Literature DB >> 35486424

Epistatic selection on a selfish Segregation Distorter supergene - drive, recombination, and genetic load.

Beatriz Navarro-Dominguez1, Ching-Ho Chang1, Cara L Brand1, Christina A Muirhead1,2, Daven C Presgraves1, Amanda M Larracuente1.   

Abstract

Meiotic drive supergenes are complexes of alleles at linked loci that together subvert Mendelian segregation resulting in preferential transmission. In males, the most common mechanism of drive involves the disruption of sperm bearing one of a pair of alternative alleles. While at least two loci are important for male drive-the driver and the target-linked modifiers can enhance drive, creating selection pressure to suppress recombination. In this work, we investigate the evolution and genomic consequences of an autosomal, multilocus, male meiotic drive system, Segregation Distorter (SD) in the fruit fly, Drosophila melanogaster. In African populations, the predominant SD chromosome variant, SD-Mal, is characterized by two overlapping, paracentric inversions on chromosome arm 2R and nearly perfect (~100%) transmission. We study the SD-Mal system in detail, exploring its components, chromosomal structure, and evolutionary history. Our findings reveal a recent chromosome-scale selective sweep mediated by strong epistatic selection for haplotypes carrying Sd, the main driving allele, and one or more factors within the double inversion. While most SD-Mal chromosomes are homozygous lethal, SD-Mal haplotypes can recombine with other, complementing haplotypes via crossing over, and with wildtype chromosomes via gene conversion. SD-Mal chromosomes have nevertheless accumulated lethal mutations, excess non-synonymous mutations, and excess transposable element insertions. Therefore, SD-Mal haplotypes evolve as a small, semi-isolated subpopulation with a history of strong selection. These results may explain the evolutionary turnover of SD haplotypes in different populations around the world and have implications for supergene evolution broadly.
© 2022, Navarro-Dominguez et al.

Entities:  

Keywords:  D. melanogaster; chromosomal inversions; epistatic selection; evolutionary biology; genetics; genomics; meiotic drive; population genomics; supergene

Mesh:

Substances:

Year:  2022        PMID: 35486424      PMCID: PMC9122502          DOI: 10.7554/eLife.78981

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.713


Introduction

Supergenes are clusters of linked loci that control variation in complex phenotypes. Some supergenes mediate adaptive polymorphisms that are maintained by some form of frequency- or density-dependent natural selection, as in, for example, mimicry in butterflies, self-incompatibility in plants, plumage polymorphisms in birds, and heteromorphic sex chromosomes (see Schwander et al., 2014; Thompson and Jiggins, 2014, for review). Other supergenes are maintained by selfish social behaviors that enhance the fitness of carriers at the expense of non-carriers, as in some ant species (Keller and Ross, 1998; Wang et al., 2013). Still other supergenes are maintained by their ability to achieve selfish, better-than-Mendelian transmission during gametogenesis, as in the so-called meiotic drive complexes found in fungi, insects, and mammals (Lyon, 2003; Larracuente and Presgraves, 2012; Lindholm et al., 2016; Svedberg et al., 2018; Fuller et al., 2020). Meiotic drive complexes gain transmission advantages at the expense of other loci and their hosts. In heterozygous carriers of male drive complexes in animals, the driver disables spermatids that bear drive-sensitive target alleles (Larracuente and Presgraves, 2012; Lindholm et al., 2016). To spread in the population, the driver must be linked in a cis-arrangement to a drive-resistant (insensitive) target allele (Charlesworth and Hartl, 1978). Recombination between the driver and target can result in a ‘suicide’ haplotype that distorts against itself (Sandler and Carpenter, 1972; Hartl, 1974). These epistatic interactions between driver and target lead to selection for modifiers of recombination that tighten linkage, such as chromosomal inversions (Charlesworth and Hartl, 1978; Schwander et al., 2014; Thompson and Jiggins, 2014; Charlesworth, 2016). Like most supergenes (Charlesworth and Charlesworth, 1975; Turner, 1977), meiotic drive complexes originate from two or more loci with some degree of initial linkage. Successful drivers thus tend to be located in regions of low recombination, such as non-recombining sex chromosomes (Hamilton, 1967; Hurst and Pomiankowski, 1991), centromeric regions, or in chromosomal inversions of autosomes (Lyon, 2003; Larracuente and Presgraves, 2012; Lindholm et al., 2016; Svedberg et al., 2018). The short-term benefits of reduced recombination can entail long-term costs. Chromosomal inversions that lock supergene loci together can also incidentally capture linked loci, which causes large chromosomal regions to segregate as blocks. Due to reduced recombination, the efficacy of natural selection in these regions is compromised: deleterious mutations can accumulate, and beneficial ones are more readily lost (Muller, 1964; Hill and Robertson, 1968; Felsenstein, 1974; Charlesworth et al., 2009). Many meiotic drive complexes are thus homozygous lethal or sterile. The degeneration of drive haplotypes is not inevitable, however. Different drive haplotypes that complement one another may be able to recombine, if only among themselves (Dod et al., 2003; Presgraves et al., 2009; Brand et al., 2015). Gene conversion from wildtype chromosomes may also ameliorate the genetic load of supergenes (Uyenoyama, 2005; Wang et al., 2013; Tuttle et al., 2016; Branco et al., 2018; Stolle et al., 2019; Brelsford et al., 2020). Male meiotic drive complexes thus represent a class of selfish supergenes that evolve and persist via the interaction of drive, recombination, and natural selection. Here, we focus on the evolutionary genetics of Segregation Distorter (SD), a well-known autosomal meiotic drive complex in Drosophila melanogaster (Sandler et al., 1959). In heterozygous males, SD disables sperm bearing drive-sensitive wildtype chromosomes via a chromatin condensation defect (Hartl et al., 1967; Temin et al., 1991). SD has two main components: the driver, Segregation Distorter (Sd), is a truncated duplication of the gene RanGAP located in chromosome arm 2L (Powers and Ganetzky, 1991; Merrill et al., 1999; Kusano et al., 2001); and the target of drive, Responder (Rsp), is a block of satellite DNA in the pericentromeric heterochromatin of 2R. Previous studies of SD chromosomes have detected linked upward modifiers of drive, including Enhancer of SD (E[SD]) on 2L and several others on 2R (Sandler and Hiraizumi, 1960; Miklos, 1972; Ganetzky, 1977; Hiraizumi et al., 1980; Brittnacher and Ganetzky, 1984), but their molecular identities are unknown. Sd-RanGAP and Rsp straddle the centromere, a region of reduced recombination, and some SD chromosomes bear pericentric inversions that presumably further tighten linkage among these loci. In heterozygotes with a pericentric inversion, recombination in the inverted region generates aneuploids and therefore reduced fertility, although this effect might be mitigated by strong suppression of recombination (Coyne et al., 1993). Many SD chromosomes also bear paracentric inversions on 2R (reviewed in Lyttle, 1991; Larracuente and Presgraves, 2012). Although recombination between paracentric inversions and the main components of SD is possible, their strong association implies a role for epistatic selection in the evolution of these supergenes (Larracuente and Presgraves, 2012). While SD is present at low population frequencies (<5%) around the world (Temin et al., 1991; Larracuente and Presgraves, 2012), Sd-RanGAP appears to have originated in sub-Saharan Africa, the ancestral geographic range of D. melanogaster, survived the out-of-Africa bottleneck, and spread to the rest of the world (Presgraves et al., 2009; Brand et al., 2015). Multiple factors likely contribute to the low frequency of SD in populations: negative selection, insensitive Rsp alleles, and unlinked suppressors (reviewed in Larracuente and Presgraves, 2012). Two independent longitudinal studies suggest that SD haplotypes can replace each other in populations over short time scales (<30 years) (Temin and Kreber, 1981; Brand et al., 2015) without major changes in the overall population frequency of SD (Temin and Kreber, 1981). The predominant SD variant in Africa is SD-Mal, which recently swept across the entire continent (Presgraves et al., 2009; Brand et al., 2015). SD-Mal has a pair of rare, African-endemic, overlapping paracentric inversions spanning ~40% of 2R:In(2R)51B6–11;55E3–12 and In(2R)44F3–12;54E3–10, hereafter collectively referred to as In(2R)Mal (Aulard et al., 2002; Presgraves et al., 2009). SD-Mal chromosomes are particularly strong drivers, with ~100% transmission. Notably, recombinant chromosomes bearing the Sd-RanGAP duplication from this haplotype but lacking the inversions do not drive (Presgraves et al., 2009), suggesting that In(2R)Mal is essential for SD-Mal drive. We therefore expect strong epistatic selection to enforce the association of Sd-RanGAP and In(2R)Mal. The functional role of In(2R)Mal for drive is still unclear: do these inversions function to suppress recombination between Sd-RanGAP and a major distal enhancer on 2R, or do they contain a major enhancer? Here, we combine genetic and population genomic approaches to study SD-Mal haplotypes sampled from a single population in Zambia, the putative ancestral range of D. melanogaster (Pool et al., 2012). We address four issues. First, we reveal the structural features of the SD-Mal haplotype, including the organization of the insensitive Rsp allele and the In(2R)Mal rearrangements. Second, we characterize the genetic function of In(2R)Mal and its role in drive. Third, we infer the population genetic history of the rapid rise in frequency of SD-Mal in Zambia. And fourth, we explore the evolutionary consequences of reduced recombination on SD-Mal haplotypes. Our results show that SD-Mal experienced a recent chromosome-scale selective sweep mediated by epistatic selection and has, as a consequence of its reduced population recombination rate, accumulated excess non-synonymous mutations and transposable element (TE) insertions. The SD-Mal haplotype is a supergene that evolves as a small, semi-isolated subpopulation in which complementing SD-Mal chromosomes can recombine inter se via crossing over and with wildtype chromosomes via gene conversion. These results have implications for supergene evolution and may explain the enigmatic evolutionary turnover of SD haplotypes in different populations around the world.

Results and discussion

To investigate the evolutionary genomics of SD-Mal, we sequenced haploid embryos from nine driving SD-Mal haplotypes sampled from a single population in Zambia (Brand et al., 2015), the putative ancestral range of D. melanogaster (Pool et al., 2012). Illumina read depth among samples ranged between ~46 and 67× (Supplementary file 1; BioProject PRJNA649752 in NCBI). Additionally, we obtained ~12× coverage with long-read Nanopore sequencing of one homozygous viable line, SD-ZI125, to create a de novo assembly of a representative SD-Mal haplotype (BioProject PRJNA649752 in NCBI; assembly in Navarro-Dominguez et al., 2022a). We use these data to study the evolution of SD-Mal structure, diversity, and recombination.

Chromosomal features of the SD-Mal supergene

The SD-Mal haplotype has at least three key features: the main drive locus, the Sd-RanGAP duplication on 2L; an insensitive Responder (Rsp) in 2R heterochromatin; and the paracentric In(2R)Mal arrangement on chromosome 2R (Figure 1). We used our long-read and short-read sequence data for SD-ZI125 to confirm the structure of the duplication (Figure 1A) and then validated features in the other SD-Mal haplotypes. All SD-Mal chromosomes have the Sd-RanGAP duplication at the same location as the parent gene on chromosome 2L (see also Brand et al., 2015). The Rsp locus, the target of SD, corresponds to a block of ~120 bp satellite repeats in 2R heterochromatin (Figure 1B; Wu et al., 1988). The reference genome, Iso-1, has a Rsp allele corresponding to a primary Rsp locus containing two blocks of tandem Rsp repeats—Rsp-proximal and Rsp-major—with ~1000 copies of the Rsp satellite repeat interrupted by TEs (Khost et al., 2017). A small number of Rsp repeats exist outside of the primary Rsp locus, although they are not known to be targeted by SD. There are three of these additional Rsp loci in Iso-1: ~ 10 copies in 2R, distal to the major Rsp locus (Rsp-minor); a single copy at the distal end of 2R (60A); and ~12 copies in 3L (Houtchens and Lyttle, 2003; Larracuente, 2014; Khost et al., 2017). The genomes of SD flies carry ~20 copies of Rsp (Wu et al., 1988; Pimpinelli and Dimitri, 1989), but the organization of the primary Rsp locus on SD chromosomes is unknown. To characterize the Rsp locus of the SD-Mal haplotype, we mapped SD-Mal reads to an Iso-1 reference genome (see Khost et al., 2017). As expected, reads from Iso-1 reference are distributed across the whole Rsp-major region. For SD-Mal chromosomes, however, very few reads map to the Rsp repeats at the Rsp-major (Figure 1B). This suggests that all SD-Mal have a complete deletion of the primary Rsp locus containing Rsp-proximal and Rsp-major and that the only Rsp copies in the SD-Mal genomes are the minor Rsp loci in chromosomes 2R and 3L (Figure 1—figure supplement 1).
Figure 1.

Map depicting the chromosomal features of the SD-Mal chromosome.

The schematic shows the cytogenetic map of chromosomes 2L and 2R (redrawn based on images in Lefevre, 1976) and the major features of the chromosome. (A) Dotplot showing that the Sd locus is a partial duplication of the gene RanGAP (in black), located at band 37D2-6. The gene Hs2st occurs in the first intron of RanGAP, and it is also duplicated in the Sd locus (Hs2st-2). (B) The Rsp-major locus is an array of tandem repeats located in the pericentric heterochromatin (band h39). Read mapping to a reference genome containing 2R pericentric heterochromatin (Iso1 strain, see Chang and Larracuente, 2019) shows that SD-Mal chromosomes do not have any Rsp repeats in the Rsp-major locus, consistent with being insensitive to distortion by Sd (Rsp) (orange, high relative coverage regions correspond to transposable element interspersed), in contrast with Iso-1, which is sensitive (Rsp). The tracks below indicate the presence of types of repetitive elements found at this locus. Black lines indicate the presence of a repeat type in the reference genome. Gray shading shows where Rsp repeats are in the reference genome. (C) Two paracentric, overlapping inversions constitute the In(2R)Mal arrangement shown on the schematic of polytene chromosomes: In(2R)51BC;55E (In(2R)Mal-p) in orange brackets and In(2R)44F;54E (In(2R)Mal-d) in red parentheses. Pericentromeric heterochromatin and the centromere are represented by a gray rectangle and black circle, respectively. (D) Our assembly based on long-read sequencing data provide the exact breakpoints of In(2R)Mal and confirms that the distal inversion (Dmel.r6, 2R:14,591,034–18,774,475) occurred first, and the proximal inversion (Dmel.r6, 2R:8,855,601–15,616,195) followed, overlapping ~1 Mb with the distal inversion. The colored rectangles correspond to locally collinear blocks of sequence with the height of lines within the block corresponding to average sequence conservation in the aligned region (Darling et al., 2010). Blocks below the center black line indicate regions that align in the reverse complement orientation. Vertical red lines indicate the end of the assembled chromosomes. Visible marker locations used for generating recombinants (b (34D1), c (52D1), and px (58E4-58E8)) are indicated on the cytogenetic map (Lefevre, 1976).

For each locus annotated in the reference Drosophila melanogaster genome (Khost et al., 2017), we plot estimated Rsp abundance as the sum of average depth of repeats at each locus normalized by average depth of chromosome 2 on the y-axis. SD-Mal has very few reads mapping to the primary Rsp locus (Rsp-proximal and Rsp-major), suggesting a complete deletion of the target of drive.

(A) Schematics of uninverted chromosome arm 2R showing the location of the five synteny blocks defined by Mauve (Darling et al., 2010; Figure 1D). (B) Possible rearrangements between blocks that can generate a double, overlapping, paracentric inversion. (B1) Distal inversion first, then proximal inversion. (B2) Proximal inversion first, then distal. (B3) Whole region first, then distal. (B4) Whole region first, then proximal. Note that B1 (distal inversion first, then proximal), is the only scenario that matches what we observe in our SD-Mal chromosome assembly (Figure 1D).

(a) Wildtype arrangement of chromosome 2R. Pericentromeric heterochromatin and the centromere are represented by a gray rectangle and black circle, respectively. (b) In(2R)Mal-d: inversion of 4.18 Mb of 2R (2R:14,591,003–18,774,475), which disrupted the 3’ UTR of the Mctp gene (2R:18,761,758–18,774,824). (c) In(2R)Mal-p: Inversion of 6.76 Mb of 2R (2R:8,855,602–17,749,310), with 1.02 Mb overlapping with the now proximal segment of In(2R)Mal-d. This inversion disrupted the 3’ UTR of the sns gene (2R:8,798,489–8,856,091) and the CDS of the CG10931 gene (2R:17,748,935–17,750,136).

(A) We crossed 8–10 b c px/b c px virgin females to 3–5 SD-ZI125 males, recovered SD-ZI125/b c px virgins, then backcrossed 8–10 of them to 3–5 b c px homozygous males. (B) We recovered three types of recombinant chromosomes from SD-ZI125/b c px x b c px/b c px crosses, attending to visible markers: b + +; + c px; and + + px, and crossed them back to virgin b c px females to measure the strength of segregation distortion reported on Table 2. We genotype the presence of the Sd locus duplication in the recombinants by PCR.

Figure 1—figure supplement 1.

Estimated abundance of Rsp repeats at each Rsp locus in the reference Iso-1 genome and SD-Mal.

For each locus annotated in the reference Drosophila melanogaster genome (Khost et al., 2017), we plot estimated Rsp abundance as the sum of average depth of repeats at each locus normalized by average depth of chromosome 2 on the y-axis. SD-Mal has very few reads mapping to the primary Rsp locus (Rsp-proximal and Rsp-major), suggesting a complete deletion of the target of drive.

Map depicting the chromosomal features of the SD-Mal chromosome.

The schematic shows the cytogenetic map of chromosomes 2L and 2R (redrawn based on images in Lefevre, 1976) and the major features of the chromosome. (A) Dotplot showing that the Sd locus is a partial duplication of the gene RanGAP (in black), located at band 37D2-6. The gene Hs2st occurs in the first intron of RanGAP, and it is also duplicated in the Sd locus (Hs2st-2). (B) The Rsp-major locus is an array of tandem repeats located in the pericentric heterochromatin (band h39). Read mapping to a reference genome containing 2R pericentric heterochromatin (Iso1 strain, see Chang and Larracuente, 2019) shows that SD-Mal chromosomes do not have any Rsp repeats in the Rsp-major locus, consistent with being insensitive to distortion by Sd (Rsp) (orange, high relative coverage regions correspond to transposable element interspersed), in contrast with Iso-1, which is sensitive (Rsp). The tracks below indicate the presence of types of repetitive elements found at this locus. Black lines indicate the presence of a repeat type in the reference genome. Gray shading shows where Rsp repeats are in the reference genome. (C) Two paracentric, overlapping inversions constitute the In(2R)Mal arrangement shown on the schematic of polytene chromosomes: In(2R)51BC;55E (In(2R)Mal-p) in orange brackets and In(2R)44F;54E (In(2R)Mal-d) in red parentheses. Pericentromeric heterochromatin and the centromere are represented by a gray rectangle and black circle, respectively. (D) Our assembly based on long-read sequencing data provide the exact breakpoints of In(2R)Mal and confirms that the distal inversion (Dmel.r6, 2R:14,591,034–18,774,475) occurred first, and the proximal inversion (Dmel.r6, 2R:8,855,601–15,616,195) followed, overlapping ~1 Mb with the distal inversion. The colored rectangles correspond to locally collinear blocks of sequence with the height of lines within the block corresponding to average sequence conservation in the aligned region (Darling et al., 2010). Blocks below the center black line indicate regions that align in the reverse complement orientation. Vertical red lines indicate the end of the assembled chromosomes. Visible marker locations used for generating recombinants (b (34D1), c (52D1), and px (58E4-58E8)) are indicated on the cytogenetic map (Lefevre, 1976).

Estimated abundance of Rsp repeats at each Rsp locus in the reference Iso-1 genome and SD-Mal.

For each locus annotated in the reference Drosophila melanogaster genome (Khost et al., 2017), we plot estimated Rsp abundance as the sum of average depth of repeats at each locus normalized by average depth of chromosome 2 on the y-axis. SD-Mal has very few reads mapping to the primary Rsp locus (Rsp-proximal and Rsp-major), suggesting a complete deletion of the target of drive.

Possible rearrangements of synteny blocks to generate a double inversion.

(A) Schematics of uninverted chromosome arm 2R showing the location of the five synteny blocks defined by Mauve (Darling et al., 2010; Figure 1D). (B) Possible rearrangements between blocks that can generate a double, overlapping, paracentric inversion. (B1) Distal inversion first, then proximal inversion. (B2) Proximal inversion first, then distal. (B3) Whole region first, then distal. (B4) Whole region first, then proximal. Note that B1 (distal inversion first, then proximal), is the only scenario that matches what we observe in our SD-Mal chromosome assembly (Figure 1D).

Model of the In(2R)Mal rearrangement.

(a) Wildtype arrangement of chromosome 2R. Pericentromeric heterochromatin and the centromere are represented by a gray rectangle and black circle, respectively. (b) In(2R)Mal-d: inversion of 4.18 Mb of 2R (2R:14,591,003–18,774,475), which disrupted the 3’ UTR of the Mctp gene (2R:18,761,758–18,774,824). (c) In(2R)Mal-p: Inversion of 6.76 Mb of 2R (2R:8,855,602–17,749,310), with 1.02 Mb overlapping with the now proximal segment of In(2R)Mal-d. This inversion disrupted the 3’ UTR of the sns gene (2R:8,798,489–8,856,091) and the CDS of the CG10931 gene (2R:17,748,935–17,750,136).

Crossing scheme to generate recombinants along SD-Mal.

(A) We crossed 8–10 b c px/b c px virgin females to 3–5 SD-ZI125 males, recovered SD-ZI125/b c px virgins, then backcrossed 8–10 of them to 3–5 b c px homozygous males. (B) We recovered three types of recombinant chromosomes from SD-ZI125/b c px x b c px/b c px crosses, attending to visible markers: b + +; + c px; and + + px, and crossed them back to virgin b c px females to measure the strength of segregation distortion reported on Table 2. We genotype the presence of the Sd locus duplication in the recombinants by PCR.
Table 2.

Strength of segregation distortion in recombinants of SD-ZI125.

GenotypeMarkers N n ±SE k ±SE k* ±SEp-value (k* = 0.5)
1 Sd In(2R)Mal + + + and b + + 11290.36.030.990.000.980.00<0.0001
2 Sd In(2R)Mal + + px 71118.89.480.970.010.960.01<0.0001
3 Sd In(2R)Mal+ + c px 19147.614.390.540.010.510.010.3082
4 Sd+ In(2R)Mal b + + 24124.810.310.680.020.550.030.0572
5 Sd+ In(2R)Mal+ + c px 65120.48.320.530.010.510.010.3586

Chromosome 2 markers are black (b), curved (c), and plexus (px). N, number of crosses; n, average number of progeny from the crosses; SE, standard error; k, average proportion of progeny inheriting the recombinant SD chromosome from SD males; k*, average proportion of progeny inheriting the partial SD chromosome from SD/b c px males, corrected for viability. p-values reported by a single sample t-test with a null hypothesis of k* = 0.5, as expected for Mendelian segregation. b + + flies were PCR-genotyped for the presence (row 1) or absence (row 4) of Sd-RanGAP.

The complex In(2R)Mal inversion is distal to the Rsp locus on chromosome 2R (Figure 1C). We used our SD-ZI125 assembly to determine the precise breakpoints of these inversions. Relative to the standard D. melanogaster 2R scaffold (BDGP6), SD-ZI125 has three large, rearranged blocks of sequence corresponding to In(2R)Mal (Figure 1C): a 1.03 Mb block collinear with the reference but shifted proximally; a second inverted 5.74 Mb block; and a third inverted 3.16 Mb block. From this organization, we infer that the distal inversion, which we refer to as In(2R)Mal-d, occurred first and spanned 4.18 Mb (approx. 2R:14,591,003–18,774,475). The proximal inversion, which we refer to as In(2R)Mal-p, occurred second and spanned 6.76 Mb, with 1.02 Mb overlapping with the proximal region of In(2R)Mal-d (approx. 2R:8,855,602–17,749,310). Note that any rearrangement different than distal first, proximal second, leads to a different outcome (Figure 1—figure supplement 2). All four breakpoints of the In(2R)Mal rearrangement involve simple joins of unique sequence. Three of these four breakpoints span genes (Figure 1—figure supplement 3): sns (2R:8,798,489–8,856,091), CG10931 (2R:17,748,935–17,750,136), and Mctp (2R:18,761,758–18,774,824). The CDSs of both sns and Mctp remain intact in the In(2R)Mal arrangement, with the inversion disrupting their 3’ UTRs. Neither of these two genes is expressed in testes (https://flybase.org/reports/FBgn0024189; https://flybase.org/reports/FBgn0034389; Chintapalli et al., 2007; FB2021_06; Larkin et al., 2021), making it unlikely that they affect drive. In(2R)Mal-p disrupts the CDS of CG10931, which is a histone methyltransferase with high expression levels in testis (https://flybase.org/reports/FBgn0034274; Chintapalli et al., 2007; FB2021_06; Larkin et al., 2021). Even for genes that are not directly interrupted by the inversion breakpoints, the chromosomal rearrangements may disrupt the regulation of nearby genes if, for example, they affect the organization of topologically associating domains (TADs; reviewed in Spielmann et al., 2018). The In(2R)Mal inversion breakpoints disrupt physical domains reported in Hou et al., 2012, however inversion-mediated disruptions of TAD boundaries do not necessarily affect gene expression (Ghavi-Helm et al., 2019). Future work is required to determine if the inversions affect gene expression near the breakpoints and if CG10931 has a role in the SD-Mal drive phenotype.
Figure 1—figure supplement 2.

Possible rearrangements of synteny blocks to generate a double inversion.

(A) Schematics of uninverted chromosome arm 2R showing the location of the five synteny blocks defined by Mauve (Darling et al., 2010; Figure 1D). (B) Possible rearrangements between blocks that can generate a double, overlapping, paracentric inversion. (B1) Distal inversion first, then proximal inversion. (B2) Proximal inversion first, then distal. (B3) Whole region first, then distal. (B4) Whole region first, then proximal. Note that B1 (distal inversion first, then proximal), is the only scenario that matches what we observe in our SD-Mal chromosome assembly (Figure 1D).

Figure 1—figure supplement 3.

Model of the In(2R)Mal rearrangement.

(a) Wildtype arrangement of chromosome 2R. Pericentromeric heterochromatin and the centromere are represented by a gray rectangle and black circle, respectively. (b) In(2R)Mal-d: inversion of 4.18 Mb of 2R (2R:14,591,003–18,774,475), which disrupted the 3’ UTR of the Mctp gene (2R:18,761,758–18,774,824). (c) In(2R)Mal-p: Inversion of 6.76 Mb of 2R (2R:8,855,602–17,749,310), with 1.02 Mb overlapping with the now proximal segment of In(2R)Mal-d. This inversion disrupted the 3’ UTR of the sns gene (2R:8,798,489–8,856,091) and the CDS of the CG10931 gene (2R:17,748,935–17,750,136).

In African populations, chromosomes bearing Sd but lacking In(2R)Mal do not drive (Presgraves et al., 2009; Brand et al., 2015). The functional role of In(2R)Mal in drive is, however, unclear. As expected, In(2R)Mal suppresses recombination: in crosses between a multiply marked chromosome 2, b c px, and SD-Mal (Figure 1—figure supplement 4), we find that In(2R)Mal reduces the b–c genetic distance by 54.6% and the c–px genetic distance by 92.4%, compared with control crosses between b c px and Oregon-R (Table 1). Our crosses confirm that In(2R)Mal is indeed required for drive: if we generate recombinants along an SD-Mal chromosome, all recombinants with both Sd and In(2R)Mal show strong drive (Table 2, rows 1 and 2), whereas none of the recombinants that separate Sd and In(2R)Mal drive (Table 2, rows 3 and 4). We conclude that SD-Mal drive requires both Sd and In(2R)Mal, which implies that one or more essential enhancers, or co-drivers, is located within or distal to In(2R)Mal.
Figure 1—figure supplement 4.

Crossing scheme to generate recombinants along SD-Mal.

(A) We crossed 8–10 b c px/b c px virgin females to 3–5 SD-ZI125 males, recovered SD-ZI125/b c px virgins, then backcrossed 8–10 of them to 3–5 b c px homozygous males. (B) We recovered three types of recombinant chromosomes from SD-ZI125/b c px x b c px/b c px crosses, attending to visible markers: b + +; + c px; and + + px, and crossed them back to virgin b c px females to measure the strength of segregation distortion reported on Table 2. We genotype the presence of the Sd locus duplication in the recombinants by PCR.

Table 1.

Frequency of recombinants along SD-Mal chromosomes vs. wildtype (OreR) chromosomes.

Cross N n nR (b–c) nR (c–px) d (b–c) d (c–px)
OreR/b c px x b c px/b c px151,71641837226.6223.21
SD-Mal/b c px x b c px/b c px111,8202113211.811.76

N, number of crosses; n, total progeny scored; n, number of recombinants, d, genetic distance in cM, Kosambi-corrected.

N, number of crosses; n, total progeny scored; n, number of recombinants, d, genetic distance in cM, Kosambi-corrected. Chromosome 2 markers are black (b), curved (c), and plexus (px). N, number of crosses; n, average number of progeny from the crosses; SE, standard error; k, average proportion of progeny inheriting the recombinant SD chromosome from SD males; k*, average proportion of progeny inheriting the partial SD chromosome from SD/b c px males, corrected for viability. p-values reported by a single sample t-test with a null hypothesis of k* = 0.5, as expected for Mendelian segregation. b + + flies were PCR-genotyped for the presence (row 1) or absence (row 4) of Sd-RanGAP. The temporal order of inversions (first In(2R)Mal-d, then In(2R)Mal-p) suggests two possible scenarios. In(2R)Mal-d, occurring first, may have captured the essential enhancer, with the subsequent In(2R)Mal-p serving to further reduce recombination between Sd and the enhancer. Alternatively, an essential enhancer may be located distal to In(2R)Mal-d, and the role of both In(2R)Mal inversions is to reduce recombination with Sd. To distinguish these possibilities, we measured drive in b recombinants, which bear Sd and In(2R)Mal but have recombined between the distal breakpoint of In(2R)Mal (2R:18,774,475) and px (2R:22,494,297). All of these recombinants show strong drive (n = 71; Table 2, row 2). Assuming that recombination is uniformly distributed throughout the 3.72 Mb interval between the In(2R)Mal-d distal breakpoint and px, the probability of failing to separate an essential co-driver or distal enhancer among any of our 71 recombinants is <0.014. Furthermore, using molecular markers (see Materials and methods), we detected two recombinants within 100 kb of the distal breakpoint of In(2R)Mal, both with strong drive (k > 0.99; Supplementary file 2). We therefore infer that the co-driver resides inside or within 100 kb of the In(2R)Mal arrangement. More specifically, we speculate that the In(2R)Mal-d inversion both captured the co-driver and reduced recombination with Sd, whereas In(2R)Mal-p tightened linkage between centromere-proximal components of SD-Mal and In(2R)Mal-d. Despite the recruitment of these inversions, recombination occurs readily between Sd and the proximal break of In(2R)Mal (Table 2; Presgraves et al., 2009; Brand et al., 2015). Nevertheless, we observe long-range linkage disequilibrium between Sd and In(2R)Mal. Among 204 haploid genomes from Zambia (Lack et al., 2016; see Materials and methods), we identified 198 wildtype haplotypes (Sd+ In(2R)Mal+), 3 SD-Mal haplotypes (Sd In(2R)Mal), and 3 recombinant haplotypes (three Sd In(2R)Mal+, zero Sd+ In(2R)Mal). While Sd and In(2R)Mal each have individually low sample frequencies (0.0294 and 0.0147, respectively), they tend to co-occur on the same chromosome (r2 = 0.493; Fisher’s exact p = 1.4 × 10–5). We calculated the expected decay of linkage disequilibrium between Sd and In(2R)Mal in the absence of any natural selection (Hill and Robertson, 1968), assuming a conservative sex-averaged recombination frequency corresponding to a map distance between Sd and In(2R)Mal of ~2.5 cM (FlyBase; FB2021_06; Larkin et al., 2021) and an effective population size of 106. Under these assumptions, the observed estimated coefficient of linkage disequilibrium, D = 0.0143, has an expected half-life of just ~28 generations (2.8 years) and, decays to negligible levels (i.e., expected D and r2 both ~10–3) in <100 generations (<10 years). We therefore conclude that the SD-Mal supergene haplotype is maintained by strong epistatic selection.

Rapid increase in frequency of the SD-Mal supergene

We used population genomics to infer the evolutionary history and dynamics of SD-Mal chromosomes. We called SNPs in our Illumina reads from nine complete SD-Mal haplotypes from Zambia (see Materials and methods). For comparison, we also analyzed wildtype (SD) chromosomes from the same population in Zambia (Lack et al., 2016), including those with chromosome 2 inversions: 10 with the In(2L)t inversion and 10 with the In(2R)NS inversion (see Materials and methods). Table 3 shows that nucleotide diversity (π) is significantly lower on SD-Mal haplotypes compared to uninverted SD chromosome arms (Table 3; Figure 2A). The relative reduction in diversity on SD-Mal haplotypes is distributed heterogeneously: π is sharply reduced for a large region that spans ~25.8 Mb, representing 53% of chromosome 2 and extending from Sd-RanGAP on 2L (2L:19,441,959; Figure 2—figure supplement 1), across the centromere, and to ~2.9 Mb beyond the distal breakpoint of In(2R)Mal (2R:18,774,475; Table 3, rows 3, 5, and 6; Figure 2A). Thus, the region of reduced nucleotide diversity on SD-Mal chromosomes covers all the known essential loci for the drive phenotype: Sd-RanGAP, Rsp and In(2R)Mal.
Table 3.

Nucleotide diversity (π) on SD-Mal and SD chromosomes.

π ( ± st. dev.)p-value
Chr.Region SD+ SD-Mal SD+ × f SD-Mal vs. SD+ SD-Mal vs. SD+*f
1 2L Distal toSd-RanGAP1.03E-021.03E-021.52E-040.57270.00E + 00
(±3.01E-03)(±3.09E-03)(±4.43E-05)
2 2L Proximal toSd-RanGAP4.44E-039.39E-056.52E-055.84E-900.0027
(±2.75E-03)(±1.66E-04)(±4.04E-05)
3 2R In(2R)Mal 8.94E-037.97E-051.31E-040.00E + 001.42E-33
(±2.95E-03)(±1.18E-04)(±4.33E-05)
42L-2RSD-Mal supergene6.42E-037.98E-059.43E-050.00E + 002.60E-06
(±4.03E-03)(±1.32E-04)(±5.92E-05)

Average nucleotide diversity (π) per site and empirical standard deviation estimated in 10-kb windows along chromosome 2, for SD+, SD-Mal, and SD+ scaled by the estimated frequency of SD-Mal chromosomes (SD+× f, where f = 1.47%). Outside of the linked region (row 1), π. Inside of the linked region (rows 2–4), π < π; even after scaling π by the frequency of SD-Mal in the population, π. Due to non-independence of SNPs in non-recombining regions, we also estimated variance in π based on Charlesworth and Charlesworth, 2010; which is 5.30E-05 for In(2R)Mal and 6.27E-05 for the entire SD-Mal supergene. p-values reported by paired t-test between 10-kb windows.

Figure 2.

Diversity on SD-Mal chromosomes.

(A) Average pairwise nucleotide diversity per site (π) and (B) Tajima’s D estimates in non-overlapping 10-kb windows along chromosome 2 in Zambian SD-Mal chromosomes (n = 9, orange) and SD chromosomes from the same population, bearing the cosmopolitan inversions In(2L)t (n = 10, dark blue) and In(2R)NS (n = 10, light blue). Regions corresponding to pericentric heterochromatin are shaded in gray and the centromere location is marked with a black circle. SD-Mal chromosomes show a sharp decrease in nucleotide diversity and skewed frequency spectrum from the Sd locus (Sd-RanGAP, 2L:19.4 Mb) to ~2.9 Mb beyond the distal breakpoint of In(2R)Mal.

Average pairwise nucleotide diversity per site (π) in non-overlapping, 1-kb windows, for SD+ and SD-Mal chromosomes, around the Sd-RanGAP locus.

(A) Tajima’s D estimates in non-overlapping 10-kb windows along chromosome 2, in Zambian SD-Mal chromosomes (n = 9, orange) and SD chromosomes from the same population, bearing the cosmopolitan inversions In(2L)t (n = 10, dark blue) and In(2R)NS (n = 10, light blue). (B) To account for the differences in number of segregating sites between windows, we also estimated D/D, that is, the ratio of D to its theoretical minimum D, when all sites are singletons. Regions corresponding to pericentric heterochromatin are shaded in gray and the centromere location is marked with a black circle.

Figure 2—figure supplement 1.

Diversity at the Sd-RanGAP locus on SD-Mal chromosomes.

Average pairwise nucleotide diversity per site (π) in non-overlapping, 1-kb windows, for SD+ and SD-Mal chromosomes, around the Sd-RanGAP locus.

Average nucleotide diversity (π) per site and empirical standard deviation estimated in 10-kb windows along chromosome 2, for SD+, SD-Mal, and SD+ scaled by the estimated frequency of SD-Mal chromosomes (SD+× f, where f = 1.47%). Outside of the linked region (row 1), π. Inside of the linked region (rows 2–4), π < π; even after scaling π by the frequency of SD-Mal in the population, π. Due to non-independence of SNPs in non-recombining regions, we also estimated variance in π based on Charlesworth and Charlesworth, 2010; which is 5.30E-05 for In(2R)Mal and 6.27E-05 for the entire SD-Mal supergene. p-values reported by paired t-test between 10-kb windows.

Diversity on SD-Mal chromosomes.

(A) Average pairwise nucleotide diversity per site (π) and (B) Tajima’s D estimates in non-overlapping 10-kb windows along chromosome 2 in Zambian SD-Mal chromosomes (n = 9, orange) and SD chromosomes from the same population, bearing the cosmopolitan inversions In(2L)t (n = 10, dark blue) and In(2R)NS (n = 10, light blue). Regions corresponding to pericentric heterochromatin are shaded in gray and the centromere location is marked with a black circle. SD-Mal chromosomes show a sharp decrease in nucleotide diversity and skewed frequency spectrum from the Sd locus (Sd-RanGAP, 2L:19.4 Mb) to ~2.9 Mb beyond the distal breakpoint of In(2R)Mal.

Diversity at the Sd-RanGAP locus on SD-Mal chromosomes.

Average pairwise nucleotide diversity per site (π) in non-overlapping, 1-kb windows, for SD+ and SD-Mal chromosomes, around the Sd-RanGAP locus.

Tajima’s D estimates.

(A) Tajima’s D estimates in non-overlapping 10-kb windows along chromosome 2, in Zambian SD-Mal chromosomes (n = 9, orange) and SD chromosomes from the same population, bearing the cosmopolitan inversions In(2L)t (n = 10, dark blue) and In(2R)NS (n = 10, light blue). (B) To account for the differences in number of segregating sites between windows, we also estimated D/D, that is, the ratio of D to its theoretical minimum D, when all sites are singletons. Regions corresponding to pericentric heterochromatin are shaded in gray and the centromere location is marked with a black circle. The reduced nucleotide diversity among SD-Mal might be expected given its low frequency in natural populations (see below; Presgraves et al., 2009; Brand et al., 2015). SD persists at low frequencies in populations worldwide, presumably reflecting the balance between drive, negative selection, and genetic suppression and/or resistance (Hartl, 1975; Charlesworth and Hartl, 1978; Larracuente and Presgraves, 2012). If the SD-Mal supergene has been maintained at stable drive-selection-suppression equilibrium frequency for a long period of time, then its nucleotide diversity may reflect a mutation-drift equilibrium appropriate for its effective population size. Under this scenario, we expect diversity at the supergene to be similar to wildtype (SD) diversity scaled by the long-term equilibrium frequency of SD. We estimated SD-Mal frequency to be 1.47% by identifying the Sd duplication and In(2R)Mal breakpoints in 204 haploid genomes from Zambia (3/204, comparable to Presgraves et al., 2009; Brand et al., 2015; data from Lack et al., 2016; see Materials and methods). To approximate our expectation under mutation-drift equilibrium, we scaled average π from the SD sample by 1.47% in 10-kb windows across the region corresponding to the SD-Mal supergene, defined as the region from Sd-RanGAP to the distal breakpoint of In(2R)Mal. While nucleotide diversity outside of the SD-Mal supergene region is comparable to SD (Table 3, row 1), diversity in the supergene region is significantly lower than expected even when scaled by its frequency (Table 3, row 4), suggesting that the low population frequency of SD-Mal cannot fully explain its reduced diversity. This observation suggests two possibilities: the SD-Mal supergene historically had an equilibrium frequency less than 1.47% in Zambia; or the SD-Mal supergene, having reduced recombination, has experienced hitchhiking effects due to background selection and/or a recent selective sweep. To distinguish between these possibilities, we analyzed summaries of the site frequency spectrum. We find strongly negative Tajima’s D mirroring the distribution of reduced diversity, indicating an excess of rare alleles (Figure 2B). Such a skew in the site frequency spectrum suggests a recent increase in frequency of the SD-Mal supergene in Zambia. Given the low recombination frequency between SD-Mal and SD chromosomes, we treat them as two subpopulations and estimate their differentiation using Wright’s fixation index, F. The high differentiation of SD-Mal from SD chromosomes from the same population similarly suggests a large shift in allele frequencies. F in the SD-Mal supergene region is unusually high for chromosomes from the same population (Figure 3A). Neither of the SD chromosomes with cosmopolitan inversions show such high differentiation, and mean nucleotide differences (d) between SD-Mal and SD are comparable to the other inversions, implying that the differentiation of the SD-Mal supergene is recent. Our results—low diversity, strongly negative Tajima’s D, high F and relatively low d—are thus consistent with a rapid increase in frequency of the SD-Mal haplotype that reduced nucleotide diversity within SD-Mal and generated large differences in allele frequencies with SD+ chromosomes (e.g., Charlesworth, 1998; Cruickshank and Hahn, 2014).
Figure 3.

Differentiation between SD-Mal and wildtype chromosomes.

(A) Pairwise F and (B) d per base pair in non-overlapping 10-kb windows along chromosome 2, between Zambian SD-Mal haplotypes (n = 9) and wildtype chromosomes from the same population, bearing the cosmopolitan inversions In(2L)t (n = 10) and In(2R)NS (n = 10). Regions corresponding to pericentric heterochromatin are shaded in gray and the centromere location is marked with a black circle.

Differentiation between SD-Mal and wildtype chromosomes.

(A) Pairwise F and (B) d per base pair in non-overlapping 10-kb windows along chromosome 2, between Zambian SD-Mal haplotypes (n = 9) and wildtype chromosomes from the same population, bearing the cosmopolitan inversions In(2L)t (n = 10) and In(2R)NS (n = 10). Regions corresponding to pericentric heterochromatin are shaded in gray and the centromere location is marked with a black circle. To estimate the timing of the recent expansion of the SD-Mal supergene, we used an approximate Bayesian computation (ABC) method with rejection sampling in neutral coalescent simulations. We do not know if SD chromosomes acquired In(2R)Mal in Zambia or if the inversions occurred de novo on an SD background. For our simulations, we assume that the acquisition of the second inversion (or the double inversion by crossover) was a unique event that enhanced drive strength and/or efficiency and that the onset of the selective sweep occurred following this event. Under this scenario, extant SD-Mal chromosomes have a single origin. We therefore simulated this history in a coalescent framework as an absolute bottleneck to a single chromosome. We performed simulations considering a sample size of n = 9 and assumed no recombination in the ~9.92 Mb region of In(2R)Mal. We simulated with values of S drawn from a uniform distribution ±5% of the observed number of segregating sites in non-coding regions of In(2R)Mal. We considered a prior uniform distribution of the time of the expansion (t) ranging from 0 to 4N generations (0–185,836 years ago), assuming that D. melanogaster N in Zambia 3,160,475 (Kapopoulou et al., 2018), a In(2R)Mal frequency of 1.47%, and 10 generations per year (Li and Stephan, 2006; Thornton and Andolfatto, 2006; Laurent et al., 2011; Kapopoulou et al., 2018). Using the ABC with rejection sampling conditional on our observed estimates of π and Tajima’s D for In(2R)Mal (π = 584.60, D = –1.33; note that π is an overall, unscaled estimate of nucleotide diversity for the whole In(2R)Mal region and that only non-coding regions were considered), we infer that the SD-Mal expansion began ~0.0884 (95% CIs 0.0837–0.1067) × 4N generations ago or, equivalently, ~1644 years ago (1.11% rejection sampling acceptance rate; Figure 4). To account for possible effects of gene conversion between SD and SD+ chromosomes (see below), we discarded SNPs shared with SD chromosomes (see below), and recalculated π and Tajima’s D using only private SNPs (π = 427.72, D = –1.45). Based on these parameters, the estimated SD-Mal expansion occurred ~0.0679 (95% CIs 0.0647–0.0868) 4N generations ago, ~1261 years (1.02% rejection sampling acceptance rate; Figure 4). To calculate the posterior probability of the model, we performed 100,000 simulations under three models: a model assuming a stable frequency of SD-Mal; a model assuming an exponential growth of SD-Mal, based on parameters estimated for Zambia (Kapopoulou et al., 2018); and a selective sweep model (assuming t = 0.0884 and t = 0.0679) (Figure 4—figure supplement 1). The simulated data are inconsistent with a long-term stable frequency of SD-Mal (all SNPs, p = 0.0522, p = 0.096; private, p = 0.0266, p = 0.0668) or long-term exponential growth (all SNPs, p = 0.0465, p = 0.0907; private, p = 0.0215, p = 0.0605). Instead, our simulations suggest that a recent selective sweep is more consistent with the data (all SNPs, p = 0.3554, p = 0.5952; private, p = 0.3480, p = 0.6142). Taken together, evidence from nucleotide diversity, the site frequency spectrum, population differentiation, and coalescent simulations suggests a rapid non-neutral increase in frequency of the SD-Mal supergene that began <2000 years ago.
Figure 4.

Estimating the time since the SD-Mal selective sweep.

Approximate Bayesian computation (ABC) estimates based on 10,000 posterior samples place the onset of the selective sweep between 0.0884 (95% CI 0.0837–0.1067) and 0.0679 (0.0647–0.0868) × 4N generations, that is, ~1261–1644 years ago, considering recent estimates of N in Zambia from Kapopoulou et al., 2018, frequency of SD-Mal in Zambia 1.47% and 10 generations per year. Estimates were done considering only In(2R)Mal, where crossing over is rare and only occurs between SD-Mal chromosomes, using all SNPs and excluding shared SNPs in order to account for gene conversion from SD chromosomes.

(A) With S estimated using all SNPs in In(2R)Mal, and (B) excluding SNPs shared with SD chromosomes to account for gene conversion. Demographic models are: constant frequency of SD-Mal, exponential growth of SD-Mal, and a recent sweep and expansion model (absolute bottleneck at a time t, being t = 0.0884 4N generations for all SNPs and t = 0.0679 4N generations excluding shared SNPs, Figure 4). Blue horizontal line marks observed π (estimated for the entire region) and Tajima’s D in In(2R)Mal in Zambian SD chromosomes.

Figure 4—figure supplement 1.

Neutral coalescent simulations under three demographic models.

(A) With S estimated using all SNPs in In(2R)Mal, and (B) excluding SNPs shared with SD chromosomes to account for gene conversion. Demographic models are: constant frequency of SD-Mal, exponential growth of SD-Mal, and a recent sweep and expansion model (absolute bottleneck at a time t, being t = 0.0884 4N generations for all SNPs and t = 0.0679 4N generations excluding shared SNPs, Figure 4). Blue horizontal line marks observed π (estimated for the entire region) and Tajima’s D in In(2R)Mal in Zambian SD chromosomes.

Estimating the time since the SD-Mal selective sweep.

Approximate Bayesian computation (ABC) estimates based on 10,000 posterior samples place the onset of the selective sweep between 0.0884 (95% CI 0.0837–0.1067) and 0.0679 (0.0647–0.0868) × 4N generations, that is, ~1261–1644 years ago, considering recent estimates of N in Zambia from Kapopoulou et al., 2018, frequency of SD-Mal in Zambia 1.47% and 10 generations per year. Estimates were done considering only In(2R)Mal, where crossing over is rare and only occurs between SD-Mal chromosomes, using all SNPs and excluding shared SNPs in order to account for gene conversion from SD chromosomes.

Neutral coalescent simulations under three demographic models.

(A) With S estimated using all SNPs in In(2R)Mal, and (B) excluding SNPs shared with SD chromosomes to account for gene conversion. Demographic models are: constant frequency of SD-Mal, exponential growth of SD-Mal, and a recent sweep and expansion model (absolute bottleneck at a time t, being t = 0.0884 4N generations for all SNPs and t = 0.0679 4N generations excluding shared SNPs, Figure 4). Blue horizontal line marks observed π (estimated for the entire region) and Tajima’s D in In(2R)Mal in Zambian SD chromosomes. The sweep signal on the SD-Mal haplotypes begins immediately distal to Sd-RanGAP on 2L and extends ~3 Mb beyond the distal boundary of In(2R)Mal on 2R. To understand why the sweep extends so far beyond the In(2R)Mal-d distal breakpoint, we consider three, not mutually exclusive, possibilities. First, chromosomal inversions can suppress recombination ~1–3 Mb beyond their breakpoints (in both multiply inverted balancer chromosomes, [Miller et al., 2016; Crown et al., 2018; Miller et al., 2018] and natural inversions [Stevison et al., 2011; Fuller et al., 2017]), extending the size of the sweep signal. To determine the extent of recombination suppression caused by In(2R)Mal, we estimated recombination rates in the region distal to the inversion. The expected genetic distance between the distal breakpoint of In(2R)Mal (2R:18.77 Mb) and px (2R:22.49 Mb) is ~13.87 cM (Fiston-Lavier et al., 2010). Measuring recombination between SD-Mal and standard arrangement chromosomes for the same (collinear) interval, we estimate a genetic distance of ~1.76 (Table 1), an 87.3% reduction. In(2R)Mal strongly reduces recombination beyond its distal boundary. Second, although we have inferred that the essential enhancer(s) reside(s) within the In(2R)Mal inversion (see above), we have not excluded the possibility of weak enhancers distal to the inversion which might contribute to the sweep signal. We find that SD-Mal chromosomes with In(2R)Mal-distal material recombined away (b) have modestly but significantly lower drive strength (k = 0.96 vs. 0.98; Table 2, lines 1–2), suggestive of one or more weak distal enhancers. Third, there may be mutations distal to In(2R)Mal that contribute to the fitness of SD-Mal haplotypes but without increasing the strength of drive, for example, compensatory mutations that ameliorate the effects of SD-Mal-linked deleterious mutations. Most supergenes show long-range LD, reduced nucleotide diversity, and differentiation when compared with their wildtype counterparts. While some meiotic drive supergenes show evidence of recurrent selective sweeps (Dyer et al., 2007) or a signature of epistatic selection without strong selective sweeps (Fuller et al., 2020), others show no signatures of recent or ongoing positive selection (Kelemen and Vicoso, 2018). The relatively recent origin (~38.5 kya; Brand et al., 2015) of SD might explain the constant turnover, as there may not have been enough time to reach a stable equilibrium compared to older drive systems like the t-haplotype, whose first inversion arose 3 mya (Hammer and Silver, 1993).

Recombination on SD-Mal supergenes

While nearly all SD-Mal haplotypes are individually homozygous lethal and do not recombine with wildtype chromosomes in and around In(2R)Mal, ~90% of pairwise combinations of different SD-Mal chromosomes (SD/SD) are viable and fertile in complementation tests (Presgraves et al., 2009; Brand et al., 2015). Therefore, recombination via crossing over may occur between SD-Mal chromosomes in SD/SD heterozygous females. To determine if SD-Mal chromosomes recombine, we estimated mean pairwise linkage disequilibrium (r) between SNPs located within the In(2R)Mal arrangement. We found that mean r between pairs of SNPs declines as a function of the physical distance separating them (Figure 5A), a hallmark of recombination via crossing over (Hill and Robertson, 1968; Miyashita and Langley, 1988; Schaeffer and Miller, 1993; Awadalla et al., 1999; Conway et al., 1999). Pairwise LD is higher and extends further in In(2R)Mal than in the equivalent region of SD chromosomes or in any of the other two cosmopolitan inversions, In(2L)t and In(2R)NS (Figure 5A). This pattern is not surprising: the low frequency of SD-Mal makes SD/SD genotypes, and hence the opportunity for recombination, rare. (The smaller sample size of SD (n = 9) vs. SD (n = 10) may also contribute weakly to its higher estimated LD.) To further characterize the history of recombination between SD-Mal haplotypes, we used 338 non-singleton, biallelic SNPs in In(2R)Mal to trace historical crossover events. From these SNPs, we estimate that Rm (Hudson and Kaplan, 1985), the minimum number of recombination events, in this sample of SD-Mal haplotypes is 15 (Figure 5C). Thus, assuming that these SD-Mal haplotypes are ~16,436 generations old (Figure 4), we estimate that recombination events between SD-Mal haplotypes occur a minimum of once every ~1096 generations. We can thus confirm that crossover events are relatively rare, likely due to the low population frequency of SD-Mal and the possibly reduced fitness of SD/SD genotypes.
Figure 5.

Recombination on SD-Mal haplotypes.

(A) Linkage disequilibrium () as a function of distance in 10-kb windows, measured in In(2R)Mal (n = 9), In(2L)t (n = 10), In(2R)NS (n = 10), and the corresponding region of In(2R)Mal in a standard, uninverted 2R chromosome (n = 10). (B) Histogram of length of runs of SNPs in In(2R)Mal shows that a high proportion of shared SNPs concentrate in runs shorter than 1 kb. (C) Chromosomal configuration of the 338 non-singleton SNPs in nine different SD-Mal lines. Color coded for two states (same in light orange or different in dark orange) using SD-ZI125 as reference. Locations of minimal number of recombination events are labeled as triangles at the bottom. Maximum likelihood tree is displayed on the left.

Recombination on SD-Mal haplotypes.

(A) Linkage disequilibrium () as a function of distance in 10-kb windows, measured in In(2R)Mal (n = 9), In(2L)t (n = 10), In(2R)NS (n = 10), and the corresponding region of In(2R)Mal in a standard, uninverted 2R chromosome (n = 10). (B) Histogram of length of runs of SNPs in In(2R)Mal shows that a high proportion of shared SNPs concentrate in runs shorter than 1 kb. (C) Chromosomal configuration of the 338 non-singleton SNPs in nine different SD-Mal lines. Color coded for two states (same in light orange or different in dark orange) using SD-ZI125 as reference. Locations of minimal number of recombination events are labeled as triangles at the bottom. Maximum likelihood tree is displayed on the left. While crossing over is suppressed in SD-Mal/SD heterozygotes, gene conversion and/or double crossover events may still occur, accounting for the shared SNPs between SD-Mal and SD chromosomes within In(2R)Mal. As both events exchange tracts of sequence, we expect shared SNPs to occur in runs of sites at higher densities than private SNPs, which should be distributed randomly. Accordingly, in In(2R)Mal, SNP density is five times higher for runs of shared SNPs (0.63 SNPs/kb) than for runs of SD-private SNPs (0.12 SNPs/kb), as expected if SD chromosomes, which have higher SNP densities, were donors of conversion tract sequences. Although we cannot exclude the contribution of double crossovers, we note that 62.2% (89 out of 143) of the shared SNP runs are <1 kb, 80.4% (115 out of 143) are <10 kb (Figure 5B), and the longest run is ~50.2 kb. These sizes are more consistent with current estimates of gene conversion tract lengths in D. melanogaster than with double cross-overs (Comeron et al., 2012; Miller et al., 2016). Surprisingly, these inferred gene conversion events are unevenly distributed across In(2R)Mal, being more frequent in the In(2R)Mal-p than in In(2R)Mal-d (Supplementary file 3). Our discovery that SD-Mal haplotypes can recombine with each other distinguishes the SD-Mal supergene from supergenes that are completely genetically isolated (Wang et al., 2013; Charlesworth, 2016; Tuttle et al., 2016). The lack of crossing over with SD chromosomes, however, means that SD-Mal haplotypes evolve as a semi-isolated subpopulation, with a nearly 100-fold smaller N and limited gene flow from SD via gene conversion events. The reduced recombination, low N, and history of epistatic selection may nevertheless lead to a higher genetic load on SD-Mal than SD+ chromosomes. We therefore examined the accumulation of deleterious mutations, including non-synonymous mutations and TEs, on the SD-Mal supergene.

Consequences of reduced recombination, small effective size, and epistatic selection

We first studied the effects of a reduced efficacy of selection on SNPs in In(2R)Mal. As many or most non-synonymous polymorphisms are slightly deleterious (Ohta, 1976; Fay et al., 2001; Eyre-Walker et al., 2002; Keightley and Eyre-Walker, 2007; Eyre-Walker and Keightley, 2009), relatively elevated ratios of non-synonymous to synonymous polymorphisms (N/S ratio) can indicate a reduced efficacy of negative selection. For the SNPs in In(2R)Mal, the overall N/S ratio is 2.3-fold higher than that for the same region of SD chromosomes (Table 4). Notably, the N/S ratio for private SNPs is 3.1-fold higher (Table 4), whereas the N/S ratios for shared SNPs do not significantly differ from SD chromosomes (Table 4, Figure 6—figure supplement 1). These findings suggest that gene conversion from SD ameliorates the accumulation of potentially deleterious non-synonymous mutations on SD-Mal chromosomes (see also Kelemen and Vicoso, 2018; Pieper and Dyer, 2016).
Table 4.

Synonymous and non-synonymous SNPs.

Genotype N S N/S Fold changep-value
All SNPs SD-Mal 791140.692.27<0.0001
SD+ 10,47034,3010.31
Private SNPs SD-Mal 61551.113.10<0.0001
SD+ 678218,9380.36
Shared SNPs SD-Mal 18590.311.270.3722
SD+ 368815,3630.24

Counts of non-synonymous (N) and synonymous (S) SNPs in the In(2R)Mal region of SD-Mal chromosomes, and the equivalent region of uninverted, SD chromosomes. N/S ratio per genotype, fold-change of N/S ratios between SD-Mal and SD p-values reported by Pearson’s χ test of independence.

Figure 6—figure supplement 1.

Frequency spectra of synonymous and non-synonymous SNPs.

Frequency spectra of synonymous and non-synonymous SNPs in the In(2R)Mal chromosome region in Zambian SD chromosomes (n = 9, orange) and wildtype chromosomes from the same population, bearing the cosmopolitan inversions In(2L)t (n = 10, dark blue) and In(2R)NS (n = 10, light blue). N/S ratio for each of the frequency categories.

Counts of non-synonymous (N) and synonymous (S) SNPs in the In(2R)Mal region of SD-Mal chromosomes, and the equivalent region of uninverted, SD chromosomes. N/S ratio per genotype, fold-change of N/S ratios between SD-Mal and SD p-values reported by Pearson’s χ test of independence. Gene conversion may not, however, rescue SD-Mal from deleterious TEs insertions, as average TE length exceeds the average gene conversion tract length (Kaminker et al., 2002). TEs accumulate in regions of reduced recombination, such as centromeres (Charlesworth et al., 1994) and inversions, especially those at low frequency (Eanes et al., 2009; Sniegowski and Charlesworth, 1994). Indeed, TE densities for the whole euchromatic region of chromosome 2R are significantly higher for SD-Mal compared to SD chromosomes (Figure 6A). This increased TE density on SD-Mal is driven by the low recombination regions of the haplotype: In(2R)Mal has significantly higher TE density than SD whereas the distal region of 2R outside of the sweep region does not (Figure 6B). The most overrepresented families in In(2R)Mal relative to standard chromosomes are M4DM, MDG1, ROO_I, and LINE elements (Figure 6—figure supplement 2)—TEs that are currently or recently active (Kaminker et al., 2002; Kofler et al., 2015; Diaz-González and Dominguez, 2020)—consistent with the recent origin of the SD-Mal haplotype. Thus, the differences in shared vs. private SNPs suggests that gene conversion from SD chromosomes may slow the accumulation of deleterious point mutations but not the accumulation of TEs. Despite occasional recombination, the small N of SD-Mal haplotypes has incurred a higher genetic load.
Figure 6.

Transposable elements (TEs) on SD-Mal haplotypes.

(A) Number of TE insertions per 100-kb windows along chromosome 2 in Zambian SD chromosomes (n = 9, orange) and wildtype chromosomes from the same population, bearing the cosmopolitan inversions In(2L)t (n = 10, dark blue) and In(2R)NS (n = 10, light blue). (B) Ratio of the number of insertions in the euchromatin of 2R to 2L per library. The relative enrichment in TEs in 2R of SD-Mal haplotypes is mostly due to an increase of TE insertions in non-recombining regions of the chromosome. Asterisks denote significance, p-values estimated by a Kruskal-Wallis test (threshold for significance p = 0.05).

Frequency spectra of synonymous and non-synonymous SNPs in the In(2R)Mal chromosome region in Zambian SD chromosomes (n = 9, orange) and wildtype chromosomes from the same population, bearing the cosmopolitan inversions In(2L)t (n = 10, dark blue) and In(2R)NS (n = 10, light blue). N/S ratio for each of the frequency categories.

Number of insertions per TE family in SD-Mal (orange) compared to uninverted SD+ chromosome 2R (dark blue), both in In(2R)Mal (2R:8.85–18.77, top panel) and the region distal to it (2R:18.77–25.29, bottom panel). The families DNA/M4DM, LTR/MDG1, LTR/ROO_I, and Non-LTR/LINE are highly overrepresented in In(2R)Mal.

Abundance of TEs in down sampled (3M reads, 75 bp) libraries for Zambian SD chromosomes (n = 9, orange) and SD chromosomes from the same population, bearing the cosmopolitan inversions In(2L)t (n = 10, dark blue) and In(2R)NS (n = 10, light blue).

Figure 6—figure supplement 2.

Number of insertions per transposable element (TE) family.

Number of insertions per TE family in SD-Mal (orange) compared to uninverted SD+ chromosome 2R (dark blue), both in In(2R)Mal (2R:8.85–18.77, top panel) and the region distal to it (2R:18.77–25.29, bottom panel). The families DNA/M4DM, LTR/MDG1, LTR/ROO_I, and Non-LTR/LINE are highly overrepresented in In(2R)Mal.

Transposable elements (TEs) on SD-Mal haplotypes.

(A) Number of TE insertions per 100-kb windows along chromosome 2 in Zambian SD chromosomes (n = 9, orange) and wildtype chromosomes from the same population, bearing the cosmopolitan inversions In(2L)t (n = 10, dark blue) and In(2R)NS (n = 10, light blue). (B) Ratio of the number of insertions in the euchromatin of 2R to 2L per library. The relative enrichment in TEs in 2R of SD-Mal haplotypes is mostly due to an increase of TE insertions in non-recombining regions of the chromosome. Asterisks denote significance, p-values estimated by a Kruskal-Wallis test (threshold for significance p = 0.05).

Frequency spectra of synonymous and non-synonymous SNPs.

Frequency spectra of synonymous and non-synonymous SNPs in the In(2R)Mal chromosome region in Zambian SD chromosomes (n = 9, orange) and wildtype chromosomes from the same population, bearing the cosmopolitan inversions In(2L)t (n = 10, dark blue) and In(2R)NS (n = 10, light blue). N/S ratio for each of the frequency categories.

Number of insertions per transposable element (TE) family.

Number of insertions per TE family in SD-Mal (orange) compared to uninverted SD+ chromosome 2R (dark blue), both in In(2R)Mal (2R:8.85–18.77, top panel) and the region distal to it (2R:18.77–25.29, bottom panel). The families DNA/M4DM, LTR/MDG1, LTR/ROO_I, and Non-LTR/LINE are highly overrepresented in In(2R)Mal.

Abundance of transposable elements (TEs) in downsampled libraries.

Abundance of TEs in down sampled (3M reads, 75 bp) libraries for Zambian SD chromosomes (n = 9, orange) and SD chromosomes from the same population, bearing the cosmopolitan inversions In(2L)t (n = 10, dark blue) and In(2R)NS (n = 10, light blue).

Conclusions

Supergenes are balanced, multigenic polymorphisms. Under the classic model of supergene evolution, epistatic selection among component loci favors the recruitment of recombination modifiers that reinforce the linkage of beneficial allelic combinations. The advantages of reduced recombination among strongly selected loci can however compromise the efficacy of selection at linked sites. Supergenes thus provide opportunities to study the interaction of recombination and natural selection. We have studied a population of selfish supergenes, the SD-Mal haplotypes of Zambia, to investigate the interplay of recombination, selection, and meiotic drive. Our findings demonstrate, first, that the SD-Mal supergene extends across ~25.8 Mb of D. melanogaster chromosome 2, a region that comprises the driving Sd-RanGAP, a drive-insensitive deletion at the major Rsp locus, and the In(2R)Mal double inversion. Second, using genetic manipulation, we show that SD-Mal requires Sd-RanGAP and an essential co-driver that localizes almost certainly within the In(2R)Mal rearrangement, and probably within the distal inversion. These data provide experimental evidence for epistasis between Sd-RanGAP and In(2R)Mal: neither allele can drive without the other. Third, we provide population genomics evidence that epistatic selection on loci spanning the SD-Mal supergene region drove a very recent, chromosome-scale selective sweep. These patterns are consistent with recurrent episodes of replacement of one SD haplotype by others (Presgraves et al., 2009; Brand et al., 2015). Fourth, despite rare crossovers among complementing SD-Mal haplotypes and gene conversion from wildtype chromosomes, the relative genetic isolation and low frequency of SD-Mal results in the accumulation of deleterious mutations including, especially, TE insertions. From these findings, we conclude that the SD-Mal supergene population is of small effective size, semi-isolate from the greater population of wildtype chromosomes, and subject to bouts of very strong selection. Non-recombining supergenes that exist exclusively in heterozygous state tend to degenerate, as in the case of Y chromosomes (reviewed in Charlesworth and Charlesworth, 2000) and some autosomal supergenes which, for different reasons, lack any opportunity for recombination (Uyenoyama, 2005; Wang et al., 2013; Tuttle et al., 2016; Branco et al., 2018; Stolle et al., 2019; Brelsford et al., 2020). But not all supergenes are necessarily expected to degenerate. In SD-Mal, for instance, complementing SD-Mal haplotypes can recombine via crossing over, if rarely, and gene flow from wildtype SD to SD-Mal chromosomes can occur via gene conversion. In the mouse t-haplotype, there is similar evidence for occasional recombination between complementing t-haplotypes (Dod et al., 2003) and with standard chromosomes, probably via gene conversion (Herrmann et al., 1987; Erhart et al., 2002; Wallace and Erhart, 2008; Kelemen and Vicoso, 2018). Despite the many parallels characterizing supergenes, their ultimate evolutionary fates depend on the particulars of the system.

Materials and methods

Fly lines, library construction, and sequencing

We sequenced haploid embryos using the scheme in Langley et al., 2011, which takes advantage of a mutation, ms(3)K81 (Fuyama, 1984), which causes the loss of the paternal genome early in embryonic development. We crossed SD-Mal/CyO stocks generated in Brand et al., 2015 to homozygous ms(3)K81 males and allowed them to lay eggs overnight. We inspected individual embryos under a dissecting scope for evidence of development and then isolated them for whole genome amplification using the REPLI-g Midi kit from Qiagen (catalog number 150043). For each WGA DNA sample, we tested for the presence of Sd-RanGAP using PCR (primers from Presgraves et al., 2009). We prepared sequencing libraries for Illumina sequencing with TruSeq PCR free 350 bp. We assessed library quality using a BioAnalyzer and sequenced with HiSeq2500 2 × 150 bp reads (TruSeq) or 2 × 125 bp reads (Nextera). To trim reads, we used Trimgalore v0.3.7 and the parameters: q 28 --length 20 --paired -a . Trimmed reads are available in SRA (Bioproject PRJNA649752, SRA accession numbers in Supplementary file 1, Sheet 1). We sequenced a total of 10 SD-Mal genomes. One of these genomes (SD-ZI157) was Sd-In(2R)Mal, non-driving, and therefore excluded from further analysis. Out of the remaining nine driving SD-Mal chromosomes, one of them (SD-ZI138) had lower depth than the other eight (Supplementary file 1, Sheet 2) in the main chromosome arms but unusually high depth in the mitochondrial genome. We ran additional analyses dropping SD-ZI138 and show that including this sample does not affect our main conclusions (Supplementary file 5; Sheet 2). For the Nanopore library, we extracted High-Molecular-Weight DNA from ~200 frozen female SD-ZI125/SD-ZI125 virgins. We extracted DNA using a standard phenol-chloroform method and spooled DNA using capillary tubes. We constructed a library with ~1 μg DNA using RAD004 kit and the ultra-long read sequencing protocol (Quick, 2018). We sequenced the library using R9.4 flow cells and called bases with the ONT Albacore Sequencing Pipeline Software version v2.2.10.

Estimating Rsp copy number

We mapped Zambian SD reads to an assembly containing 2R pericentric heterochromatin (Chang and Larracuente, 2019), including the Rsp locus detailed in Khost et al., 2017, with bowtie2 v2.3.5 (Langmead and Salzberg, 2012). We estimated mean per-window and per-Rsp repeat depth using mosdepth v0.2.9 (Pedersen and Quinlan, 2018). Coordinates for Rsp repeats were based on annotations in Khost et al., 2017.

In(2R)Mal breakpoints

To assemble SD-ZI125, we filtered Nanopore reads using Porechop (v0.2.3) and Filtlong (--min_length 500) to remove adapters and short reads (https://github.com/rrwick/Porechop [Wick et al., 2017; Wick, 2017a] and https://github.com/rrwick/Filtlong [Wick, 2017b]). We were left with a total of 1,766,164,534 bases in 327,248 filtered reads. We performed de novo assemblies with the Nanopore reads using Flye v2.3.7 (Kolmogorov et al., 2019) with parameters ‘-t 24 g 160 m --nano-raw’ and wtdbg v2.2 (Ruan and Li, 2020) with parameters ‘-p 19 -AS 1 s 0.05 L 0 -e 1’. We independently polished these two assemblies 10 times with Pilon v1.22 (Walker et al., 2014) using paired-end Illumina reads. Lastly, we reconciled these two polished assemblies using quickmerge v0.3 (Chakraborty et al., 2016) using the flye assembly as the reference with the command ‘python merge_wrapper.py wtdbg assembly flye assembly’. We aligned the contig containing the euchromatin on SD-ZI125 to chromosome 2R of the D. melanogaster (BDGP6) genome using Mauve (Darling et al., 2010). We defined the breakpoints according to the block rearrangement shown in Figure 1. To validate these breakpoints, we designed primers anchored at both sides of the most external breakpoints of In(2R)Mal (Supplementary file 4) for PCR.

Measuring genetic distances along SD-Mal and strength of distortion in the recombinants

To estimate recombination frequencies and obtain SD-Mal recombinant genotypes, we used a D. melanogaster stock al[1] dpy[ov1] b[1] pr[1] c[1] px[1] sp[1], from Bloomington Drosophila Stock Center (RRID:BDSC_156), which has three visible, recessive markers on chromosome 2 that are informative about recombinants involving SD: black (b, 2L: 13.82), curved (c, 2R:15.9), and plexus (px, 2R:22.49). As our SD flies are white-eyed, we did not score purple (pr, an eye color phenotype). All crosses were transferred to fresh vials after 5 days, and then adults were removed from the second vial after 5 days. Progeny emerging from the crosses were scored for up to 20 days following the cross. To generate SD-Mal recombinant chromosomes, we crossed 8–10 b c px/b c px virgin females to 3–5 SD-ZI125 males, recovered SD-ZI125/b c px virgins, then backcrossed 8–10 of them to 3–5 b c px homozygous males (Figure 1—figure supplement 4). To estimate genetic distance between the visible markers, we scored the number of recombinants in 11 crosses (n = 1820). To compare genetic distance in SD-Mal to wildtype chromosomes, we estimated the number of recombinants from 15 crosses between OregonR/b c px females to b c px/b c px males (n = 1716). We recovered three types of recombinant chromosomes from SD-ZI125/b c px x b c px/b c px crosses: b Sd and b (Figure 1—figure supplement 4). We crossed 3–5 virgin b c px/b c px females to individual recombinant males of each type, and scored the proportion of progeny carrying the recombinant chromosome (k = n/n). To distinguish distortion from viability effects, we also measured transmission of recombinant chromosomes through females, as drive is male-specific. We used these crosses to measure relative viability (w = n/n). We then used w to calculate a viability-corrected strength of distortion in males (k* = n/(wn + n)) (Powers and Ganetzky, 1991). To check for recombination close to the inversion breakpoints, we amplified two regions between the distal breakpoint of In(2R)Mal (2R:18:77) and px (2R:22.49), corresponding to the genes sano (2R:18.87; F primer: GGACCATTTCTAGGGCATCA, R primer: AATGAAACGTCCCCTCTTTG) and CG15666 (2R:21.34; F primer: GGCCTATTGCGAGAGAACTG, R primer: TGCTTCCTTGATCTCGTCCT). Primers were designed so that they yield amplicons of different length in SD-Mal and SD.

Estimate of the frequency of SD-Mal in the DPGP3 dataset

To estimate the frequency of In(2R)Mal in a random sample of Zambian chromosomes, we mapped the 204 Illumina paired-end libraries from the DPGP3 dataset (Lack et al., 2016) to the D. melanogaster (BDGP6) genome, using bwa-mem (v0.7.9a), and we visually looked for an accumulation of discordant read pairs surrounding the estimated breakpoints of In(2R)Mal. To test the reliability of this method, we also applied it to detect cosmopolitan inversions In(2L)t and In(2R)NS and compared our inversion calls with the most recent inversion calls for the DPGP3 dataset (http://johnpool.net/Updated_Inversions.xls, last accessed 07/13/2020), getting a 98% and 99% of concordance for In(2L)t and In(2R)NS, respectively. To determine the frequency of the Sd-RanGAP duplication in the DPGP3 dataset, we applied a similar method around the breakpoints of the Sd-RanGAP duplication (see Supplementary file 5).

SNP calling and annotation

For SNP calling, we mapped the Illumina reads from our SD-Mal libraries and the 20 SD libraries from the DPGP3 dataset to D. melanogaster (BDGP6) genome (ftp://ftp.ensembl.org/pub/release-88/fasta/drosophila_melanogaster/dna/; last accessed o6/25/20) using BWA mem (v0.7.9a). We removed duplicated reads with Picard (2.0.1) and applied the GATK (3.5) ‘best practices’ pipeline for SNP calling. We did local realignment and base score recalibration using SNPs data from DPGP1 ensembl release 88 (ftp://ftp.ensembl.org/pub/release-88/variation/vcf/drosophila_melanogaster/; last accessed 06/25/20). To call SNPs and indels, we used HaplotypeCaller and performed joint genotyping for each of the five genotypes using GenotypeGVCFs. SNPs filtered with following parameters: ‘QD <2.0 || FS >60.0 || MQ <40.0 || MQRankSum <–12.5 || ReadPosRankSum <–8.0’. We annotated SNPs as synonymous or non-synonymous using SNPeff (4.3, Cingolani et al., 2012) with the integrated D. melanogaster database (dmel_r6.12) database and parsed these annotations with SNPsift (Cingolani et al., 2012). To classify the SNPs as ‘shared’ between SD-Mal, SD and SD, or ‘private’ to each one of them, we used BCFtools intersect (1.6; Danecek et al., 2021).

Population genomics analysis

We wrote a Perl script to estimate S, π, Tajima’s D, F, and d in windows across the genome (available here: https://github.com/bnavarrodominguez/sd_popgen; Navarro-Dominguez, 2022b, copy archived at swh:1:rev:e012c1df579871600334847e254a1ecc6c053592). To calculate F values, we used the Weir-Cockerham estimator (Weir and Cockerham, 1984). Only those sites with a minimum sample depth of 8 were included in the F and Tajima’s D calculations. We determined window size by the number of ‘acceptable sample depth’ sites (and not, for example, a particular range of chromosome coordinates). As Tajima’s D is sensitive to the numbers of segregating sites in a sample (Schaeffer, 2002), we also estimated D/Dmin; that is, the ratio of Tajima’s D to its theoretical minimum (D) when all sites in a window are singletons (Tajima, 1989; Figure 2—figure supplement 2). To confirm that repeats were not interfering with our results, we ran our population genomics pipeline masking SNPs in repetitive elements identified by RepeatMasker (Smit et al., 2013), which yielded equivalent results (Supplementary file 6, Sheet 1).
Figure 2—figure supplement 2.

Tajima’s D estimates.

(A) Tajima’s D estimates in non-overlapping 10-kb windows along chromosome 2, in Zambian SD-Mal chromosomes (n = 9, orange) and SD chromosomes from the same population, bearing the cosmopolitan inversions In(2L)t (n = 10, dark blue) and In(2R)NS (n = 10, light blue). (B) To account for the differences in number of segregating sites between windows, we also estimated D/D, that is, the ratio of D to its theoretical minimum D, when all sites are singletons. Regions corresponding to pericentric heterochromatin are shaded in gray and the centromere location is marked with a black circle.

Age of the sweep

We calculated overall S, π and Tajima’s D from the SD-Mal SNP set using our same Perl script (available here: https://github.com/bnavarrodominguez/sd_popgen), using a single window of 9.5 Mb within the boundaries of In(2R)Mal. To account for gene conversion, we calculated an additional set of summary statistics masking the SNPs annotated as shared by at least one of the SD+ libraries. We estimated the time since the most recent selective sweep using an ABC method with rejection sampling. We modeled the selective sweep as an absolute bottleneck (N = 1) at some time (t, 4N generations) in the past. We performed simulations in ms (Hudson, 2002), considering a sample size of 9 and assuming no recombination in the ~9.92 Mb of In(2R)Mal. To enrich for neutral mutations, we only considered non-coding SNPs in intergenic and intronic regions. We simulated with values of S drawn from a uniform distribution ±5% of S. We considered a prior uniform distribution of time of the sweep (t) ranging from 0 to 4N generations, that is, 0–185,836 years ago, considering D. melanogaster N in Zambia 3,160,475 (Kapopoulou et al., 2018), frequency of In(2R)Mal 1.47% and 10 generations per year. The rejection sampling algorithm is as follows: (1) draw S and t from prior distributions; (2) simulate 1000 samples using the coalescent under a selective sweep model; (3) calculate average summary statistics for drawn S and t; (4) accept or reject chosen parameter values conditional on |π| ≤ ε, |D| ≤ ε; (5) return to step 1 and continue simulations until m desired samples from the joint posterior probability distribution are collected. For estimates of t, ε was set to 5% of the observed values of the summary statistics (in step 4) and m was set to 10,000. These simulations were performed with parameters calculated using all the SNPs in non-coding regions of In(2R)Mal and also excluding SNPs shared with SD chromosomes to account for gene conversion. We simulated 100,000 samples with the resulting estimated t and S, under our sweep model, under a constant size population model, and under an exponential growth model. For the growth model, we assumed an exponential growth rate of α = 0.26, based on parameters estimated for Zambia (exponential growth from past N = 1,137,712 to present N = 3,160,475 in the last 72,005 years) (Kapopoulou et al., 2018), scaling N by the frequency of SD-Mal in Zambia (1.47%). We calculated two-sided p-values for π and Tajima’s D using an empirical cumulative probability function (ecdf) in R (R Development Core Team, 2019). We estimated the maximum a posteriori estimate as the posterior mode and 95% credibility intervals (CIs) in R (R Development Core Team, 2019).

Recombination

For estimates of recombination, we filtered the SNPs in In(2R)Mal to variable positions genotyped in all of the nine ZI-SD samples and excluded singletons, resulting in a total of 338 SNPs. We estimated pairwise linkage disequilibrium (r) using PLINK v1.9 (Purcell et al., 2007). We discarded r data calculated for pairs of SNPs flanking the internal In(2R)Mal breakpoints. For comparison, we estimated pairwise linkage disequilibrium in the same region of In(2R)Mal for SD uninverted 2R chromosome arms and, for comparison, in SD inversion and in SD inversions. For SD chromosomes, we applied the same filters (variable, non-singleton SNPs), plus an SNP ‘thinning’ to 1 SNPs/kb to get a manageable set of results. To investigate the possibility of crossing over between SD-Mal chromosomes, we used RecMin (Myers and Griffiths, 2003) to estimate the minimum number of crossovers between the 338 biallelic, non-singleton SNPs in In(2R)Mal. RecMin input is a binary file, which we generated using SD-ZI125 as an arbitrary reference for SD, assigning 0 or 1 on each position depending on if it was the same base or different. Maximum likelihood trees to establish relationships between SD-Mal haplotypes based on these 338 SNPs were estimated using RAxML-NG (Kozlov et al., 2019). Runs of shared and private SNPs were identified in R, using all SNPs (including singletons). A run of SNPs is defined as a region from 5’ to 3’ where all the SNPs are in the same category (shared or private). Distance between the first and the last SNP of a category is considered length of the run. The region between the last SNP of a category and the first SNP of the alternative category is considered distance between runs. Because our sample size is small, we may underestimate the number of shared SNPs, as some private SNPs may be shared with some SD chromosomes that we have not sampled.

TE calling

We used a TE library containing consensus sequences of Drosophila TE families (Chang and Larracuente, 2019). With this library, we ran RepeatMasker (Smit et al., 2013) to annotate reference TEs in the D. melanogaster (BDGP6) genome. To detect genotype-specific TE insertions in our Illumina libraries, we used the McClintock pipeline (Nelson et al., 2017), which runs six different programs with different strategies for TE calling. We collected the redundant outputs from RetroSeq (Keane et al., 2013), PoPoolationTE (Kofler et al., 2012), ngs_te_mapper (Linheiro et al., 2012), TE-Locate (Platzer et al., 2012), and TEMP (Zhuang et al., 2014), discarded the calls produced by TEMP based on non-evidence of absence, and then merged the insertions detected by all different programs, considering the same insertion those of the same TE closer than a distance of ±600 bp, as described in Bast et al., 2019. To reduce false positives, we only considered TE insertion calls that were predicted by more than one of the methods. To account for differences in library read number and/or length between datasets, we report the TE counts for 2R normalized by the TE count for chromosome 2L for the same library (Figure 6B). To assess whether library differences qualitatively affect our results, we repeated the above TE analysis on a set of 3 million randomly selected paired-end reads, trimmed to a fixed length of 75 bp, from each library and report TE count for chromosomes 2R and 2L separately (Figure 6—figure supplement 3).
Figure 6—figure supplement 3.

Abundance of transposable elements (TEs) in downsampled libraries.

Abundance of TEs in down sampled (3M reads, 75 bp) libraries for Zambian SD chromosomes (n = 9, orange) and SD chromosomes from the same population, bearing the cosmopolitan inversions In(2L)t (n = 10, dark blue) and In(2R)NS (n = 10, light blue).

The work advances our understanding of the Segregation Distorter (SD) complex in Drosophila melanogaster. SD, the classic example of a selfish chromosome, consists of two tightly linked genetic elements and thus qualifies as a supergene. The work also excels through particularly careful analyses. In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses. [Editors' note: this paper was reviewed by Review Commons.] Reviewer #1 (Evidence, reproducibility and clarity (Required)): This study examines the Segregation Distorter (SD) polymorphism in a single population in Zambia, Africa. The goals for this study are: (1) to identify the structural features of the SD-Mal haplotype, including the organization of the insensitive Rsp allele and the In(2R)Mal rearrangements; (2) to characterize the genetic function of In(2R)Mal and its role in drive; (3) to infer the population genetic history of the rapid rise in frequency of SD-Mal in Zambia; and (4) to explore the evolutionary consequences of reduced recombination on SD-Mal haplotypes. To accomplish these goals, Nanopore long read sequencing was used to generate a de novo assembly of one SD-Mal haplotype followed by Illumina short read resequencing of nine driving SD haplotypes from a single population in Zambia. The long read assembly of the SD-Mal with the overlapping inversions was used to infer that the distal inversion happened first followed by the proximal inversion. Recombinants were generated with crosses between the SD-Mal and a multiply marked strain show that the two inversions are required for SD drive. This is interesting because the two inversions do not include either SD or Rsp implying an enhancer of drive is located within the inverted region. The paper uses the decay of LD between the SD locus and the inversions to show that LD should decay rapidly suggesting that the association of SD and the inversions is maintained by epistatic selection (see FULLER et al. 2020 for a similar argument for Sex-ratio in D. pseudoobscura). The paper used population genomic analysis of SNPs to show that nucleotide heterozygosity is reduced acros 25 Mb of the SD, Rsp, and Inversion chromosome suggesting a recent origin of the SD-Mal chromosome. The paper used analysis of synonymous and non-synonymous ( S and N) SNPs to infer the degree of deleterious mutations in SD-Mal. The reasoning is that most nonsynonymous SNPs reflect deleterious alleles. The analysis presented here examines the ratio of N/S as a proxy for genetic load. The inverted chromosome has a higher N/S than non-inverted arrangements suggesting that there is higher genetic load or deleterious mutations on SD-Mal chromosomes explaining homozygous lethality of SD-Mals. One question that is not answered by this analysis is what is the frequency of the non-synonymous mutations. How often would they be allelic such that different SD-Mals would be homozygous lethal? Or would only self-SD-Mals be homozygous lethal? Indeed, most combinations of SD Mal chromosomes are viable and fertile in complementation tests (see Presgraves et al. 2009 and Brand et al. 2015), suggesting that most of the deleterious mutations causing lethality or sterility are unique to each haplotype. TEs are found in much greater numbers in SD-Mal chromosomes consistent with the idea that low recombination regions are a sink for the accumulation of TEs. This study examines the Segregation Distorter (SD) polymorphism in a single population in Zambia, Africa. SD is a meiotic drive element that is composed of two tightly linked parts, a driver locus Ran-Gap and the driver's target Responder (Rsp). Ran-Gap is duplicated on the SD chromosome while Rsp is a satellite DNA with SD sensitive and insensitive alleles. The sensitive Rsp allele is a larger satellite that the Rsp insensitive allele. The SD driver allele is linked to a Rsp insensitive allele and targets Rspsensitive chromosomes limiting their transmission during meiosis. This paper maps the location of breakpoints of two inversions that are associated with the SD chromosome and increase the transmission of the SD chromosome. The paper determines the evolutionary sequence of the two inversion events. Evolutionary genomic analysis demonstrates that the SD-Mal chromosome is recent and that the linked inversions enhance the SD phenotype. This is interesting because the distance between the inversions and the two critical loci for the SD phenomenon is sufficient to be randomly shuffled. The fact that they are nonrandomly associated supports the hypothesis that at least one SD enhancing locus is found within the inversions and that strong epistatic selection is maintaining the association. Thank you for this nice summary. We respond to your comments point-by-point below. No additional experiments are needed. The data and methods are presented in such a way that they are reproducible. The data analyses are appropriate Major Comments 1. Page 7 lines 159-176. The issue at play here is the position effect where the inversion breakpoints create variation that could play a role in selection for the phenotype. The paper describes how the breakpoints have disrupted some genes including one that is highly expressed in testes. Another possibility that should be mentioned is that the breakpoints could disrupt gene expression of neighboring genes either because of shuffling regulatory sequences or altering topologically associated domains (TADs). Hou et al. (2012) and others have developed TAD maps for D. melanogaster. Do the inversion breakpoints disrupt TADs potentially leading to altered gene expression that could create selectable variation. I agree that future work will be needed to consider all these possibilities. This is an interesting possibility. Thank you for this suggestion. All four inversion breakpoints disrupt physical domains reported in Hou et al. (2012). However, TADs can vary between tissues, and some studies show that TAD reorganization by inversions does not impact gene expression in Drosophila (Ghavi-Helm et al. 2019 ; Meadows et al. 2010). As Torosin et al. 2020 propose, there might be functionally distinct TAD subtypes, some of them highly conserved and some of them might tolerate rearrangements and evolve rapidly. Thus, it is hard to know the impact of this disruption on SD-Mal. We therefore prefer to be cautious. We revised the text to say: “Even for genes that are not directly interrupted by the inversion breakpoints, the chromosomal rearrangements may disrupt the regulation of nearby genes if, e.g., they affect the organization of topologically associating domains (TADs; reviewed in (SPIELMANN et al. 2018)). The In(2R)Mal inversion breakpoints disrupt physical domains reported in Hou et al. (HOU et al. 2012), however inversion-mediated disruptions of TAD boundaries do not necessarily affect gene expression (GHAVI-HELM et al. 2019). Future work is required to determine if the inversions affect gene expression near the breakpoints and if CG10931 has a role in the SD-Mal drive phenotype.” (lines 194-199) 2. Page 8 Lines 207-208. Can more detail be provided about how these recombinants were infer from molecular markers? Is there any evidence for gene conversion events with non-SD chromosomes, i.e., 100 to 200 bp segments? See Rozas and Aguade (ROZAS AND AGUADÉ 1993) and Betran et al. (1997). Thank you for noting that details were missing about how we genotyped based on molecular markers. We amplified a region from the genes sano (2R: 18.87) and CG15666 (2R: 21.34) using primers that yield amplicons of different sizes in SD+ and SD-Mal chromosomes. We now include the PCR primers and a description of our approach in the Methods (lines 583-587). We infer gene conversion events with non-SD chromosomes from the pattern of shared and private SNPs (see the section “Recombination on SD-Mal supergenes”, starting at line 386). 3. Page 12 Lines 269-279. Tajima's D is sensitive to the numbers of segregating sites within a window (SCHAEFFER 2002). One way to normalize D is to use the ratio of D to its theoretical minimum Dmin when all sites are singletons (see equations 43-45 in TAJIMA 1989). For an example, see Figure 5 in (FULLER et al. 2017). Thank you for this suggestion. We estimated Tajima’s D normalized by Dmin and now we show the results in a new supplementary figure (Figure S9). The results are very similar to Tajima’s D without normalization and therefore our conclusion is the same. We elected to keep the standard Tajima’s D in the main text (Figure 2) and present the normalized D in the supplement (Figure S9). 4. Page 14 Lines 304-306. I would have initially agreed with the paper that shared SNPs between SD-Mal and the ancestral arrangement reflect gene conversion. Using SLIM3 (HALLER AND MESSER 2019) to simulate the origin of new inversions, there is a period of time soon after the origin of the new arrangement where SNPs are polymorphic in the ancestral arrangement and one of the ancestral alleles is fixed in the derived arrangement. Would this site be removed as evidence of gene conversion or would both arrangements need to be segregating for both variants? To detect evidence of gene conversion, we only consider sites that are polymorphic in In(2R)Mal and so we would not consider sites that are fixed in In(2R)Mal. 5. Page 16 Lines 347-366. Recombination in the form of gene conversion would not only happen between SD-Mal chromosomes, but more likely to occur in pairings with non-SD chromosomes. Yes, we agree. However this section is discussing crossing over. The discussion of gene conversion is in the next paragraph (starting at line 416). To make it clearer that here we are referring to crossing over, we added “Therefore, recombination via crossing over may occur between SD-Mal chromosomes in SDi/SDj heterozygous females.” (line 390) 6. Figure 1b. More explanation is needed to explain what is being shown in the lower part of this figure. Does a black line indicate presence of a repeat or TE? An explanation should be added to the figure legend. Yes, the black line indicates the presence of a repetitive element. We adjusted the legend to make this clearer: “The tracks below indicate the presence of types of repetitive elements found at this locus. Black lines indicate the presence of a repeat type in the reference genome. Grey shading shows where Rsp repeats are in the reference genome.”. Thanks for the suggestion. 7. Figure 1c. It might be useful for readers that don't think about overlapping inversions often to provide schematics for the two possible rearrangement scenarios to help understand the inference about why the distal inversion had to happen first. The two possible scenarios are: 1. distal first proximal second leads to red, blue, yellow, green, purple versus 2. proximal first distal second leads to red, green, blue, yellow, purple. The first scenario fits the data. What does the striping of the block mean? Thanks very much for the suggestion to add schematics. We added a supplemental figure (supplemental figure S2) showing schematics for the different scenarios. The apparent striping of the blocks reflects the similarity profile estimated by Mauve: the height corresponds to the sequence conservation and is calculated based on the alignment column entropy in an aligned region. We now include a brief description in the legend: “The colored rectangles correspond to locally collinear blocks of sequence with the height of lines within the block corresponding to average sequence conservation in the aligned region (Darling et al. 2010).” Literature Cited Betran, E., J. Rozas, A. Navarro and A. Barbadilla, 1997 The estimation of the number and the length distribution of gene conversion tracts from population DNA sequence data. Genetics 146: 89-99. Fuller, Z. L., G. D. Haynes, S. Richards and S. W. Schaeffer, 2017 Genomics of natural populations: Evolutionary forces that establish and maintain gene arrangements in Drosophila pseudoobscura. Molecular Ecology 26: 6539-6562. Fuller, Z. L., S. A. Koury, C. J. Leonard, R. E. Young, K. Ikegami et al., 2020 Extensive Recombination Suppression and Epistatic Selection Causes Chromosome-Wide Differentiation of a Selfish Sex Chromosome in Drosophila pseudoobscura. Genetics 216: 205-226. Haller, B. C., and P. W. Messer, 2019 SLiM 3: Forward Genetic Simulations Beyond the Wright-Fisher Model. Molecular Biology and Evolution 36: 632-637. Hou, C., L. Li, Zhaohui S. Qin and Victor G. Corces, 2012 Gene density, transcription, and insulators contribute to the partition of the Drosophila genome into physical domains. Molecular Cell 48: 471-484. Rozas, J., and M. Aguadé, 1993 Transfer of genetic information in the rp49 region of Drosophila subobscura between different gene arrangements. Proceedings of the National Academy of Sciences USA 90: 8083-8087. Schaeffer, S. W., 2002 Molecular population genetics of sequence length diversity in the Adh region of Drosophila pseudoobscura. Genetical Research 80: 163-175. Tajima, F., 1989 Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123: 585-595. Reviewer #1 (Significance (Required)): This study examines the Segregation Distorter (SD) polymorphism in a single population in Zambia, Africa. SD is a meiotic drive element that is composed of two tightly linked parts, a driver locus Ran-Gap and the driver's target Responder (Rsp). Ran-Gap is duplicated on the SD chromosome while Rsp is a satellite DNA with SD sensitive and insensitive alleles. The sensitive Rsp allele is a larger satellite that the Rsp insensitive allele. The SD driver allele is linked to a Rsp insensitive allele and targets Rspsensitive chromosomes limiting their transmission during meiosis. This paper maps the location of breakpoints of two inversions that are associated with the SD chromosome and increase the transmission of the SD chromosome. The paper determines the evolutionary sequence of the two inversion events. Evolutionary genomic analysis demonstrates that the SD-Mal chromosome is recent and that the linked inversions enhance the SD phenotype. This is interesting because the distance between the inversions and the two critical loci for the SD phenomenon is sufficient to be randomly shuffled. The fact that they are nonrandomly associated supports the hypothesis that at least one SD enhancing locus is found within the inversions and that strong epistatic selection is maintaining the association. This work would appeal to audiences in the evolutionary genomics field who are interested in genome rearrangement related to phenotypic variation. My expertise is in evolutionary genomics and I have done similar work on a meiotic drive system on X chromosomes that lead to altered Sex ratios. The Sex ratio system also involves inversion mutations associated with the Sex ratio phenotype. Referees cross-commenting session Reviewer 1 I think the composite set of reviews all agree about the importance of this study. One of few studies that has sequenced a driving chromosome and provided some insightful conclusions. Each of the reviewers touch on slightly different issues, but the set of comments will definitely improve the paper. I think the paper strikes the right balance of addressing important issues without going into too much detail that might hide the interesting results. Reviewer 3 I agree with reviewer 1. Reviewer 2 I also agree – thank you for the nice summary! Reviewer #2 (Evidence, reproducibility and clarity (Required)): SD is a classic example of an autosomal segregation distorter. By combining genetic analyses, long read dna sequencing of one haplotype, and population genomics data, this manuscript provides the first description of the sequence of this selfish element, confirming several previous observations (e.g. general structure), and shedding new light on its history and on the selective pressures that have shaped it (a recent selective sweep driven by epistemically selection, and the accumulation of an excess of nonsynonymous likely due do a reduction in the efficacy of purifying selection). The functional role of different parts of the element is also tested by looking at the distortion capacity of SD/Wild type recombinants. I really enjoyed how thorough the analyses provided here are, and found the conclusions very convincing. My only difficulty was that because so much work is presented here, there was sometimes not much space to put results fully into context. For instance, how the age of the sweep is determined is explained in detail, but the importance of the number is only briefly alluded to in the conclusions. The results could perhaps also be discussed more in the context of what has been found for other drivers (e.g. the excess of nonsynonymous SNPs). Thanks very much for your positive evaluation and for your suggestion. We added some additional context in the results (starting at line 347 and additional context referenced below) and respond to your other comments point-by-point below. Other comments: – Can the simulations distinguish between SDmal sweeping across a stable SD population (i.e. without changing the 1.4% frequency) versus sweeping in a way that increased SD frequency in the population? It would have been helpful to put these results in the context of what is known about frequencies of SD, and what selective pressures shape them. This is an interesting point. We are unsure of the detailed population dynamics of driving chromosomes. It is possible that SD-Mal could have increased in population frequency following the sweep before returning to the lower frequencies that we observe. We do not simulate this scenario but instead assume that following the replacement event SD-Mal rose to the same frequency as the haplotype that it replaced (similar to the scenario considered by Charlesworth and Hartl 1978). This assumption is in part motivated by an observation that Rayla Temin and Kreber made in Wisconsin, USA. Based on longitudinal data collected ~25 years apart in the same location, they observed that a SD72 haplotype replaced the previously common SD5 haplotype without a major change in the overall SD population frequency (~3%; Temin and Kreber 1981). Given the short timescale of that study, we do not consider a possible transient rise in frequency. Additionally, the selective sweep complicates any inference by coalescence, because we have no history for anything before the sweep. We added text in the Introduction to provide additional context (lines 86-87): “Multiple factors likely contribute to the low frequency of SD in populations: negative selection, insensitive Rsp alleles, and unlinked suppressors (reviewed in LARRACUENTE AND PRESGRAVES 2012). Two independent longitudinal studies suggest that SD haplotypes can replace each other in populations over short time scales (<30 years) (TEMIN AND KREBER 1981; BRAND et al. 2015) without major changes in the overall population frequency of SD (TEMIN AND KREBER 1981).” – Some runs of shared snps seem to be in longer blocs – can you really exclude double crossovers happening with SD+ (as claimed in the text, e.g. l. 105)? We cannot exclude double crossovers, but at the same time we have little evidence for them. Double crossover events are relatively rare and are widely spaced, with an average distance between them of 10.5 Mb (Miller et al. 2016). The longest block of shared SNPs we found is 50.2kb, which is still much shorter than what is expected by double crossover (e.g. the smallest double crossover event detected in Miller et al. 2016 is 1.5Mb). We also did not find any long regions standing out as having a similar nucleotide diversity as SD+ chromosomes. One explanation for these longer tracts is that runs of shared SNPs can be sparse in a long block from multiple gene conversion events, and uninterrupted by private SNPs in the middle because of the young age of the inversion. We updated the text to acknowledge that we cannot rule out double crossovers (lines 423-425): “Although we cannot exclude the contribution of double crossovers, we note that 62.2% (89 out of 143) of the shared SNP runs are <1 kb, 80.4% (115 out of 143) are <10 kb (Figure 5b), and the longest run is ~50.2 kb. These sizes are more consistent with current estimates of gene conversion tract lengths in D. melanogaster than with double cross-over (COMERON et al. 2012; MILLER et al. 2016).” – Figure 1 was a bit hard to read – Panel a has no labels on the axes, and the numbers are very small The letters denoting the markers on panel c look exactly the same as the panel letters -- could capital letters be used for the panels? – Maybe the box with the syntenic blocs could be its own panel? It would make it easier for readers to check in the legend what it is showing. – What do the lines joining the syntenic blocs mean? At first I assumed they would be showing breakpoints, as that would seem like the logical thing to show. Thank you for the suggestions. We increased label font size and now use capital letters for panels to make the figures clearer. We also made the synteny-block figure its own panel. The lines in this plot join syntenic blocks so that the reader can see where the block is the alternative arrangement. Breakpoints are between blocks. – L. 182 where is the data for the reduction in recombination coming from? No figure or table is cited. We had reported the reduction in genetic distance in the text instead of providing a table. We now include these data, including the number of recombinants, in a new Table 1. – The paragraph starting at l. 178 starts with the known observation that the inversion is essential for SDmal drive, and ends with essentially the same conclusion. Maybe it could be rephrased? Thank you for this feedback. We knew from previous work that, in natural populations from Africa, SD chromosomes sampled bearing both Sd and In(2R)Mal show very strong drive, but SD chromosomes bearing just Sd could not drive at all (Presgraves et al. 2009, Brand et al. 2015). However, we did not have direct evidence that recombination between Sd and In(2R)Mal on a driving SD chromosome creates Sd and In(2R)Mal recombinants where neither drive and are instead inherited in Mendelian proportions, as we show in Table 2. We edited the text to make this point clearer (paragraph starting at line 202). – Table 1: it could just be me, but I found the recombinants and their markers hard to make sense of. Maybe a visual schematic could be provided (as a supplementary figure at least) for readers with no experience in fly genetics? Thank you for the suggestion. We now include a new supplemental figure showing the crossing scheme and diagram of possible genotypes (supplemental figure S4) – Table 2: I wonder if this could be simplified and the expectations (outside of linked region, SDmal = SD+; inside, SDmal =< f*SD+) explicitly stated in the text. (This is done for SDmal but not for the adjacent regions). I found it a bit confusing to have comparisons for whole chromosomal arms when the expectation is a mix of both. Thank you for the suggestion. We modified this table (now Table 3) to remove whole chromosome arms and added further explanation in the Table caption. We also added a brief sentence in the text (lines 286-288) “While nucleotide diversity outside of the SD-Mal supergene region is comparable to SD+ (Table 3 row 1), diversity in the supergene region is significantly lower than expected even when scaled by its frequency (Table 3 row 4), suggesting that the low frequency of SD-Mal cannot fully explain its reduced diversity.” Reviewer #2 (Significance (Required)): Although supergenes are in fashion, there are still only a few examples of fully sequenced meiotic drivers, and the addition of SD is an important contribution. The combination of methods and detailed analysis is also novel and crucial for understanding the evolutionary pressures shaping drivers. Reviewer #3 (Evidence, reproducibility and clarity (Required)): Overall, this is an excellent paper, which presents new and illuminating results on the classic system of meiotic drive, the Segregation Distorter complex of Drosophila melanogaster. It is a nice combination of genetics and population genomics, and is clearly written and interesting to read. I have not, however, evaluated the sequencing and bioinformatic details, as these are beyond my expertise. Thank you for your positive feedback and thoughtful suggestions. We respond to your comments point-by-point below. I have a number of relatively minor comments that I hope will help to improve the paper. l.42 Inversions were discussed in Charlesworth and Hartl 1978. Done l.43 I think Turner 1977 (Turner, J. R. G. 1977. Evol. Biol. 10:163-206.) is a better reference; the 1967 paper does not deal with recombination modifiers like inversions. Done l.54 These are rather out of date references on Hill-Robertson effects, etc. The field has moved on a lot since then, especially the discovery of the interference selection limit in very low recombination regions (e.g. Charlesworth, B. et al. 2010. Genetic recombination and molecular evolution. Cold Spring Harb. Symp. Quant. Biol. 74:177-186). Thank you for the suggestion. We updated these references l.55-57 This seems a bit garbled: delete ', they' on l.57, perhaps. Done. We revised to: “The degeneration of drive haplotypes is not inevitable, however. Different drive haplotypes that complement one another may be able to recombine, if only among themselves (DOD et al. 2003; PRESGRAVES et al. 2009; BRAND et al. 2015).” (lines 56-58). l.60-61 Maybe mention selection for loosely linked suppressors of drive. We do not think that this is a natural place to bring up suppressors of drive at this point, so we did not mention it here. l.74 Maybe mention the problem that pericentric inversions can have problems with crossing over- Coyne, JA et al. 1993 Genetics 134: 487-496 have relevant data that suggest how this can be mitigated. We modified the sentence to add: “In heterozygotes with a pericentric inversion, recombination in the inverted region generates aneuploids and therefore reduced fertility, although this effect might be mitigated by strong suppression of recombination (Coyne, 1993).“ (lines 75-77) l.86 It would be helpful to mention the fraction of the chromosome arm that is covered by the inversions. Thanks for the suggestion. We modified this sentence to say: “SD-Mal has a pair of rare, African-endemic, overlapping paracentric inversions spanning ~40% of 2R”. (lines 92-94) l.123 It's not clear what Hs2st in the figure refers to. We added in the figure legend: “The gene Hs2st occurs in the first intron of RanGAP, and it is also duplicated in the Sd locus (Hs2st-2). “ l.165 This order looks correct, but maybe a diagram to show this would be helpful (e.g. in the SI). Thank you for the suggestion. We have added a schematic showing the possible order of inversions as a supplemental figure (figure S2) and this line to the text (lines 185-186): “Note that any rearrangement different than distal first, proximal second, leads to a different outcome (Suppl. Figure S2).” l.183 In the methods (l.522), they mention the standard multiply marked 2nd chromosome al, dp, b, pr, c, sp; why were only b, c and px used? The locations of al (2L: 0.34), dpy (2L: 4.44) and speck (2R: 24.14) were not useful for our goal of studying recombinants within the SD-Mal supergene, since they are further from the supergene than the markers we used: b (2L:13.82) and px (2R:22.49). While pr (2L:20.07) might have been useful, the phenotype (purple eyes) was difficult to distinguish in the crosses, since our stock of SD-Mal flies has white eyes. We edited the methods to say: “To estimate recombination frequencies and obtain SD recombinant genotypes, we used a stock (al[1] dpy[ov1] b[1] pr[1] c[1] px[1] speck[1], BDSC156, Bloomington Drosophila Stock Center), which has three visible, recessive markers on chromosome 2 that are informative about recombinants involving SD: black (b, 2L: 13.82), curved (c, 2R:15.9) and plexus (px, 2R:22.49). Our SD flies are white-eyed, therefore we did not score purple (pr, an eye color phenotype).” l.207 Where are the results for the molecular markers shown? We added a supplementary table with the results for molecular markers (now Suppl. Table S2) l.221 What is the confidence interval on this? Maybe also give the correlation coefficient as well. We now report the correlation coefficient. We are unclear about what confidence interval requested here, but we have assumed that you would like to account for stochasticity in the rate of decay of LD due to the interaction of genetic drift and recombination. Unfortunately, we are unaware of (and were unable to identify) population genetic theory solutions for the variance in the expected decay of LD across generations. However, we suggest that the use of the expected deterministic decay in LD in our simple calculation is reasonably justified by the very, very large population recombination parameter for Sd and the proximal breakpoint of In(2R)Mal (Ne*r > 104). In particular, we assume that Ne = 106 and use an estimated, sex-averaged recombination frequency of r = 0.025, giving Ne*r = 25,000. l.235 There is a problem with the s.e.'s on the diversity values; these SNPs are not independent of each other, as the LD plot shows. One option would be to treat them as part of a non-recombining chunk of genome, and use the standard coalescent formula for their variance to get the s.e.'s. This would be conservative. For the non-recombining region, we now report the standard deviation from the variance in Pi, using the formula B5.6.3 from Charlesworth and Charlesworth (2010) pp. 212-213 in Table 2. l.250 'seem' is better than 'be'. They might want to look at this paper, which models the spread of a mutation to a balanced state: Zeng, K. et al. 2021. Genetics 218: iyab055. We see your point. However, as the prose construction ‘may not seem surprising’ is a bit awkward, we have opted for an equivalent alternative phrasing: “The reduced nucleotide diversity among SD-Mal might be expected given its low frequency in natural populations.” This is an interesting paper but we did not come up with a natural way to tie this into our text. l.266 It would be good to explain that the low frequency of the inversion means that it is largely carried in heterozygotes, where crossing over (but probably not gene conversion) is suppressed. We mention on line 296 that there is a low recombination frequency between SD and SD+. We also mention that crossing over is suppressed in SD/SD+ heterozygotes on line 417. l.273-275 The use of Fst needs more explanation, since it is usually used for between-population comparisons. Here, you are treating inversion and standard arrangements as two subpopulations. It may also be worth mentioning that the Fst statistic is another way of describing the LD between SNPs and the inversion (see the Zeng et al. paper). Also the high Fst and low dxy is consistent with the recent sweep and low diversity within the inversion (see Charlesworth, B/ 1998 MBE 15:538-543; Cruickshank, T. and Hahn, M. 2014. Mol Ecol 23:3133-3157). We added an additional explanation for the use of FST (line 298) and now mention explicitly that FST and DXY are also consistent with the recent sweep within SD-Mal (line 303-305). However, FST is not another way of describing the LD between SNPs and the inversion. FST is a measure of population differentiation due to genetic structure. It takes into account the variance of frequencies of the same allele between two populations, and the probability of identity by descent. Linkage disequilibrium estimates non-random association of alleles at different loci, in the same chromosome, in a given population. In this particular case, FST and LD are both elevated across SD-Mal because of low recombination with other chromosomes from the same population, but high FST does not necessarily entail high LD and vice versa. l.293 It seems a bit unlikely that both inversions arose at the same time. More likely, the distal one was segregating first, and then got hit by the proximal one. If this is a unique event, then you are simulating the second inversion origin, which is fine. We agree. However, we do not know if they arose in an SD or wildtype background: the double inversion could also be segregating and become in cis with Sd by crossover, which would be a single event. We modified the text to clarify this point. “For our simulations, we assume that the acquisition of the second inversion (or the double inversion by crossover) was a unique event that enhanced drive strength and/or efficiency, and the onset of the selective sweep occurred following this event. ” (lines 318-319) l.295 I wonder if one could use the Zeng et al. results on the SFS etc. to make inferences. A problem with what they've done is that they assume a static population size, rather than fitting a demographic model to the wild-type population; this would surely affect the skew in the SFS. Finally, silent sites should strictly be used for this analysis, as they should show less skew in the SFS than nonsynonymous sites. Thank you for the suggestions. We repeated these analyses, using only SNPs located in noncoding regions (intronic and intergenic). We also included an exponential growth model based on demographic parameters from Kapopoulou et al. 2018. See Figure 4 and Suppl. Figure S6. Our conclusions do not change. l.331 References about balancers are not really relevant to natural inversions. While we agree that balancer chromosomes may be different because they are multiply inverted (although In(2R)Mal is not a simple inversion either) and not found in natural populations, we respectfully disagree that it is not relevant for our main point that inversions suppress recombination beyond their breakpoints. We added a citation here to Fuller et al. 2017, which studies natural inversions in D. pseudoobscura and elected to keep the other citations as well, but make the distinction (lines 360362): “First, chromosomal inversions can suppress recombination ~1-3 Mb beyond their breakpoints (in both multiply-inverted balancer chromosomes [Miller et al. 2016; Miller et al. 2018; Crown et al. 2018] and natural inversions [Stevison et al. 2011; Fuller et al. 2017]), extending the size of the sweep signal.” l.348 I would be interested to see a more quantitative statement about the frequency of lethals in Sd-Mal. There are old investigations of inversions by Mukai's group, which suggested that normal inversions are enriched for lethals, but not by any means fixed: 1974 Genetics 76:339, 1976 82:63. See Presgraves et al. 2009 and Brand et al. 2015 for a more extensive analysis on lethals in SD-Mal. They show that most combinations of two different SD Mal chromosomes are viable and fertile in complementation tests, suggesting that most of the deleterious mutations causing lethality or sterility are unique to each haplotype. l.356-9 The sample size needs to be taken into account; it's presumably smaller for Sd-Mal than wildtype, and so Sd-Mal will get LD extending out much further purely by sampling. In the absence of LD, the expectation or r2 is 1/sample size, so will be substantial for a small sample. In any case, it's the product of Ne and recombination rate that determines r2, and Ne is certainly smaller for Sd-Mal. The recent sweep of course complicates interpretation of LD within the inversions. I think these points need attention. The sample size for all population genomics analyses are comparable: 9 for SD-Mal, and 10 for each of the SD+ chromosome samples (In(2L)t and In(2R)NS). We have added sample sizes to the figure caption. The main question we aimed to answer here was whether SD-Mal chromosomes have histories with or without recombination. The aim of Figure 5a is to show that LD decays with distance, a signature of past recombination. A secondary observation is that LD is higher for SD-Mal than wildtype. We agree that higher LD for SD-Mal than wildtype is expected, given the smaller Ne of SD-Mal chromosomes and, to a lesser extent, due to the smaller sample (9 versus 10). We acknowledge both factors in the manuscript (lines 397-398): “This pattern is not surprising: the low frequency of SD-Mal makes SDi/SDj genotypes, and hence the opportunity for recombination, rare. The smaller sample size of SD (n=9) versus SD+ (n=10) may also contribute to higher LD. “. A meaningful quantitative comparison between SD and wildtype samples is not straightforward, however, as the answer depends on the finer details of the SD-Mal sweep. We are reluctant to go beyond our conclusions that a simple sweep model with a recent time of onset fits the data better than the standard neutral model. l.385 Miller et al. 2016 Genetics 203:159 should also be cited. They get a similar mean tract length but a different rate of initiation from Comeron; the latter probably suffers from technical problems and is too high (it's much higher than the old Chovnick values). Cited. Thanks. l.398 These reference to deleterious effect of nonsynonymous mutations are rather old; some of the more recent stuff on estimating the DFE for them should probably be mentioned. We added additional references. l.400 There are problems with using N/S as a measure of deleterious effects, as the denominator is affected by Ne, and so N/S is automatically inflated if S is reduced by low Ne (see Campos et al. 2014 MBE 31:1010 for a discussion and a proposed alternative using the mean frequencies of segregating nonsyn mutations). In many ways, this is all a bit trivial, since, if Ne is reduced, the product Ne x s is automatically reduced, and this is what is used as a measure of selection. The argument that N/S is “automatically inflated if S is reduced by low Ne” presumes that N mutations and S mutations have different distributions of Ne*s. Assuming the standard neutral model, N and S are assumed to be strictly neutral and linear with Ne, and any reduction in Ne should affect both the numerator and denominator of N/S equivalently. Instead, we find that N/S is >2-fold higher for SD versus SD+ chromosomes (Table 4). This cannot be explained by a simple reduction of Ne under the SNM and, therefore, implicates a difference in Ne*s between N and S mutations. As we argue in the manuscript, the fact that N/S is higher for SD than SD+ is as expected if N sites are enriched for slightly deleterious mutations, and if the efficacy of purifying selection is compromised on SD-Mal chromosomes. We are reluctant to push these analyses further by trying to make strong inferences about Ne*s from the SFS, as suggested, for two reasons. First, our sample is rather shallow, comprising just 9 SD chromosomes. Second, the SD-Mal population is in a sweep recovery phase and not at any constant-size equilibrium (as typically assumed for low-recombination regions subject to recurrent hitchhiking effects; see, e.g., Campos et al. 2014). Table 3 Again, there is an independence issue with the chis-squared test, due to shared geneaologies of the SNPs. I am no statistician, but the chi-squared test is likely to be too liberal. The individual observations (mutations) in our samples are all affected by the nonindependence of genealogical history. But this is true for all contingency-based tests in population genetics, from the MK test to GWAS analyses. We see no immediate solution to this problem.The null hypothesis of this chi-squared test is whether the distribution of mutations into N and S classes is independent of whether they come from SD-Mal and SD+ samples. Our chi-square analyses strongly reject this null hypothesis. We agree it is important to be cautious when p values are marginal, but our Table 4 shows p-values smaller than 0.001, so we believe that our conclusions will remain valid. l.434-433 This statement is too definite for my tastes. Supergenes are an observation; epistatic selection is an interpretation; there are other explanations for non-driving inversions, for example. Thanks for the comment. We modified this statement (lines 475-477) to say: “Supergenes are balanced, multigenic polymorphisms. Under the classic model of supergene evolution, epistatic selection among component loci favors the recruitment of recombination modifiers that reinforce the linkage of beneficial allelic combinations.” l.451-452 These properties are shared by non-driving inversions; it would be good to comment briefly on this commonality. We added a brief comment on this (line 490-492): “Fourth, despite rare crossovers among complementing SD-Mal haplotypes and gene conversion from wildtype chromosomes, the relative genetic isolation and low frequency of SD-Mal results in the accumulation of deleterious mutations including, especially, TE insertions.“ l.455 The likelihood of significant degeneration must depend on the size of the non-recombining region; there is reason to be sceptical of claims about it for ones that involve a small regions. We agree that the magnitude of Hill Robertson effects, and thus degeneration, are functions of the size of the region. However, here we are not discussing small regions. We hope this point is already clear in our pointing to Y chromosomes and supergene examples. Reviewer #3 (Significance (Required)): This provides a significant advance in our knowledge and understanding of the Segregation Distorter complex of Drosophila melanogaster, the classic example of a selfish chromosome. Thank you all for your constructive feedback. References: Charlesworth B, Hartl D L, 1978 Population dynamics of the segregation distorter polymorphism of Drosophila melanogaster. Genetics 89: 171–192. Temin R G, Kreber R, 1981 A look at SD (Segregation Distorter) in the wild population in Madison, Wisconsin, more than 20 years after its initial discovery there. Drosoph. Inf. Serv. 56: 137. Ghavi-Helm, Yad, et al. "Highly rearranged chromosomes reveal uncoupling between genome topology and gene expression." Nature genetics 51.8 (2019): 1272-1282. Meadows, L. A., Chan, Y. S., Roote, J., and Russell, S. (2010). Neighbourhood continuity is not required for correct testis gene expression in Drosophila. PLoS biology, 8(11), e1000552. Torosin, Nicole S., et al. 3D genome evolution and reorganization in the Drosophila melanogaster species group. PLoS genetics, 2020, vol. 16, no 12, p. E1009229. Miller, D. E., K. R. Cook, A. V. Arvanitakis and R. S. Hawley, 2016 Third Chromosome Balancer Inversions Disrupt Protein-Coding Genes and Influence Distal Recombination Events in Drosophila melanogaster. G3 (Bethesda) 6: 1959-1967.
  116 in total

1.  Theoretical genetics of Batesian mimicry II. Evolution of supergenes.

Authors:  D Charlesworth; B Charlesworth
Journal:  J Theor Biol       Date:  1975-12       Impact factor: 2.691

2.  Bounds on the minimum number of recombination events in a sample history.

Authors:  Simon R Myers; Robert C Griffiths
Journal:  Genetics       Date:  2003-01       Impact factor: 4.562

Review 3.  Transmission ratio distortion in mice.

Authors:  Mary F Lyon
Journal:  Annu Rev Genet       Date:  2003       Impact factor: 16.830

4.  Role of very slightly deleterious mutations in molecular evolution and polymorphism.

Authors:  T Ohta
Journal:  Theor Popul Biol       Date:  1976-12       Impact factor: 1.570

Review 5.  Supergenes and complex phenotypes.

Authors:  Tanja Schwander; Romain Libbrecht; Laurent Keller
Journal:  Curr Biol       Date:  2014-03-31       Impact factor: 10.834

6.  Evidence for sperm dysfunction as the mechanism of segregation distortion in Drosophila melanogaster.

Authors:  D L Hartl; Y Hiraizumi; J F Crow
Journal:  Proc Natl Acad Sci U S A       Date:  1967-12       Impact factor: 11.205

7.  Phylogenetic analysis of the alpha-globin pseudogene-4 (Hba-ps4) locus in the house mouse species complex reveals a stepwise evolution of t haplotypes.

Authors:  M F Hammer; L M Silver
Journal:  Mol Biol Evol       Date:  1993-09       Impact factor: 16.240

Review 8.  The selfish Segregation Distorter gene complex of Drosophila melanogaster.

Authors:  Amanda M Larracuente; Daven C Presgraves
Journal:  Genetics       Date:  2012-09       Impact factor: 4.562

9.  Complex History and Differentiation Patterns of the t-Haplotype, a Mouse Meiotic Driver.

Authors:  Reka K Kelemen; Beatriz Vicoso
Journal:  Genetics       Date:  2017-11-14       Impact factor: 4.562

10.  McClintock: An Integrated Pipeline for Detecting Transposable Element Insertions in Whole-Genome Shotgun Sequencing Data.

Authors:  Michael G Nelson; Raquel S Linheiro; Casey M Bergman
Journal:  G3 (Bethesda)       Date:  2017-08-07       Impact factor: 3.154

View more
  2 in total

1.  Supergene potential of a selfish centromere.

Authors:  Findley Finseth; Keely Brown; Andrew Demaree; Lila Fishman
Journal:  Philos Trans R Soc Lond B Biol Sci       Date:  2022-06-13       Impact factor: 6.671

2.  Epistatic selection on a selfish Segregation Distorter supergene - drive, recombination, and genetic load.

Authors:  Beatriz Navarro-Dominguez; Ching-Ho Chang; Cara L Brand; Christina A Muirhead; Daven C Presgraves; Amanda M Larracuente
Journal:  Elife       Date:  2022-04-29       Impact factor: 8.713

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.