A new breeding method of F1 hybrid using male sterility would open an exciting frontier in lettuce breeding, a self-pollinating crop. Male sterility is a crucial trait in F1 hybrid breeding. It is essential to map the causative gene for using male sterility. The ms-S, male-sterile (MS) gene of 'CGN17397', was mapped to linkage group (LG) 8 by ddRAD-seq and narrowed down between two markers using two F2 populations. This region spans approximately 10.16 Mb, where 94 genes were annotated according to the lettuce reference genome sequence (version8 from 'Salinas'). The whole-genome sequencing of the MS lines 'CGN17397-MS' and male-fertile (MF) lines 'CGN17397-MF' revealed that only one gene differed in the area of Lsat_1_v5_gn_8_148221.1, a homolog of acyl-CoA synthetase5 (ACOS5), and was deleted in the MS lines. It was reported that ACOS5 was needed for pollen wall formation and that the null mutants of ACOS5 were entirely male sterility in some plants. Thus, I concluded that Lsat_1_v5_gn_8_148221.1 designated as LsACOS5 was a biologically plausible candidate gene for the ms-S locus. By using the structural polymorphism of LsACOS5, an InDel marker was developed to select the MS trait. The results obtained here provide valuable information for the genic male-sterility in lettuce.
A new breeding method of F1 hybrid using male sterility would open an exciting frontier in lettuce breeding, a self-pollinating crop. Male sterility is a crucial trait in F1 hybrid breeding. It is essential to map the causative gene for using male sterility. The ms-S, male-sterile (MS) gene of 'CGN17397', was mapped to linkage group (LG) 8 by ddRAD-seq and narrowed down between two markers using two F2 populations. This region spans approximately 10.16 Mb, where 94 genes were annotated according to the lettuce reference genome sequence (version8 from 'Salinas'). The whole-genome sequencing of the MS lines 'CGN17397-MS' and male-fertile (MF) lines 'CGN17397-MF' revealed that only one gene differed in the area of Lsat_1_v5_gn_8_148221.1, a homolog of acyl-CoA synthetase5 (ACOS5), and was deleted in the MS lines. It was reported that ACOS5 was needed for pollen wall formation and that the null mutants of ACOS5 were entirely male sterility in some plants. Thus, I concluded that Lsat_1_v5_gn_8_148221.1 designated as LsACOS5 was a biologically plausible candidate gene for the ms-S locus. By using the structural polymorphism of LsACOS5, an InDel marker was developed to select the MS trait. The results obtained here provide valuable information for the genic male-sterility in lettuce.
Lettuce (Lactuca sativa L.), a cool-season vegetable crop, is stressed in high-temperature environments[1,2]. Increasing temperatures associated with climatic change have been shown to affect negatively the growth of lettuce, a major leafy vegetable, and necessitate the development of new cultivars with enhanced stress tolerance. Hybrids usually have better stress tolerance due to hybrid vigor than pure lines and have also been extensively used in leafy vegetable crops such as cabbage and Chinese cabbage to enhance crop production[3,4]. Harnessing hybrids are considered as one of the effective approaches for many leafy vegetable crops[5], and the cultivation of F1 hybrids allows quantum jump in their productivity. Since a cultivation test has already confirmed that lettuce yield of F1 hybrids increased over the parent, and exploitation of hybrid vigor allowed to promise in improving the yield and other quality parameters[6]. Precise control over pollen fertility is a key factor in the production of F1 hybrids in self-pollinating crops[7]. Although the F1 hybrid breeding of the self-pollinating crops such as rice, soybean, wheat, and lettuce would challenge many common-sense assumptions in plant breeding, developments of hybrid rice using genic male sterility (GMS) and cytoplasmic male sterility (CMS) are already underway with great success in China[8,9]. In addition, numerous studies have been also performed for male sterility in soybean and wheat [7,10-14].The present study began from the finding of a GMS plant in the inbred lines of ‘CGN17397’ (Fig. 1)[15]. Because lettuce has a compound autogamous floral structure, it is impossible to completely remove pollen from the flower[1]. Male sterility which can avoid unnecessary maternal self-pollination is not only an essential trait for the hybrid breeding approach in lettuce, and is also useful in the fundamental study of genetic and phenotypic investigations using F1 progeny such as disease resistance. In contrast to CMS, the phenotype of GMS is recognized after flowering. Hence, genetic markers linked to the male-sterile (MS) locus are needed to select MS plants at the pre-planting stage[16]. The markers for the ms-S gene have been developed by an amplified fragment length polymorphism (AFLP) technique so far, but all markers were located on the same side of the gene[15]. In this study, genetic mapping of the ms-S gene was conducted in two F2 populations obtained from a cross between MS and male-fertile (MF) plants. Additionally, by employing the whole-genome sequencing of MS lines ‘CGN17397-MS’ and MF lines ‘CGN17397-MF’, the candidate gene for male sterility was identified to develop a reliable PCR-based marker for MAS (Marker Assisted Selection).
Figure 1
At the flowering time, stigmas emerge from the anther sheaths. (a) An inflorescence of Lactuca sativa: The inflorescence is composed of 7–15 yellow florets. (b) Pistil of a MF flower of ‘CGN17397-MF’: There are pollen grains on the stigma. White arrows indicate pollen grains. (c) Pistil of a MS flower of ‘CGN17397-MS’: There are no pollen grains on the stigma.
At the flowering time, stigmas emerge from the anther sheaths. (a) An inflorescence of Lactuca sativa: The inflorescence is composed of 7–15 yellow florets. (b) Pistil of a MF flower of ‘CGN17397-MF’: There are pollen grains on the stigma. White arrows indicate pollen grains. (c) Pistil of a MS flower of ‘CGN17397-MS’: There are no pollen grains on the stigma.
Results
Inheritance of male sterility
MS phenotypes of the F2 individuals from a cross between MS plant ‘2008–83-MS’ and MF plant ‘UenoyamaMaruba’ and a cross between MS plant ‘CGN17397-MS’ and MF plant ‘Salinas’ were visually determined by whether there were pollen grains on stigmas or not at the flowering time. The MS trait derived from ‘CGN17397-MS’ was proposed to be controlled by a single recessive gene, according to the segregation of putative genotype of the male-sterile gene showing a 1:3 ratio in the two F2 populations (Table 1). These results are consistent with the previous study[15].
Table 1
Segregation of male sterility in the two F2 populations.
Population
Maternal parent
Paternal parent
No. of sterile plants
No. of fertile plants
Total
Segregation ratio
χ2 (1:3)
F2
2008–83-MS
UenoyamaMaruba
22
68
90
1:3.09
0.90
F2
CGN17397-MS
Salinas
29
67
96
1:2.31
0.24
Segregation of male sterility in the two F2 populations.
Linkage analysis for male sterility trait by ddRAD-seq analysis
For genetic mapping of the locus for the male sterility, double-digest restriction site-associated DNA sequencing (ddRAD-seq) analysis was conducted for constructing a linkage map using the F2 population from a cross between ‘2008–83-MS’ and ‘UenoyamaMaruba’. For the setting of RAD-R scripts[17], BWA mode, construction method, and correction approach were “mem_60″, “ABH”, and ”6US” respectively. Then, the 1241 pairs of RAD tags in two parents were employed as codominant markers for genetic mapping of male sterility and used for linkage map construction (Fig. S1). By summarizing the linkage map, the total length of the linkage map was 1815.6 centi-Morgan (cM). Marker density ranged from 1.2 cM (LG2) to 2.0 cM (LG1) per marker. The number of markers in the linkage groups ranged from 93 (LG1) to 194 (LG5). Summary statistics of the linkage map are shown in Table 2. The segregation data of the genotype of the F2 population and the phenotype of MS traits showed that the ms-S gene was located at the position between 238.429 Mbp and 257.031 Mbp with the interval of 4.6 cM on LG8 (Fig. 2a). Genotyping using three PCR-based markers designed in this region was conducted for fine mapping (Table 3). However, the area could not be further narrowed in this population because these three markers showed complete cosegregation with male sterility (Fig. 2a). Then, the F2 population derived from a cross between ‘CGN17397-MS’ and ‘Salinas’ was employed to further mapping of the target locus using PCR-based markers. The gene of the male sterility was located at the position between 246.869 Mbp and 263.743 Mbp with the interval of 6.6 cM on LG8 (Fig. 2b), and LG8_v8_250.793Mbp indicated complete cosegregation with the male sterility based on the two F2 populations (Figs. 2, 3). The results of mapping using the two F2 populations demonstrated that the ms-S gene is located at the position between 246.869 Mbp and 257.031 Mbp on LG8 (Fig. 2).
Table 2
Summary of integrated lettuce linkage groups.
Linkage groups
Total mapped tags
Common tags
2008–83-MS unique tags
UenoyamaMaruba unique tags
Linkage construct marker
No. biallelic tags
Map length
Average interval between markers
No.RAD-tags
(%)
No.RAD-tags
(%)
No.RAD-tags
(%)
(cM)
(cM)
LG1
124,945
22,471
18.0
54,780
43.8
47,694
38.2
93
184.5
2.0
LG2
129,078
21,774
16.9
57,304
44.4
50,000
38.7
145
180.7
1.2
LG3
156,126
29,616
19.0
69,645
44.6
56,865
36.4
153
203.6
1.3
LG4
233,307
40,703
17.4
105,380
45.2
87,224
37.4
180
255.3
1.4
LG5
206,664
36,684
17.8
93,595
45.3
76,385
37.0
194
273.5
1.4
LG6
123,784
20,567
16.6
55,848
45.1
47,369
38.3
121
173.2
1.4
LG7
124,880
21,275
17.0
53,338
42.7
50,267
40.3
106
161.6
1.5
LG8
183,044
33,217
18.1
82,951
45.3
66,876
36.5
134
221.1
1.6
LG9
131,647
21,519
16.3
59,308
45.1
50,820
38.6
115
162.0
1.4
Total
1,413,475
247,826
17.5
632,149
44.7
533,500
37.7
1241
1815.6
1.5
Figure 2
The mapped location of the ms-S locus on LG8 in two populations. Genetic distances (cM) were shown between the markers. “(RAD)” and “(PCRbased)” in the marker name indicate ddRAD-seq markers and PCR-based markers, respectively. “ms-S” indicates the position of the causal gene for male sterility. Black bars indicate ms-S locus. (a) Linkage mapping of the ms-S locus using an F2 population derived from a cross between ‘2008–83-MS’ and ‘UenoyamaMaruba’. (b) Mapping of the ms-S locus using an F2 population derived from a cross ‘CGN17397-MS’ and ‘Salinas’.
Table 3
Primers for the PCR-based markers in ms-S locus.
Primer name
Primer sequence (5'–3')
PCR product size (bp)
CGN17397-MS
Salinas
2008–83-MS
Uenoyama Maruba
LG8_v8_241.563Mbp_F
TTCGATCTCCGACGATTTATG
231
268
231
268
LG8_v8_241.563Mbp_R
CTAAGGAAACGGGAGGCAAT
LG8_v8_246.869M_F
GTTTGGTTTGCGGATTCCTA
242
267
242
267
LG8_v8_246.869M_R
GTGCAACCAATTAGCATTCG
LG8_v8_250.793Mbp_F
GATCCCTTCCAAAACTTGAGG
220
573
220
573
LG8_v8_250.793Mbp_MS_R
GGGCGGAGTCCATTATTTGT
LG8_v8_250.793Mbp_MF_R
TGCTCAACGATCTTGTTTGTG
LG8_v8_263.743M_F
TTTGAAAGCATAGGGATCATCT
297
304
304
297
LG8_v8_263.743M_R
GTTCATACCGTCGGATCGTT
Figure 3
Agarose gel electrophoresis profiles for the Indel marker, LG8_v8_250.793Mbp, linked to the male sterility. Red arrows indicate the bands of 573 bp, and white arrows indicate the bands of 220 bp. Lane 1 fertile parent ‘CGN17397-MF’; lane 2 sterile parent ‘CGN17397-MS’; lanes 3–5 sterile F2 plants, F2-2, F2-3, and F2-11; lanes 6–9 fertile heterozygous F2 plants, F2-4, F2-8, F2-10, F2-13, and F2-14, lanes 11–13 fertile homozygous F2 plants, F2-1, F2-5, and F2-6; lane M 100 bp ladder marker. Original gel is presented in Supplementary Figure S2.
Summary of integrated lettuce linkage groups.The mapped location of the ms-S locus on LG8 in two populations. Genetic distances (cM) were shown between the markers. “(RAD)” and “(PCRbased)” in the marker name indicate ddRAD-seq markers and PCR-based markers, respectively. “ms-S” indicates the position of the causal gene for male sterility. Black bars indicate ms-S locus. (a) Linkage mapping of the ms-S locus using an F2 population derived from a cross between ‘2008–83-MS’ and ‘UenoyamaMaruba’. (b) Mapping of the ms-S locus using an F2 population derived from a cross ‘CGN17397-MS’ and ‘Salinas’.Primers for the PCR-based markers in ms-S locus.Agarose gel electrophoresis profiles for the Indel marker, LG8_v8_250.793Mbp, linked to the male sterility. Red arrows indicate the bands of 573 bp, and white arrows indicate the bands of 220 bp. Lane 1 fertile parent ‘CGN17397-MF’; lane 2 sterile parent ‘CGN17397-MS’; lanes 3–5 sterile F2 plants, F2-2, F2-3, and F2-11; lanes 6–9 fertile heterozygous F2 plants, F2-4, F2-8, F2-10, F2-13, and F2-14, lanes 11–13 fertile homozygous F2 plants, F2-1, F2-5, and F2-6; lane M 100 bp ladder marker. Original gel is presented in Supplementary Figure S2.
Identification of candidate genes in ms-S locus by whole-genome sequencing
The ms-S locus was found to include 94 genes annotated according to the lettuce reference genome sequence (version8 from crisphead cultivar ‘Salinas’) (Table S1). Whole-genome sequencing data of the MS and MF lines revealed that a genomic region of about 4 kb containing the Lsat_1_v5_gn_8_148221.1 was completely deleted in only the MS lines (Fig. 4). According to the reference genome sequence, Lsat_1_v5_gn_8_148221.1 encodes an acyl-CoA synthetase5 (ACOS5), which might be orthologous to Arabidopsis MS gene AtACOS5[18,19]. To further elucidate the relationship among Lsat_1_v5_gn_8_148221.1, AtACOS5, AAO25511, and BnACOS5, these four genes were examined for amino acid alignment by employing Clustal W. The results showed that there was significant conservation within the AMP-binding domain and the fatty acid-binding domain of ACOS5[20] (Fig. 5a). The phylogenetic analysis showed that Lsat_1_v5_gn_8_148221.1 was categorized into the ACOS5 group, which is related to male sterility in some plant species[18,21] (Fig. 5b). Based on the results, the gene might be the candidate gene for ms-S because of its homology with the known recessive MS gene and was designated as LsACOS5. For the other 93 genes, the genomic sequences were completely identical between the two lines (Table S1). And, some genes were reported to be expressed in flowers such as SCD1 indicated as ORF 5[22], but no genes were known to cause the null mutant to be the MS phenotype. The LG8_v8_250.793Mbp designed using the genomic regions of the candidate gene (Fig. 4, Table S1) had polymorphism between ‘CGN17397-MS’ and ‘CGN17397-MF’ and was completely cosegregated with the MS trait in the two F2 populations (Fig. 2). These results suggest that LsACOS5 is a biologically plausible candidate gene for ms-S.
Figure 4
Screenshot of IGV software at around 250.7 Mb on LG8. Sequence reads of ‘CGN17397-MF’ and ‘CGN17397-MS’ aligned against a reference genome sequence. The deletion is displayed in only the MS lines ‘CGN17397-MS’.
Figure 5
Sequence alignment of LsACOS5 and its homologs. (a) Amino acid sequences alignment of Arabidopsis thaliana (AT1G62940), Lactuca sativa (Lsat_1_v5_gn_8_148221.1), Nicotiana sylvestris (AAO25511), and Brassica napus (BnACOS5). The sequences were aligned using ClustalW and displayed using BOXSHADE with MEGA X. Red frames indicate the conserved AMP-binding domain and fatty acid-binding domain. (b) A neighbor-joining phylogenetic tree of LsACOS5 and its homologs in some plants. Bootstrap values are the percentage of 1000 replicates.
Screenshot of IGV software at around 250.7 Mb on LG8. Sequence reads of ‘CGN17397-MF’ and ‘CGN17397-MS’ aligned against a reference genome sequence. The deletion is displayed in only the MS lines ‘CGN17397-MS’.Sequence alignment of LsACOS5 and its homologs. (a) Amino acid sequences alignment of Arabidopsis thaliana (AT1G62940), Lactuca sativa (Lsat_1_v5_gn_8_148221.1), Nicotiana sylvestris (AAO25511), and Brassica napus (BnACOS5). The sequences were aligned using ClustalW and displayed using BOXSHADE with MEGA X. Red frames indicate the conserved AMP-binding domain and fatty acid-binding domain. (b) A neighbor-joining phylogenetic tree of LsACOS5 and its homologs in some plants. Bootstrap values are the percentage of 1000 replicates.
Discussion
Because an F1 hybrid has a potential character that grows faster and has a shorter cultivation period in a field, the risk against bacterial disease accelerated by rain would be below. Thus, F1 hybrids are commonly anticipated to display high productivity under stressful conditions. In lettuce, the exploitation of the F1 hybrid could be one of the effective approaches to maintain a stable yield, particularly in tropical and subtropical regions. A new crisphead cultivar ‘Fine green’ was indeed the first F1 hybrid bred by Kaneko seeds CO., LTD. in Japan, but unfortunately, the technical detail of the breeding method was not announced publicly. In general, the MS plant is worth exploring as the key factor of F1 hybrid breeding, and several GMS mutants were also reported in lettuce so far[23]. The genetic mechanism is not understood, and this is the first report of the identification of the MS gene in lettuce. It is valuable to ascertain the genetic mechanism of MS plants to select a future breeding strategy.In this study, the two F2 populations were used to locate the MS gene to the region between the two PCR-based markers, LG8_v8_246.869Mbp and LG8_v8_257.031Mbp. Although the genomic region of the ms-S locus was relatively large, the whole-genome sequencing for ‘CGN17397-MS’ and ‘CGN17397-MF’ revealed only 1 different gene, Lsat_1_v5_gn_8_148221.1, between 2 lines in these 94 annotated genes in the ms-S locus (Table S1, Fig. 4). The gene encoded an acyl-CoA synthetase 5 (ACOS5) and was a potential ortholog of the key MS gene ACOS5 in some plants such as Arabidopsis, Tobacco, and Brassica napus[24,25] (Fig. 5a). The ACOS5 acted as acyl-CoA synthase to regulate the biosynthesis of sporopollenin to affect male fertility, and a null mutant was entirely male-sterility[18]. ‘CGN17397-MS’ displayed normal vegetative growth and complete male-sterility insensitive to environmental conditions. There were no other obvious morphological differences between the MS and MF lines. Lettuce was generally only flowering for about two hours in the morning, but the MS lines could continue to flower through the afternoon. Thus, the MS mutants of lettuce and Arabidopsis showed phenotypic similarities[18]. I concluded that LsACOS5 was a biologically plausible candidate gene for the ms-S locus (Figs. 2, 3, 4, Table S1).In addition, the insertion/deletion (InDel) marker—LG8_v8_250.793Mbp—tightly linking to LsACOS5 was developed. By using the InDel marker, it was possible to select MS plants for a conventional-breeding program (Figs. 1c, 3). Due to the structure of the lettuce flower, it was challenging to examine the inheritable characteristics of valuable traits[1], such as disease resistance in only the F1 seeds because crosses produced not only F1 seeds but also self-pollinated seeds. Because only F1 hybrid seeds can be produced using GMS plants for crossbreeding, research on valuable traits that could not be analyzed in the past would be facilitated.The F1 seed production system was needed to promote the commercial production of F1 hybrids. To propagate the F1 hybrid seeds in the case of rice, the maternal and paternal plants were alternately cultivated in a field to cross by the wind and artificial pollination[26]. But lettuce pollen was not dispersed by wind, the F1 seed production system has been already developed using insect pollination at a greenhouse. The fact that flies and bees were adopted for the system due to an absence of specialist pollinators of lettuce, the self-pollinating crop, could propagate the F1 hybrid seeds[27,28]. Moreover, the F1 hybrids are likely to be suitable for cultivation in not only fields but also plant factories. The trait of rapid growth was economically important for the cultivation in plant factories. The breeding of F1 hybrids suitable for cultivation in fields and plant factories is an issue for the future.To date, genome editing technology makes it possible to create knockout mutants of the target gene. GMS plants generally have a problem of seed mixture for the MS and MF progeny. Still, a novel hybridization platform known as the third-generation breeding technique has been successfully selected for non-transgenic GMS seeds[8]. Combining these two techniques could also be applied for the F1 hybrid breeding in lettuce, and it converts any elite cultivars into a commercial MS plant and accelerates the development of F1 hybrid cultivars. The applications of the GMS plant initiative to the rise of considerable potential for lettuce breeding.
Methods
Plant materials
The plant materials were grown at the Nagano Vegetable and Ornamental Crops Experiment Station (Shiojiri City, Nagano prefecture, Japan; 36° 10′ N, 137° 93′ E). The genic MS plant was discovered as a spontaneous mutation in ‘CGN17397’ (Fig. 1). In this paper, the MS and MF lines were designated ‘CGN17397-MS’ (alias ‘MS1024’) and ‘CGN17397-MF’, respectively[15]. ‘CGN17397-MS’ and ‘CGN17397-MF’ were used for whole-genome sequencing. ‘2008–83-MS’ was obtained from a cross between ‘CGN17397-MS’ and a cultivar ‘Patriot’ at Nagano Vegetable and Ornamental Crops Experimental Station. A total of 90 individuals from the F2 progeny obtained from a cross between ‘2008–83-MS’ and ‘UenoyamaMaruba’ (L. serriola) were used for linkage analysis using ddRAD-seq. The MS trait was visually examined at the flowering time. Additionally, 96 individuals of F2 progeny obtained from a cross between ‘CGN17397-MS’ and ‘Salinas’ were used for further mapping using PCR-based markers.
Linkage analysis based on ddRAD-seq
Genomic DNA was extracted from leaves using the Nucleo-Spin Plant II Extract Kit (Machery-Nagel, Duren, Germany). The RAD-seq library construction was performed following a previously described method[2,29]. The ddRAD-seq libraries were sequenced using the HiSeq4000 platform (Illumina, San Diego, CA, USA). Paired-end sequencing reads (100 bp × 2) were analyzed for ddRAD-seq tag extraction, counting, and linkage map construction using RAD-R scripts[17]. The read mapping was performed with the RAD tags in each parent against the lettuce reference genome sequence [version8 from crisphead cultivar ‘Salinas’ (https://genomevolution.org/coge/GenomeInfo.pl?gid=28333)]. The linkage map was graphically visualized using Mapchart and R/QTL[30,31]. Raw sequence data (FASTQ) in this ddRAD-seq were deposited in the DNA Data Bank of Japan (DDBJ) Sequence Read Archive (http://ddbj.nig.ac.jp/dra/index_e.html) under accession number DRA012711.
Designing PCR-based markers and their amplification
Polymorphisms between parental lines around the ms-S locus, including insertion, deletion, and SNP, were surveyed to identify the marker sites using the IGV software[32]. Primers for amplifying the markers were designed using the Primer3 website (http://bioinfo.ut.ee/primer3-0.4.0/), and their IDs (names) were defined as (linkage group) _ (genome version) _ (genome position). PCR was conducted using 0.5 μL of DNA template, 0.4 μL of each primer (50 μM), 2 μL of dNTP (2 mM), 5 μL of 2 × PCR Buffer, 0.2 μL of KOD FX (1 U/μL, TOYOBO, Japan), and distilled water (dH2O) to a final volume of 10 μL. PCR conditions were as follows: at 94 °C for 5 min, 30 cycles of at 94 °C for 30 s, and at 61 °C for 30 s followed by 1 cycle at 72 °C for 4 min. 9 μL of PCR products were employed to electrophoresis on 2.5% agarose gel (Takara-bio, Japan) at 100 V after amplification.
Resequencing analysis
Genomic DNA was extracted from young leaves of the two lines (‘CGN17397-MS’ and ‘CGN17397-MF’) using NucleoSpin Plant II (Machery-Nagel, Duren, Germany) and was used to construct paired-end sequencing libraries (100 bp × 2) and subjected to whole-genome sequencing using the HiSeqX (Illumina) and DNBSEQ-500 (MGI) platform. The resequencing analyses were conducted according to the previously described method[2]. Raw sequence data (fastq) for this resequencing analysis are available in the DDBJ Sequence Read Archive at accessions DRA012737.
Phylogenetic analysis
The protein sequence of the candidate gene was searched for homologs from the plant species using basic local alignment search tools (BLAST) at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). Multiple sequence alignments of the full-length protein sequences were conducted using ClustalW and displayed using BOXSHADE (https://embnet.vital-it.ch/software/BOX_form.html). The phylogenetic tree was generated using MEGA X program[33] using the neighbor-joining method with default parameters besides 1000 bootstrap replications.
Ethical statement
The author assures that legislation on seed collection has been accomplished. Permission obtained from responsible authority to collect seeds.
Ethical approval
All the experiments carried out on plants in this study were in compliance with relevant institutional, national, and international guidelines and legislation.Supplementary Information.
Authors: Zhenyi Chang; Zhufeng Chen; Na Wang; Gang Xie; Jiawei Lu; Wei Yan; Junli Zhou; Xiaoyan Tang; Xing Wang Deng Journal: Proc Natl Acad Sci U S A Date: 2016-11-18 Impact factor: 11.205
Authors: Clarice de Azevedo Souza; Sung Soo Kim; Stefanie Koch; Lucie Kienow; Katja Schneider; Sarah M McKim; George W Haughn; Erich Kombrink; Carl J Douglas Journal: Plant Cell Date: 2009-02-13 Impact factor: 11.277
Authors: Tanya G Falbel; Lisa M Koch; Jeanette A Nadeau; Jose M Segui-Simarro; Fred D Sack; Sebastian Y Bednarek Journal: Development Date: 2003-09 Impact factor: 6.868