need medical emergency requiring immediate diagnosis and treatment. However, From isolation to identification of H. influenzae, the traditional diagnose strategy was time-consuming and expensive. Therefore, the establishment of a convenient, highly sensitive, and stable detection system is urgent and critical. RESULTS: In this study, we used a combined method to detect H. influenzae. Six specific primers were designed on the basis of outer membrane protein P6 gene sequence of H. influenzae. The reaction condition such as the optimum temperature was 65℃, and the optimum reaction time was 30 min, respectively. Through the loop-mediated isothermal amplification (LAMP) in combination with nanoparticle-based lateral flow biosensor (LFB), the sensitivity of LAMP-LFB showed 100 fg was the lowest genomic DNA templates concentration in the pure cultures. Meanwhile, the specificity of H. influenzae-LAMP-LFB assay showed the exclusive positive results, which were detected in H. influenzae templates. In 55 clinical sputum samples, 22 samples were positive with LAMP-LFB method, which was in accordance with the traditional culture and Polymerase Chain Reaction (PCR) method. The accuracy in diagnosing H. influenzae with LAMP-LFB could reach 100%, compared to culture and PCR method, indicating the LAMP-LFB had more advantages in target pathogen detection. CONCLUSIONS: Taken together, LAMP-LFB could be used as an effective diagnostic approach for H. influenzae in the conditions of basic and clinical labs, which would allow clinicians to make better informed decisions regarding patient treatment without delay.
Haemophilus influenzae is a common human pathogenic strain, which is related to a variety of serious childhood illnesses, such as pneumonia, otitis media, bacteremia and meningitis [1]. Previously, it is difficult to distinguish H. influenzae from Haemophilus spp., such as Haemophilus parainfluenzae. The traditional detection techniques for isolation and identification of H. influenzae, involving colonial morphology, serological identification and growth assays, are usually consuming a lot of time and cumbersome [1]. Therefore, the establishment of a convenient, highly sensitive, and stable detection system is urgent and critical for early diagnosis and effective antibiotic therapy.For clinical detection and analysis, the molecular detection technology has the value of sensitivity and specificity [2-5]. With different targeting genes, such as the outer membrane protein (OMP) P6, capsulation-associated protein Bex A [6], and rRNA-encoding genes [7, 8], the Polymerase Chain Reaction (PCR) method has been successfully applied to H. influenzae detection. Thereinto, OMP P6 is a highly conserved gene in H. influenzae [9, 10]. Morever, it has became a potential vaccine component that protects against H. influenzae [11]. Hence, it is a suitable target gene for H. influenzae identification than other genes.A detection technique of nucleic acid called loop-mediated isothermal amplification (LAMP) was established in 2000 [12]. The principle of LAMP is to design 3 pairs of specific primers based on the 6 regions of the 3' and 5' ends of the target gene, including 1 external primer, 1 ring primer and 1 internal primer. The 3 pairs of specific primers rely on the chain replacement Bst DNA polymerase, an appropriate temperature range from 60℃ to 67℃ to make the chain replacement DNA synthesis self-cycle continuously, so as to achieve rapid amplification. After the reaction, the amplification can be judged by the turbidity of the precipitation of magnesium pyrophosphate, the by-product of the amplification, or the fluorescent dye. In this reaction, dumbbell-shaped template was formed first, and then cyclic amplification was carried out, followed by elongation and cyclic amplification [12-14]. For LAMP method, it possesses many advantages, including high sensitivity and specificity, regulable pH and the temperature ranges for amplification, and shorter time consumption (less than one hour) [15, 16]. In addition, the reagents used in LAMP assay are not expensive [15, 16]. Many studies published previously, used the LAMP method to detect bacteria, viruses, and parasites [17, 18]. For example, H. influenzae, H. influenzae type b (Hib), and serotype of non-Hib have been detection with LAMP method to diagnose for patients [1, 19, 20]. More recently, numerous methods involving electrophoresis, turbidimeters, nanoparticle-based lateral flow biosensors (LFBs) and color agents have been used to analyze the amplification production of LAMP [21]. In brief, the LFB including the sample pad, membrane backing card, nitrocellulose membrane (NC), conjugate pad, and absorbent pad, which were assembled onto a plastic adhesive backing card. In the view of low cost, simplicity and rapidness, various LFB are derived out and widely used to analyze LAMP amplicon [22-25]. It is worth mentioning that the multiple reverse transcription LAMP combined with LFB have been used to diagnosis coronavirus disease 19 (COVID-19) [26]. For the above favorable characteristics, we used LAMP combined with LFB assay and OMP P6 gene to specifically detect H. influenzae. With strain pure cultures and clinical samples, the optimal reaction conditions, sensitivity, specificity and feasibility of H. influenzae detection strategy were validated.
Results
Confirmation and demonstration of LAMP products
For the purpose of assessing the effectiveness of H. influenzae LAMP primers, the LAMP reactions were conducted with H. influenzae, H. parainfluenzae, H. haemolyticus, and non-H. influenzae genomic templates at 63℃ for 1 h. After adding the VDR reagents into the amplification mixtures, the color of positive amplification products of LAMP in tube changed from colourless to light blue (Fig. 1A). Meanwhile, in the negative control and blank tube, the color remained colorlessness. The LAMP amplification products were detected by 2% agarose gel electrophoresis, which presented the ladder bands only in the positive reaction, and no bands in the blank and negative control (Fig. 1B). With LFB, in the positive amplifications, the clear visible two red bands were seen for the control line (CL) and test line (TL). While, in the negative and blank controls, only a red band CL was observed (Fig. 1C). These results confirmed that the primers were suitable for H. influenzae detection with LAMP-LFB assay.
Fig. 1
Confirmation and demonstration of H. influenzae-LAMP amplification products. A The amplification products’ color change of H. influenzae-LAMP assay was showed with colorimetric indicators; B Amplicon of H. influenzae-LAMP was analyzed by agarose gel electrophoresis; C The products of H. influenzae-LAMP were detected with LFB. Tube 1/lane 1/biosensor 1, positive amplification of H. influenzae; tube 2/ lane 2/ biosensor 2, negative control of H. parainfluenzae; tube 3/ lane 3/ biosensor 3, negative control of H. haemolyticus; tube 4/ lane 4/ biosensor 4, negative control of S. aureus; tube 5/ lane 5/ biosensor 5, black control (double distilled water, DW)
Confirmation and demonstration of H. influenzae-LAMP amplification products. A The amplification products’ color change of H. influenzae-LAMP assay was showed with colorimetric indicators; B Amplicon of H. influenzae-LAMP was analyzed by agarose gel electrophoresis; C The products of H. influenzae-LAMP were detected with LFB. Tube 1/lane 1/biosensor 1, positive amplification of H. influenzae; tube 2/ lane 2/ biosensor 2, negative control of H. parainfluenzae; tube 3/ lane 3/ biosensor 3, negative control of H. haemolyticus; tube 4/ lane 4/ biosensor 4, negative control of S. aureus; tube 5/ lane 5/ biosensor 5, black control (double distilled water, DW)
Optimal amplification temperature of H. influenzae LAMP primers
To test the optimum reaction temperature of H. influenzae LAMP primers, the LAMP amplifications were conducted with genomic DNA of H. influenzae of 10 pg/μl per reaction from 60℃ to 67℃ with 1℃ interval. Eight motorial graphs matching with corresponding temperature were acquired by detecting the amplification products with real-time turbidimeter. The amplification of OMP P6 gene could be found at all tested temperatures. However, the 65℃ was the optimal temperature, because the absorbance threshold was reached first (Fig. 2).
Fig. 2
Optimization of amplification temperature for H. influenzae-LAMP assay. The LAMP method for H. influenzae detection was monitored with real-time turbidimeter. Eight temperatures and their corresponding curves were showed in the pictures. The turbidity > 0.1 was considered as the positive result (threshold value was 0.1). The H. influenzae DNA templates used in each reaction was 1 pg. Eight pictures (A-H) were acquired from a temperature range with 1℃ intervals (from 60℃ to 67℃). Signal 1, positive amplification of H. influenzae; signal 2, negative control of S. aureus
Optimization of amplification temperature for H. influenzae-LAMP assay. The LAMP method for H. influenzae detection was monitored with real-time turbidimeter. Eight temperatures and their corresponding curves were showed in the pictures. The turbidity > 0.1 was considered as the positive result (threshold value was 0.1). The H. influenzae DNA templates used in each reaction was 1 pg. Eight pictures (A-H) were acquired from a temperature range with 1℃ intervals (from 60℃ to 67℃). Signal 1, positive amplification of H. influenzae; signal 2, negative control of S. aureus
Analytical sensitivity of H. influenzae LAMP-LFB detection
The genomic DNA of H. influenzae was diluted into a series of gradients (10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg, and 1 fg per mixture), which were used as the templates to analyze the sensitivity of LAMP-LFB assay. As was shown in Fig. 3, the limit of detection (LOD) of LAMP-LFB assays was 100 fg by the four detectiong methods. These results indicated that LAMP detection’s LOD of H. influenzae by real-time turbidimeter (Fig. 3A), colorimetric indicator (Fig. 3B), and 2% agarose gel electrophoresis (Fig. 3C) were conformity with LFB analysis (Fig. 3D).
Fig. 3
Sensitivity of H. influenzae LAMP-LFB assay with gradient dilution of genomic DNA templates. Four monitoring method: A Real-time turbidimeter; B Colorimetric Indicator; C Agarose gel electrophoresis; D Biosensors. 1–8 represented the DNA template of each reaction was 10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg, 1 fg, respectively. The genomic DNA from 10 ng to 100 fg produced positive result
Sensitivity of H. influenzae LAMP-LFB assay with gradient dilution of genomic DNA templates. Four monitoring method: A Real-time turbidimeter; B Colorimetric Indicator; C Agarose gel electrophoresis; D Biosensors. 1–8 represented the DNA template of each reaction was 10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg, 1 fg, respectively. The genomic DNA from 10 ng to 100 fg produced positive result
The optimal duration time of H. influenzae LAMP-LFB assay
In order to examine the optimal duration time of H. influenzae LAMP-LFB assay, the assay were conducted at 65℃. And the time range was set from 10 to 60 min with 10 min interval. With 100 fg genomic DNA of LOD level, the sufficient time for LAMP assay with colorimetric indicators and LFB were both only 30 min (Fig. 4A and B). Take together, the whole detection process of H. influenzae LAMP-LFB, involving genomic DNA preparation of 20 min, LAMP reaction of 30 min, and LFB analysis of 2 min, took only 52 min.
Fig. 4
Optimal duration time of H. influenzae-LAMP-LFB assay. A Colorimetric Indicator; B LFB. Six reaction times: 10 min; 20 min; 30 min; 40 min; 50 min; 60 min were measured at 65℃. The 1–6 biosensors represented different genomic DNA template levels of H. influenzae, including 100 pg, 10 pg, 1 pg, 100 fg, 10 fg, and blank control (DW), respectively. The optimal time was 30 min
Optimal duration time of H. influenzae-LAMP-LFB assay. A Colorimetric Indicator; B LFB. Six reaction times: 10 min; 20 min; 30 min; 40 min; 50 min; 60 min were measured at 65℃. The 1–6 biosensors represented different genomic DNA template levels of H. influenzae, including 100 pg, 10 pg, 1 pg, 100 fg, 10 fg, and blank control (DW), respectively. The optimal time was 30 min
Specificity of H. influenzae LAMP-LFB assay
In this study, the specificity of the LAMP-LFB method was evaluated with the genomic templates extracted from 10 H. influenzae strains, 3 H. parainfluenzae, 3 H. haemolyticus, 3 H. parahaemolyticus and 20 non-H. influenzae bacterial pathogens (Table 2). As shown in Fig. 5, with three methods, the positive results were specifically yielded with the genomic DNA from H. influenzae, while the negative results were detected with H. parainfluenzae, H. haemolyticus, H. parahaemolyticus and non-H. influenzae strains. All results indicated that the specificity of H. influenzae LAMP-LFB assay by colorimetric indicator (Fig. 5A), agarose gel electrophoresis (Fig. 5B) were conformity with LFB method (Fig. 5C), which has 100% specificity for H. influenzae detection.
Table 2
Bacterial strains used in this study
Bacteria species
Isolates (source)
No. of strains
Haemophilus influenzae
Isolates
10
Haemophilus parainfluenzae
Isolates
3
Haemophilus haemolyticus
Isolates
3
Haemophilus parahaemolyticus
Isolates
3
Citrobacter braakii
Isolates
2
Streptococcus agalactiae
Isolates
1
Staphylococcus haemophilus
Isolates
1
Proteus mirabilis
Isolates
1
Streptococcus suis
Isolates
2
Listeria monocytogenes
Isolates
2
Listeria innocua
Isolates
1
Escherichia Coli
Isolates
2
Kleber pneumoniae
Isolates
3
Escherichia Coli
Isolates
5
Fig. 5
Specificity of H. influenzae LAMP-LFB assay with different strains’ DNA templates. A The visible color change of H. influenzae-LAMP amplicon was observed with colorimetric indicators; B The LAMP products were detected with agarose gel electrophoresis; C The LAMP assay were analyzed by means of later flow biosensor. 1–10, H. influenzae; 11–13, H. parainfluenzae; 14–16, H. haemolyticus; 17–19, H. parahaemolyticus; 20–22, Kleber pneumoniae; 23–24, Pseudomonas aeruginosa; 25–26, Citrobacter braakii; 27, Streptococcus agalactiae; 28, Staphylococcus haemophilus; 29, Proteus mirabilis; 30–31, Streptococcus suis; 32–33, Listeria monocytogenes; 34, Listeria innocua; 35–39, Escherichia coli
Specificity of H. influenzae LAMP-LFB assay with different strains’ DNA templates. A The visible color change of H. influenzae-LAMP amplicon was observed with colorimetric indicators; B The LAMP products were detected with agarose gel electrophoresis; C The LAMP assay were analyzed by means of later flow biosensor. 1–10, H. influenzae; 11–13, H. parainfluenzae; 14–16, H. haemolyticus; 17–19, H. parahaemolyticus; 20–22, Kleber pneumoniae; 23–24, Pseudomonas aeruginosa; 25–26, Citrobacter braakii; 27, Streptococcus agalactiae; 28, Staphylococcus haemophilus; 29, Proteus mirabilis; 30–31, Streptococcus suis; 32–33, Listeria monocytogenes; 34, Listeria innocua; 35–39, Escherichia coli
Examination of LAMP-LFB assay for clinical samples
As a detection tool, the usability of LAMP-LFB method for diagnosing H. influenzae was evaluated with 55 DNA temples extracted from sputum samples. 5 μl DNA template from each sample was applied to H. influenzae-LAMP assay, each reaction was repeated three times, then the 0.5 μl reaction products were detected by LFB. The 22 of 55 sputum samples exhibited H. influenzae positive results in colorimetric indicator (Fig. 6A), agarose gel electrophoresis (Fig. 6B), and LFB analysis (Fig. 6C), which was completely in consistent with traditional cultivation detection results and PCR results (Fig. 6D).
Fig. 6
Detection of H. influenzae in clinical samples with LAMP-LFB assay and PCR. A The visible color change of H. influenzae-LAMP assay was demonstrated by colorimetric indicators; B Amplification products of H. influenzae-LAMP were detected by agarose gel electrophoresis; C The products of H. influenzae-LAMP were detected with LFB. D PCR method for detection of H. influenzae. The number from 1 to 22 represented the positive results. Other numbers showed the negative results
Detection of H. influenzae in clinical samples with LAMP-LFB assay and PCR. A The visible color change of H. influenzae-LAMP assay was demonstrated by colorimetric indicators; B Amplification products of H. influenzae-LAMP were detected by agarose gel electrophoresis; C The products of H. influenzae-LAMP were detected with LFB. D PCR method for detection of H. influenzae. The number from 1 to 22 represented the positive results. Other numbers showed the negative results
Discussion
As an exclusively human pathogen, H. influenzae is well recognized to be an important cause of respiratory infection and a major cause of systemic diseases such as community-acquired pneumonia, meningitis, bacteremia and otitis media in young children and infants, which need medical emergency requiring immediate diagnosis and treatment [1]. Unfortunately, from isolation to identification of H. influenzae, the traditional diagnose strategy was spending too much time and expensive. In our study, we adopted a convenient LAMP-LFB detection system to diagnose target pathogen. Obviously, only H. influenzae strains showed the positive results for LAMP-LFB compared with the control strains, such as H. parainfluenzae, H. haemolyticus, H. parahaemolyticus and non-H. influenzae strains. Thus, LAMP-LFB assay showed no cross-reactions to the above negative strains, which demonstrated that the specificity of the target pathogen detection arrived at 100%.The sensitivity analysis showed that the minimum content of the target strain is 100 fg in H. influenzae-LAMP-LFB assay using the OMP P6 gene. Meanwhile, within 52 min, the whole experimental steps of LAMP-LFB could be completed, which included 20 min for genomic template preparation, LAMP reaction time of 30 min (Fig. 4), and LFB analysis of 2 min. Compared with agarose gel electrophoresis, colorimetric indicator and real-time turbidity, the LFB method not only presented the reliable sensitivity and accuracy (Fig. 3), but also simpler and faster. For further evaluation the practicality of LAMP-LFB method to target pathogens, we detected 55 clinical sputum samples using biological culture method and LAMP-LFB detection, respectively. The LAMP-LFB technique revealed high specificity for H. influenzae strains in the sputum samples, which was in accordance with culture-biotechnical assay. In comparison with PCR and culture assays, H. influenzae-LAMP-LFB technique just need a thermostatic instrument with a constant temperature of 65℃, which effectively avoided the long turnaround times, expensive instruments, thermal denature and change in reaction temperature, suggesting the LAMP-LFB assay was an alternative to PCR-based method. Moreover, Syafirah et al. [27] found that the LAMP assay was at least 100-fold more sensitive than the PCR method for detection of Vibrio cholerae. Furthermore, recent research in Mycoplasma pneumoniae detection and Staphylococcus aureus detection showed that the LAMP-LFB method has better detection ability than the PCR method [22, 25].The real-time turbidimeter, gel electropheresis, visual detection reagent (VDR) are all detection methods for LAMP amplification products. Each of those methods has its own advantages and disadvantages. Real-time turbidity method can monitor the reaction in real time, but it needs to rely on turbidimeter. Gel electropheresis, which requires an additional gel electrophoresis process of approximately 30 min. VDR method, although the naked eye can directly identify the reaction results, some negative reaction products also show a slight blue color, which may affect the judgment of the results. Herein, the LFB was employed to analyze LAMP products in H. influenzae-LAMP-LFB assay. The LFB relied on the primers of FIP labled with FITC and LF labled with biotin. And, the LFB method can complete the detection of amplified products within 5 min, and the results can be directly observed by naked eyes. Therefore, LAMP combined with LFB method was established in this study to detect H. influenzae. In compared with gel electrophoresis, colorimetric indicators and turbidity which applied in many previous reports, the LFB showed the superiority in ease of use in basic and clinical laboratories, simple operation and rapid results after the amplification process was completed. Moreover, based on the LFB, the extra procedure, special reagents, complicated instruments are all no longer needed. Furthermore, the results indicated with LFB is less subjective. Nevertheless, the LAMP-LFB detection also has limitation, since the LAMP results are shown qualitatively by red strips.
Conclusion
The LAMP-LFB assay targeted the specific OMP P6 gene of H. influenzae was successfully developed. The assay showed high selectivity for H. influenzae detection, high sensitivity of 100 fg in per reaction with pure culture. Meanwhile, the protocol is much more convenient with less time-spending and no expensive equipment. H. influenzae-LAMP-LFB assay established in this study might be used as a diagnosis tool for target pathogens, which would allow clinicians to make better informed decisions regarding patient treatment without delay.
Materials and methods
Instruments and reagents
The Loopamp kits and visual detection reagent (VDR) [22, 25] were purchased from HaiTaiZhengYuan Technology Co., Ltd (Beijing, China). The VDR has been widely used, and the VDR reagent is the obvious color contrast before and after reaction. Before the reaction, the VDR is light blue. In the positive reaction, the VDR continues to remain light blue. While, in the negative reaction, the VDR becomes colorless [22, 25]. The LFB, involving backing card, absorbent pad, conjugate pad, sample pad, nitrocellulose membrane (NC), and the isothermal amplification kit were purchased from Jie-Yi Biotechnology. Co., Ltd. (Shanghai, China). The Bst DNA Polymerase large Fragment was purchased from New England Biolabs Co., Ltd. (Beijing, China). The crimson red dye streptavidin-coated polymer nanoparticles (10 mg/mL, 100 mM borate, 0.05% Tween-20 with 10 mM EDTA, pH 8.5 with 0.1% BSA, 129 nm) were purchased from Bangs Laboratories, Inc. (India, USA). The rabbit anti-fluorescein antibody and the biotinylated bovine serum albumin were purchased from Abcam. Co., Ltd. (Shanghai, China). The FastPure® Blood/Cell/Tissue/Bacteria DNA Isolation Mini Kit was purchased from Vazyme biotech co., Ltd (Nanjing, China). The LA-320C realtime turbidimeter was purchased from Eiken Chemical Co., Ltd (Tokyo, Japan). The LA-320C realtime turbidimeter belongs to the special gene amplification assay device for LAMP method. The device can complete the entire process from gene amplification to detection. After incubation under isothermal conditions (60–65℃), the presence of target genes was determined by measuring the turbidity of magnesium pyrophosphate, a by-product of the amplified genes. The turbidity of each sample is measured in real time and the results are graphically displayed on the computer. The turbidity of each sample was measured every 6 s. The measurement is transferred to a computer to confirm the extent of amplification.
Design of the LAMP primers
According to the H. influenzae OMP P6 gene (Genbank accession no. L42023). The specific LAMP primers listed in Table 1, involving F3, B3, BIP, FIP, LF and LB, were designed in terms of the reaction mechanism of LAMP-LFB method with PrimerExplorer V4 (Eiken Chemical) [28, 29]. Moreover, the FIP labeled with FITC at 5’end and LF labeled with biotin at 5’end were also listed in Table 1. Through the BLAST analysis, the specificity of LAMP primers was verified. The sequences and locations of primers were displayed in Fig. 7. All of the primers were synthesized by TSINGKE Biological Technology Co., Ltd. (Beijing, China) at HPLC purification grade.
Table 1
The primers used in this study
Primers
Sequences and modifications (5’-3’)
Gene
F3
GGTTGTGAGAGACTAGAACTC
OMP P6
B3
TCCATTTAATACAGTGGGGT
FIP
AGTTGTCCAGTTGGGTTGTTAG
-TCGACTGACGGATTAAGAGT
FIP*
5’-FITC-AGTTGTCCAGTTGGGTTGTTAG
-TCGACTGACGGATTAAGAGT-3’
BIP
AATCAGAGAGTGGTGGGTCGTG-CGTT
AGCTCAGTCGGTAG
LF
CTCAGTTGGTAGAGTAGC
LF*
5’-Biotin-CTCAGTTGGTAGAGTAGC-3’
LB
GAACCTTCGACCAACGGAT
FIP*, 5’−labeled with FITC; FITC, fluorescein isothiocyanate; LF*, 5’−labeled with Biotin
Fig. 7
The LAMP primers designed according to OMP P6 gene. Different colors were used to lable the 8 primers. The sense and anti-sense sequences were marked by right and left arrows, respectively
The primers used in this studyAGTTGTCCAGTTGGGTTGTTAG-TCGACTGACGGATTAAGAGT5’-FITC-AGTTGTCCAGTTGGGTTGTTAG-TCGACTGACGGATTAAGAGT-3’AATCAGAGAGTGGTGGGTCGTG-CGTTAGCTCAGTCGGTAGFIP*, 5’−labeled with FITC; FITC, fluorescein isothiocyanate; LF*, 5’−labeled with BiotinThe LAMP primers designed according to OMP P6 gene. Different colors were used to lable the 8 primers. The sense and anti-sense sequences were marked by right and left arrows, respectively
Bacterial strains and genomic DNA preparation
The 39 clinical strains were detected in our study, including 10 H. influenzae strains, 3 H. parainfluenzae, 3 Haemophilus haemolyticus, 3 Haemophilus parahaemolyticus and 20 non-H. influenzae strains (Table 2). According to the instructions of FastPure® Blood/Cell/Tissue/Bacteria DNA Isolation Mini Kit (Nanjing, China), the genomic DNA of 39 strains were extracted. The extraction steps were as follows: For Gram-negative bacteria samples, the 200 μl Buffer ACL, 20 μl Proteinase K, and 200 μl Buffer BCL were added in turn. After Vortex blending, the mixtures were in 56℃ water bath for 10 min. For Gram-positive bacteria samples, 180 μl Lysozyme were added. After 37℃ water bath for 30 min, 20 μl Proteinase K, and 200 μl Buffer BCL were added in turn. After Vortex blending, the mixtures were in 56℃ water bath for 10 min. Next, 150 μl anhydrous ethanol was added and mixed. Transferring the mixture to the adsorption column for genome adsorption, 12,000 rpm 1 min. 500 μl Buffer WA were added for removing impurities such as protein, 12,000 rpm 1 min. 600 μl Buffer WB were added for removing salt ions, 12,000 rpm 1 min. Then, for removing ethanol, the adsorption columns were centrifuged at 12,000 rpm for 2 min and standed at room temperature for 5 min. Finally, the adsorption columns were added 50 μl Elution Buffer and standed 5 min. Subsequently, 12,000 rpm 1 min for genome elution. After extraction, with ultraviolet spectrophotometer (NanoDrop One, Thermo, America), the templates were measured at A260/280, and stored under at -20℃ until they were used. The reference strain was set with an isolate of H. influenzae, which was used in the sensitivity and optimisation analysis with pure culture. The 55 sputum samples for exhibiting the feasibility of LAMP-LFB in clinical detection were acquired from patients of Dingzhou People’s hospital with the written informed consent. This study was approved by the Ethics Committee of Dingzhou people’s Hospital, and conducted according to the medical research regulations of the Ministry of Health, China. The patients who were suspected of having H. influenzae, and sputum samples were collected over a period of three straight months.Bacterial strains used in this study
Preparation of lateral flow biosensor
According to previous reports [23, 30, 31], the results of LAMP were detected by using LFB in this study. The LFB is a commercial kit were purchased from Jie-Yi Biotechnology. Co., Ltd. (Shanghai, China). Briefly, a conjugate pad, a absorbent pad, an immersion pad, nitrocellulose membrane and a backing pad were involved in LFB. The dye streptavidin-coated polymer nanoparticles were got together in the conjugated pad. According to the instructions, 0.5 ul LAMP amplification products were added on the LFB pad, the final result will be realistic in 5 min. After that, biotin-BSA and anti-FITC were restrained at test line (TL) and control line (CL).
The standard LAMP-LFB assay
The standard LAMP reaction was conducted in a mixture of 25 μl based on previous research [32]. The reaction system was 25 μl including 2 × reaction mix 12.5 μl, DNA template 5 μl, FIP* primer 0.8 μM, FIP primer 0.8 μM, LF* primer 0.4 μM, LF primer 0.4 μM, F3 primer 0.4 μM, B3 primer 0.4 μM, BIP primer 1.6 μM, LB primer 0.8 μM, and 8 U Bst DNA polymerase large Fragment 1 μl. The amplification reaction was firstly conducted at 63℃ for 1 h. Afterwards, the reaction terminated at 85℃ for 5 min. The reaction system with 1 μl genomic template of H. parainfluenzae, H. haemolyticus, and Staphylococcus aureus strain were chosen as negative controls, respectively. In addition, the blank control reaction system contained 1 μl double distilled water. The detection methods, such as colorimetric indicators, agarose gel electrophoresis and LFB analysis, were applied to detect the LAMP amplification. According to the LFB instruction, 0.5 μl LAMP amplification product was dropped in the sample tank of LFB, then 3 drops of buffer were added to promote product diffusion. About 3–5 min later, the reaction results could be read.
The optimal temperature for LAMP-LFB assay
To evaluate the optimal amplification temperature of H. influenzae LAMP-LFB assay, the amplifications were proceeded for 1 h and in the temperature range of 60℃ to 67℃ with 1℃ intervals. The real-time turbidimeter was used to monitored the reactions. Within 1 h and the threshold value > 0.1 were defined as positive reaction with 10 pg H. influenzae genomic DNA. While, the blank control contained 5 μl of distilled water. Each reaction performed three times.
Analytical sensitivity of the LAMP-LFB assay
For verifying the limit of detection (LOD), the sensitivity of LAMP-LFB assays was proceeded with the gradient genomic DNA extracted from pure culture of H. influenzae, including 10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg, and 1 fg. Four determination techniques, including real-time turbidimeter, colorimetric indicators, LFB analysis and agarose gel electrophoresis, were applied to detect the LAMP amplification. Each reaction conducted three times.
The optimal reaction time of LAMP-LFB assay
The effect of LAMP amplification were examined at different times, and the reaction time was set from 10 to 60 min with 10 min interval, which conducted three times. The LAMP product was detected with colorimetric indicators and LFB.
Specificity evaluation of the LAMP-LFB assay
In order to examine the specificity of the LAMP-LFB, the LAMP reactions were performed with the genomic templates (at least 10 ng/μl) from 10 H. influenzae, 3 H. parainfluenzae, 3 H. haemolyticus, 3 H. parahaemolyticus and 20 non-H. influenzae strains (Table 2). The colorimetric indicators, agarose gel electrophoresis and LFB analysis, were applied to detect the LAMP product. Each sample was analyzed three times independently.
LAMP-LFB practical application in clinical samples
The 55 sputum samples mentioned in Bacterial Strains and Genomic DNA Preparation part were detected according to traditional culture methods, biochemical identification, colony morphology and Gram stain. As a result, H. influenzae isolates were successfully detected from 22 sputum samples. With DNA Isolation Kit as previously described in Reagents and Instruments part, the genomic DNA were extracted from 22 sputum samples that were positive for H. influenzae and another 33 randomly selected sputum samples that were negative for H. influenzae. The PCR carried out according to Torigoe [1] and LAMP method were used to detect H. influenzae in all of the 55 DNA temples. The colorimetric indicators, agarose gel electrophoresis and LFB analysis were used to analyze the LAMP amplification. Then the LAMP-LFB results and PCR results were compared to traditional culture.Additional file 1.
Authors: Leslye L LaClaire; Maria Lucia C Tondella; David S Beall; Corie A Noble; Pratima L Raghunathan; Nancy E Rosenstein; Tanja Popovic Journal: J Clin Microbiol Date: 2003-01 Impact factor: 5.948