| Literature DB >> 35497369 |
Lingqin Wang1,2, Mengya Jia1,2, Zhaoqin Li3, Xiaohua Liu1,2, Tianyi Sun1,2,4, Jinfeng Pei1,2, Cheng Wei1,2, Zhiyu Lin1,2,4, Haixing Li1,2.
Abstract
Genome walking is a method used to retrieve unknown flanking DNA. Here, we reported wristwatch (WW) PCR, an efficient genome walking technique mediated by WW primers (WWPs). WWPs feature 5'- and 3'-overlap and a heterologous interval. Therefore, a wristwatch-like structure can be formed between WWPs under relatively low temperatures. Each WW-PCR set is composed of three nested (primary, secondary, and tertiary) PCRs individually performed by three WWPs. The WWP is arbitrarily annealed somewhere on the genome in the one low-stringency cycle of the primary PCR, or directionally to the previous WWP site in one reduced-stringency cycle of the secondary/tertiary PCR, producing a pool of single-stranded DNAs (ssDNAs). A target ssDNA incorporates a gene-specific primer (GSP) complementary at the 3'-end and the WWP at the 5'-end and thus can be exponentially amplified in the next high-stringency cycles. Nevertheless, a non-target ssDNA cannot be amplified as it lacks a perfect binding site for any primers. The practicability of the WW-PCR was validated by successfully accessing unknown regions flanking Lactobacillus brevis CD0817 glutamate decarboxylase gene and the hygromycin gene of rice. The WW-PCR is an attractive alternative to the existing genome walking techniques.Entities:
Keywords: genome walking; partially annealing; wristwatch PCR; wristwatch primer; wristwatch-like DNA
Year: 2022 PMID: 35497369 PMCID: PMC9039356 DOI: 10.3389/fbioe.2022.792848
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
Primers used in this study.
| Primer | Oligo sequence |
|---|---|
| WWP1 | CGTCTCCAGTCT |
| WWP2 | CGTCTCCAGTCT |
| WWP3 | CGTCTCCAGTCT |
|
| TCCATACCCTCATCTCCATTTCCAT |
|
| AACTATCACCCCACAACGTCATCTC |
|
| ACCGTTCATAGGCGAAATTGTTTGT |
|
| CGGCAATTTCGATGATGCAGCTTGG |
|
| CGGGACTGTCGGGCGTACACAAATC |
|
| GACCGATGGCTGTGTAGAAGTACTC |
Note: The WWPs possess identical 5′- (12 nt) and 3′-end parts (3 nt)and a heterologous spacer (10 nt) (underlined). WWP: wristwatch primer.
Pairing of the WWP permutation with the GSP set in nested PCRs.
| Round of PCR | WWP permutation | GSP primer set | ||
|---|---|---|---|---|
| Primary | WWP1 | WWP2 | WWP3 | GSP1 |
| Secondary | WWP2 | WWP3 | WWP1 | GSP2 |
| Tertiary | WWP3 | WWP1 | WWP2 | GSP3 |
Note: The three WWPs are respectively paired with the GSP, in the same row to perform three parallel WW-PCRs. A WWP permutation is shown in the same column.
FIGURE 1Overview of the wristwatch PCR. GSP1, GSP2, and GSP3: gene-specific primers for primary, secondary, and tertiary PCRs, respectively; WWP1, WWP2, and WWP3: wristwatch primers for primary, secondary, and tertiary PCRs, respectively; thin solid line: known sequence; thin dotted line: unknown sequence; colorful thick line: primer complement; HSC, high-stringency cycle; LSC, low-stringency cycle; and RSC, reduced-stringency cycle. Only the WWP permutation WWP1-WWP2-WWP3 is presented here to illustrate the wristwatch PCR. The sequence of any WWP is random. However, WWPs can anneal to each other’s complements in the RSC attributed to the partial overlap (as shown in Table 1), thus generating a wristwatch-like structure.
Thermal cycling parameters of the WW-PCR.
| Round of PCR | Stage | Thermal condition | Cycle number |
|---|---|---|---|
| Primary | 94°C, 3 min | ||
| 1 | 94°C 30 s, 65°C 30 s, and 72°C 2 min | 5 | |
| 2 | 94°C 30 s, 25°C 30 s, and 72°C 2 min | 1 | |
| 3 | 94°C 30 s, 65°C 30 s, and 72°C 2 min | 25 | |
| 72°C 3 min | |||
| 1 μL of the primary product is directly used as the template for the secondary PCR | |||
| Secondary | 94°C, 3 min | ||
| 1 | 94°C 30 s, 65°C 30 s, and 72°C 2 min | 5 | |
| 2 | 94°C 30 s, 40°C 30 s, and 72°C 2 min | 1 | |
| 3 | 94°C 30 s, 65°C 30 s, and 72°C 2 min | 25 | |
| 72°C 3 min | |||
| 1 μL of the secondary product is directly used as the template for the tertiary PCR | |||
| Tertiary | Thermal cycling profile of the tertiary PCR is identical to that of the secondary PCR | ||
FIGURE 2Genome walking for gadA of L. brevis CD0817 (A) and hyg of rice (B). I, II, and III represent three sets of WW-PCRs in a walking, individually participated by the three WWP permutations, as indicated in Table 2; lanes P, S, and T represent primary, secondary, and tertiary PCRs, respectively; bands GS1-GS14 and GT1-GT13 indicate secondary and tertiary PCR products for gadA, respectively; and HS1-HS4 and HT1-HT4 indicate secondary and tertiary PCR products for hyg, respectively. The band numbers correspond to those in Supplementary Figure S1. M: DL 5000 DNA Marker (5000, 3000, 2000, 1500, 1000, 750, 500, 250, and 100 bp).
Comparison of different PCR-based genome walking methods.
| Method | Principle | ESMFS | ESMFE | References |
|---|---|---|---|---|
| Inverse PCR | DNA is digested and then self-cyclized. The cyclized DNA is subjected to the PCR driven by two GSPs facing in opposite directions. | No | No |
|
| CL-PCR | DNA is digested and then ligated to a synthetic oligo. The ligated DNA undergoes two-three rounds of nested PCRs performed by the oligo primer sequentially pairing with nested GSPs. | No | No |
|
| TAIL-PCR | A short degenerate primer with low Tm is used as the walking primer. The one LSC is included in every three cycles to facilitate walking primer annealing. A target product is preferentially enriched due to its higher amplification efficiency than a non-target one. | Yes | Yes |
|
| POP-PCR | A set of POPs with 3′-overlap are paired with nested GSPs. POP partially anneal to the DNA template in the one LSC/RSC of each PCR, producing a pool of ssDNAs. The target ssDNA is converted into dsDNA by the GSP in the next HSC, while the non-target one cannot be converted into dsDNA. | Yes | Yes |
|
| WW-PCR | The principle is presented in the section “Overview of WW-PCR” of this study. | Yes | Yes | This study |
Note: GSP, gene-specific primer; CL-PCR, cleavage-ligation-mediated PCR; TAIL-PCR, thermal asymmetric interlaced PCR; POP-PCR, partially overlapping primer-based PCR; WW-PCR, wristwatch PCR; ESMFS, extra safeguard mechanism for success; ESMFE, extra safeguard mechanism for efficiency; LSC, low-stringency cycle; RSC, reduced-stringency cycle; HSC, high-stringency cycle.