Molecular Diagnosis of Primary Hyperoxaluria Type 1 and Distal Renal Tubular Acidosis in Moroccan Patients With Nephrolithiasis and/or Nephrocalcinosis.

Nephrolithiasis (NL) and urolithiasis (UL) are usual reasons for hospitalization and presentation in pediatric outpatient departments and their incidence continues to rise worldwide. In Morocco, a previous epidemiological study done in the Fez region between January 2003 and November 2013 reported a prevalence of 0.83% of childhood UL. In two studies, heritability accounted for almost half of all NL or nephrocalcinosis (NC) prevalence. Genetic factors must be considered in the etiological diagnosis of urinary lithiasis in Morocco since the frequency of consanguineous marriages is high. Hereditary tubular disorders, especially distal renal tubular acidosis (dRTA) and Dent disease, and metabolic disorders like idiopathic hypercalciuria and hyperoxaluria are the most common causes of medullary NC. Primary hyperoxaluria type 1 (PH1), which can generate an early onset of NC, and often chronic kidney disease (CKD) should always be considered and thoroughly diagnosed. The aim of this work was to establish a molecular diagnosis of PH1 and dRTA and, thus, to predict and explain the disease phenotype in a cohort of 44 Moroccan patients with NL and/or NC by analyzing the AGXT and ATP6V1B1 genes that cause NL and/or NC when mutated. Disease phenotype was molecularly explained and solved in six of 44 individuals with NL and/or NC (13.6%). In the pediatric subgroup of individuals, a causative mutation in 16.2% was identified, whereas in the adult cohort no pathogenic mutation was detected. In our patients, PH1 was objectified in 67% of cases followed by dRTA in 33% of cases. We suggest that prompt detection and prophylactic treatment of UL are necessary to limit the risk of everlasting renal damage and thus prevent or delay the progression to CKD.

Introduction

Nephrolithiasis (NL) and urolithiasis (UL) can be defined by solid stones developed in the kidney (NL) or the lower urinary tract (UL). Nephrocalcinosis (NC) results from calcium phosphate or calcium oxalate deposition in the kidney parenchyma, mainly in tubular epithelial cells and in the interstitial tissue [1]. NC is evaluated by ultrasonography according to the anatomical region of the deposit which can be cortical and diffuse NC or medullary NC, with the latter being classified as grade I, II, or III depending on their degree of echogenicity [2]. All three stages are frequently encountered during hospitalization and presentation in pediatric departments [3]. Although the incidence and the prevalence of NL and NC are still unknown, the condition is not so rare. Over the last several decades, the incidence of pediatric NL and NC has notably risen [4]. Episodes of colicky pain, the necessity for surgical intervention, high recurrence rate, and high economic cost are the major factors that can initiate a progression to chronic kidney disease (CKD), which may explain high morbidity in NL/NC patients [5]. NL is developed by up to 10% of individuals worldwide [6]. In Morocco, incidence and risk factors for hospitalization due to stone prevalence are seen more in adults than children. Indeed, the prevalence of childhood UL between January 2003 and November 2013 was estimated to be 0.83% [7]. Genetic and anatomical causes represent the main risk factors (~75%) for the development of kidney stones in children [8]. Kidney stones are not the disease itself, but the first symptom of the underlying disease and do not represent the diagnosis, which means that every first kidney stone in children has to be investigated carefully to disclose the underlying disease [3,9]. NL and NC are known to share a certain degree of heritability. In fact, NL and/or NC of hereditary origin can make up to half of the total cases [10,11]. Mutations in at least 30 genes can lead to monogenic forms of NL and/or NC due to autosomal-recessive, autosomal-dominant, or X-linked transmission, according to the Online Mendelian Inheritance in Man (OMIM) database. Causative mutations in 11.4% of adults and 20.8% of early-onset cases with NC/NL have been reported by Halbritter et al. [11]. This does not only confirm a considerable occurrence of heritable NL/NC but also demonstrates the importance of mutation detection for prescribing appropriate therapeutic and preventative measures. Hereditary monogenic kidney stones are classified into three groups: 1) inborn errors of metabolism of which primary hyperoxaluria type 1 (PH1) is the most dreadful; 2) congenital tubulopathies, especially distal renal tubular acidosis (dRTA) with or without hearing loss; 3) cystinuria [12]. In Morocco, the frequency of consanguineous marriages is very high. In fact, the homogenization of the gene pool of the population is reflected at the individual level by the accumulation of recessive alleles in the homozygous state within the loci, thus increasing the risk of expression of monogenic or even multifactorial diseases [13]. In this study, we aimed to establish, in a cohort of 44 Moroccan patients with NL and/or NC, a molecular diagnosis of PH1 and dRTA by analyzing, respectively, the AGXT and ATP6V1B1 genes that cause NL and/or NC when mutated.

Materials and methods

Patients

Forty-four Moroccan patients from 40 unrelated families were enrolled in this study. Patients were recruited from the nephrology and pediatric departments of Hassan II University Hospital in Fez. The study was approved by the University Hospital Ethics Committee (Faculty of Medicine and Pharmacy, Fez) and referenced as 06/18. Patients were informed about the aim of the study, and their consent to genetic testing was obtained. The inclusion criterion of this study was defined by the first clinical manifestation of NL and/or the existence of NC on renal ultrasound. However, the exclusion criterion includes any condition or medication that might have caused a secondary renal stone disease. Clinical data, pedigree information, and blood samples were collected from 44 individuals. The collected data for this cohort include sex, age, history of consanguinity, and ultrasound findings. The cohort was composed of 32 male and 12 female patients. Among these, 33 had NL and nine demonstrated NC by renal ultrasound. Two exhibited both NC and NL.

Molecular genetic testing

QIAamp DNA Blood Mini Kit (Qiagen, Inc.) was used to extract genomic DNA from the patient’s peripheral blood. The molecular study was performed by direct sequencing of exons 1, 2, 7, 9, and 10 of the AGXT gene to investigate the Maghrebian mutation, p.Ile244Thr, and the described Moroccan mutations: p.Val326TyrfsX15, p.Lys12ArgfsX34, and p.Arg111X [14], and exon 12 of ATP6V1B1 gene to inquire into the most recurrent mutation in North African populations, c.1155dupC [15-17]. All studied exons (coding regions and exon-intron junctions) of each gene were amplified by polymerase chain reaction (PCR).

PCR reactions were performed in a total volume of 25 µL containing 10 ng of DNA for exons 1 and 2 of AGXT gene, 100 ng of DNA for the rest of exons, 2.5 µL of 10× enzyme buffer, 0.2 mM of each dNTP, 1.5 mM MgCl2, 0.4 µM of each primer, and 0.5 U Taq DNA polymerase (Invitrogen). All PCR primers and conditions are illustrated in Table 1.

Table 1

Oligonucleotide primers used for polymerase chain reaction

Gene		Forward	Reverse	Amplicon length (bp)	Annealing temperature (°C)
ATP6V1B1	Exon 12	GCTTCAAAGTGGTTTTTGTCC	GAGTCCAGTGCCCCCAAC	535	60
AGXT	Exon 1	CCGAGCACAAGCACAGATAA	TGAGACCCAGGCTCCCCGC	453	65
	Exon 2	CCTTCCAACCTGCCTCCT	GGGCTGCCAGCTTCAAAC	494	65
	Exon 7	CCGTCTCACTCCCGTGAAAC	CACCTCTCAGCCATCCCCAG	246	65
	Exons 9-10	CAGGCAAAGTCAAACTGG	TGCACAGTCCTGCTCAAG	827	65

Amplification by PCR was carried out in a ProFlexTM thermocycler (Applied Biosystems®, Waltham, MA, USA) according to the following program: an initial denaturation step at 95°C for 1 min followed by 35 cycles of denaturation at 94°C for 30 s, annealing for 1 min, and extension at 72°C for 1 min, before a final extension step at 72°C for 9 min. Annealing temperatures varied depending on the exon to be amplified (Table 1). PCR products were analyzed by electrophoresis through 2% agarose gels. Gels were stained with ethidium bromide and DNA was visualized under UV.

Direct sequencing was performed, with the same primer sets used for PCR, on an ABI 3500Dx Genetic Analyzer v2.3 using the BigDye Terminator Kit (Applied Biosystems: ABI) and the SeqA v5.4 software (Applied Biosystems: ABI) (https://www.thermofisher.com/order/catalog/product/4360967) following the manufacturer's instructions (https://www.thermofisher.com/document-connect/document-connect.html?url=https%3A%2F%2Fassets.thermofisher.com%2FTFS-Assets%2FLSG%2Fmanuals%2Fcms_041266.pdf). To determine the presence of mutations in the amplified exons, each sequence was analyzed using the sequence alignment program Nucleotide BLAST tool (Blastn) (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome) of the National Center for Biotechnology Information (NCBI) (https://www.ncbi.nlm.nih.gov/).

Statistical analysis

Analysis of the collected data was done using the Statistical Package for the Social Sciences (SPSS) version 22.0 (SPSS Inc., Chicago, IL, USA). Frequencies and percentages were used to describe the data. To compare the proportion of values in each category, we used nonparametric chi-square (goodness-of-fit test). P-value was considered statistically significant when <0.05 for all tests.

Results

Patients' epidemiological and clinical data

Forty-four patients from 40 unrelated families from different regions of Morocco were enrolled in this study: 12 female and 32 male patients with a sex ratio M/F of 2.7. Patients were aged from 1 to 58 years and 84% were <18 years. The average delay between the onset of a lithiasis disease and the diagnosis of the hereditary cause determined in six cases was six years (2-10 years) (Table 2). Consanguinity was present in 43% of these patients, while 57% of them showed negative consanguinity. According to the presenting complaint, 3 (6.8%) of the patients had sensorineural hearing loss and 5 (11.4%) were diagnosed with failure to thrive. Renal ultrasound results were in favor of NC in 9 (20.5%) patients, NL in 33 (75%), and both NL and NC in 2 (4.5%) (Table 3).

Table 2

Demographic characteristics of patients

Characteristics	Frequency (%)
Sex
Male	32 (72.7)
Female	12 (27.3)
Age at presentation
<18 years	37 (84)
≥18 years	7 (16)
Consanguinity
Yes	19 (43)
No	25 (57)

Table 3

Clinical profile of patients

NL, nephrolithiasis; NC, nephrocalcinosis.

Characteristics	Frequency (%)
Presenting complaint
Sensorineural hearing loss	3 (6.8)
Failure to thrive	5 (11.4)
Ultrasound finding
Nephrolithiasis	33 (75)
Nephrocalcinosis	9 (20.5)
NL+NC	2 (4.5)

Identification of mutations

A molecular diagnosis was performed first by direct sequencing of selected exons 1, 2, 7, 9, and 10 of the AGXT gene to investigate the Maghrebian mutation, c.731T>C/p.I244T, and the described Moroccan mutations, p.Val326TyrfsX15, p.Lys12ArgfsX34, and p.Arg111X, and second by direct sequencing of exon 12 of ATP6V1B1 gene to examine the most recurrent mutation in North African populations, c.1155dupC. Analysis of all studied exons (coding regions and exon-intron junctions) of each gene showed the presence of the Maghrebian and recurrent mutation, c.731T>C/p.I244T, in AGXT gene in four patients and the previously reported frameshift mutation c.1155dupC/p.Ile386Hisfs*56 in two patients, and all mutations were in a homozygous state. Such molecular diagnosis allowed us to explain the disease phenotype in six of 44 individuals with NL and/or NC (13.6%) (Figure 1). We also detected a causative mutation in 16.2% (six of 37) of patients in the pediatric subgroup, which demonstrated an onset before 18 years of age. However, we did not identify any pathogenic mutation in the adult cohort (≥18 years), a result that seems to be statistically not significant (P = 0.568). The sex of the molecularly solved patients was normalized to that of the cohort and allowed us to verify a possible correlation between sex and monogenic causes of the disease. The cohort consisted of 12 females and 32 males of whom five carrying pathogenic mutations were male and one was female (Table 4), resulting in a statistically insignificant difference in the detection of pathogenic mutations between sexes (P = 0.664). The age of patients when the disease first manifested was less than six years for those with PH1 and less than one year for the patient diagnosed with dRTA. All PH1 patients presented isolated NL (P = 0.558), and their parents had positive consanguinity (P = 0.029). Two PH1 patients had renal impairment; three had a positive family history of renal stone. Two PH1 patients were siblings. For the remaining two patients with dRTA, their parents had positive consanguinity (P = 0.181). They presented medullary NC (P = 0.038), sensorineural hearing loss (P = 0.003), and failure to thrive (P = 0.011).

Figure 1

Established molecular diagnoses in six of 44 (13.6%) individuals with NL and/or NC.

A flow chart showing the distribution for molecular diagnoses of NL and/or NC.

NL, nephrolithiasis; NC, nephrocalcinosis.

Table 4

Molecular genetic diagnoses established in five of 44 (11.4%) individuals with NL/NC

NL, nephrolithiasis; NC, nephrocalcinosis; dRTA, distal renal tubular acidosis.

Patient  code	Gene [protein]	Nucleotide change	Amino acid change	Zygosity state	Sex	Age of onset (years)	NL/NC	Genetic diagnosis (after mutational analysis)
P1	ATP6V1B1 [ATPase, H+ transporting, lysosomal 56/58 kDa, V1 subunit B1]	c.1155dupC	p.Ile386Hisfs*56	hom	M	<1 (3 months)	NC	dRTA, deafness
P2	ATP6V1B1 [ATPase, H+ transporting, lysosomal 56/58 kDa, V1 subunit B1]	c.1155dupC	p.Ile386Hisfs*56	hom	F	2	NC	dRTA, deafness
P3	AGXT [Alanine-gloxylate aminotransferase]	c.731T>C	p.lle244Thr	hom	M	5	NL	PH1
P4	AGXT [Alanine-gloxylate aminotransferase]	c.731T>C	p.lle244Thr	hom	M	6	NL	PH1
P5	AGXT [Alanine-gloxylate aminotransferase]	c.731T>C	p.lle244Thr	hom	M	5	NL	PH1
P6	AGXT [Alanine-gloxylate aminotransferase]	c.731T>C	p.lle244Thr	hom	M	6	NL	PH1

Discussion

Early onset of NL and NC in children are frustrating conditions for both clinicians and families because they are frequently unnoticed. Many monogenic mutations responsible for NL and/or NC pathologies have been identified in recent years [18]. In this study, 44 patients with NL and/or NC underwent a mutational analysis. By sequencing the coding regions of AGXT and ATP6V1B1 genes, which are among the genes known to lead to monogenic NL and/or NC, we spotlighted causative mutations in six out of 44 of them (13.6%).

After analyzing the age distribution of patients in whom causative mutations are identified, it has been shown that recessive monogenic diseases usually occur earlier in life than dominant monogenic diseases [11]. Furthermore, genetic causes for the development of kidney stones are more frequent in children, while in adults kidney stones are predominantly due to dietary imbalance [12,19], Our results agree with this for monogenic causes of NL and/or NC. Table 4 shows that all mutated patients had an onset before 18 years of age. The average delay between the onset of a lithiasis disease and the diagnosis of the hereditary cause, as determined in six cases, was six years (2-10 years). In infantile renal tubular diseases, clinical manifestations occur mostly in the first decades of life and are easily diagnosed [20,21]. In one of our patients, the clinical manifestations started at the age of three months but the diagnosis of the etiology in question was molecularly confirmed eight years later. Indeed, there is a great delay in the diagnosis of the hereditary character of NL and/or NC. In our patients, the average delay was of six years even though the main elements that point to a genetic cause were common: a high percentage of parental consanguinity; familial cases of UL; dialysis nephropathy or death; bilateral, multiple, and recurrent calculus; or NC [20]. The fact that the correlation between sex or age of onset and monogenic causes of disease was statistically not significant ((P = 0.664) and (P = 0.568), respectively) could be explained by the small size of the cohort.

AGXT was, above all, the most predominant disease-causing gene in the cohort we studied (P = 0.000). The median age of the first stone was five years. This finding is in line with retrospective analysis of stone composition indicating that PH1 is the main recessive monogenic origin of stone diseases in the pediatric patients [11,12].

In our patients, PH1 was objectified in 67% of cases followed by dRTA in 33% of cases. This distribution is in accordance with that described by the Cristal laboratory in France. In fact, PH1 was the main cause noted in 45% of pediatric cases followed by dRTA in 5% of cases [12].

PH1 is certainly underdiagnosed in Morocco because only four mutations have been studied among more than 178 identified during PH type 1 and the search for specific mutations of PH type 2 and type 3 is not in current practice yet [14,22]. PH1 is the most devastating of the familial forms of lithiasis and represents a frequent cause of CKD and dialysis [23]. At the time of its diagnosis, all the patients already had renal impairment.

There is a geographic and ethnic specificity of the mutations which are decisive in the severity of the disease. c.508G>A/p.G170R is most common in Europe and North America while c.731T>C/p.I244T is most common in the Maghreb region [24]. The only mutation of the AGXT gene identified in our patients was c.731T>C/p.I244T, and this mutation was reported as the most frequent in previous Moroccan, Tunisian and Libyan series [14,25-27].

Vitamin B6 (Pyridoxine*) prescribed at a dose of 5-10 mg/kg/day can reduce oxaluria from 300 to 600 mg/day by up to 30% in 30% of patients by diverting the metabolism of oxalate toward the more soluble glycocolle [28]. Patients carrying the c.508G>A/p.G170R or c.454T>A/p.F152I mutation are good responders [29]. It is imperative to test this treatment in any patient with PH1 because of the lack of a close correlation between genotype and phenotype. This treatment should be maintained even at the CKD stage [29]. None of these mutations mentioned above have been detected in our cohort.

Genetic disorders common in pediatric patients can be linked to primary or inherited forms of dRTA [30-33]. Mutations in transport/channels genes, expressed in both the kidney and the inner ear, such as ATP6V1B1 and ATP6V0A4, can cause progressive sensorineural hearing loss in children as a result of dRTA [17,34-37]. Additionally, significant functional impairment in urinary acidification and no responsiveness to acute acid load are seen in children presenting recessive dRTA with nonsense mutations in the ATP6V1B1 gene. Indeed, in this study, we identified two cases of dRTA with an early onset of deafness due to a mutation in this gene.

It is, therefore, worthwhile to determine the monogenic origins of NL and/or NC very early. This will have important prognostic implications and will allow the adoption of the best therapeutic strategy. This includes suggesting practical implications such as initiating audiometry for ATP6V1B1 patients and predicting responsiveness to a vitamin B6 (pyridoxine) treatment since patients carrying the c.508G>A/p.G170R or c.454T>A/p.F152I mutation are known to be good responders [29]. Individuals with PH1 caused by mutations in the AGXT gene represent an excellent example of individualized therapy based on molecular genetic diagnosis. Indeed, it has been shown that sensitivity to pyridoxine by these patients is linked to the presence of a distinctive allele (G170R) [38]. We believe that by including a genetic diagnosis in the repertory of clinical tests we may avoid invasive and potentially harmful procedures such as the liver biopsy prescribed for patients with suspected primary hyperoxaluria type 1. Therefore, genetic screening can be valuable if there is an atypical clinical presentation or if the standard diagnosis is hampered by the progression to a CKD.

Extremely rare diseases can be fairly appreciated if more genetic screenings are accomplished. We plan in future studies to consider whole-exome sequencing as a more effective approach to determine the molecular genetic basis of NL and/or NC.

Conclusions

This study highlighted mutations in at least two genes, namely the AGXT and ATP6V1B1, among the 30 genes known to be linked to monogenic forms of NL and/or NC. The mutation rate in our cohort was 13.6%. We emphasize the importance of prescribing specific genetic tests in the clinical practice of pediatric patients with NL and/or NC. A genetic screening if implemented would improve considerably the current approach to both prophylaxis and treatment and could lead to efficient personalized treatments. Genetic counseling and/or mutation analysis for the patient's healthy relatives at risk is recommended in people with NL and/or NC. Finally, the information provided by mutation analysis will not only allow early detection of such pathologies by clinicians but also the follow-up of disease development and the introduction of preventive treatments when possible.