Literature DB >> 35478281

Comparison of Actinobacteria communities from human-impacted and pristine karst caves.

Andrea Buresova-Faitova1,2,3, Jan Kopecky3, Marketa Sagova-Mareckova3, Lise Alonso1, Florian Vautrin1, Yvan Moënne-Loccoz1, Veronica Rodriguez-Nava1.   

Abstract

Actinobacteria are important cave inhabitants, but knowledge of how anthropization and anthropization-related visual marks affect this community on cave walls is lacking. We compared Actinobacteria communities among four French limestone caves (Mouflon, Reille, Rouffignac, and Lascaux) ranging from pristine to anthropized, and within Lascaux Cave between marked (wall visual marks) and unmarked areas in different rooms (Sas-1, Passage, Apse, and Diaclase). In addition to the 16S rRNA gene marker, 441 bp fragments of the hsp65 gene were used and an hsp65-related taxonomic database was constructed for the identification of Actinobacteria to the species level by Illumina-MiSeq analysis. The hsp65 marker revealed higher resolution for species and higher richness (99% operational taxonomic units cutoff) versus the 16S rRNA gene; however, more taxa were identified at higher taxonomic ranks. Actinobacteria communities varied between Mouflon and Reille caves (both pristine), and Rouffignac and Lascaux (both anthropized). Rouffignac displayed high diversity of Nocardia, suggesting human inputs, and Lascaux exhibited high Mycobacterium relative abundance, whereas Gaiellales were typical in pristine caves and the Diaclase (least affected area of Lascaux Cave). Within Lascaux, Pseudonocardiaceae dominated on unmarked walls and Streptomycetaceae (especially Streptomyces mirabilis) on marked walls, indicating a possible role in mark formation. A new taxonomic database  was developed. Although not all Actinobacteria species were represented, the use of the hsp65 marker enabled species-level variations of the Actinobacteria community to be documented based on the extent of anthropogenic pressure. This approach proved effective when comparing different limestone caves or specific conditions within one cave.
© 2022 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Entities:  

Keywords:  16S rRNA gene sequencing; Actinobacteria; Paleolithic cave; cave anthropization; hsp65 sequencing; metabarcoding

Mesh:

Substances:

Year:  2022        PMID: 35478281      PMCID: PMC8988830          DOI: 10.1002/mbo3.1276

Source DB:  PubMed          Journal:  Microbiologyopen        ISSN: 2045-8827            Impact factor:   3.904


INTRODUCTION

Limestone caves are isolated habitats that are extremely limited in organic carbon (Barton et al., 2007). They are associated with the development of microbial strategies that enable adaptation to oligotrophic and high calcium conditions. In addition, caves are considered to be extreme environments, as they are oligotrophic, due to the complete darkness, low and constant temperatures, and high humidity (Barton & Jurado, 2007; De Mandal et al., 2017; Ortiz et al., 2014). Some of these caves contain Paleolithic artwork and, consequently, have been frequently visited by tourists for a long time (Alonso et al., 2019; Bontemps et al., 2021; Schabereiter‐Gurtner et al., 2002). Thus, human‐mediated dispersion of endogenous as well as exogenous nutrients and microorganisms inside the caves, together with human metabolism may induce changes in internal microclimatic and microbiological conditions (Hoyos et al., 1998; Mulec, 2014). Microorganisms can be somewhat resilient to changes (Johnston et al., 2012; Tomczyk‐Żak & Zielenkiewicz, 2016). However, community shifts may also occur, which deserves attention if those shifts favor microorganisms with biodeterioration ability (F. Bastian et al., 2010; Bontemps et al., 2021; Fernandez‐Cortes et al., 2011; Sánchez‐Moral et al., 1999) or increase the proportion of species harboring strains with pathogenic potential (Bercea et al., 2019; Neral et al., 2015; Rajput et al., 2012). In such cases, these shifts could represent a threat to cave conservation and the health of visitors. Actinobacteria represent important cave dwellers, and many are potentially pathogenic (Jurado et al., 2010), biotechnologically relevant (Bhullar et al., 2012; Hamedi et al., 2019; Syiemiong & Jha, 2019), and novel (Fang et al., 2017; Jurado et al., 2008; Jurado, Kroppenstedt, et al., 2009; Rangseekaew & Pathom‐Aree, 2019) species have been identified in these environments. Actinobacteria can dominate in both anthropized (Gonzalez‐Pimentel et al., 2018) and pristine caves (De Mandal et al., 2017); however, some actinobacterial taxa are specific to one cave type. For example, the autochthonous presence of the Pseudonocardiaceae family has been reported as part of the core microbiome of pristine caves (Lavoie et al., 2017; Porca et al., 2012; Riquelme et al., 2015). However, some species, such as Pseudonocardia hispaniensis, have been detected in the moonmilk of a cave associated with urban contamination (Miller et al., 2018), and its presence may be due to its ability to degrade exogenous organic compounds (Lavoie et al., 2017; Porca et al., 2012). This is also true for the Streptomycetaceae family, which has also been identified among pristine cave inhabitants (Maciejewska et al., 2017). Furthermore, Pseudonocardiaceae and Streptomycetaceae seem to be prominent in pigment‐forming communities on the walls of certain show caves (Cuezva et al., 2012; Porca et al., 2012). In contrast, Euzebyales (Gonzalez‐Pimentel et al., 2018), Nocardiaceae (De Mandal et al., 2017), and Gaiellales (Zhu et al., 2019) represent oligotrophic taxa that dominate in pristine caves, most likely because of their ability to degrade complex compounds present in the cave, or to fix CO2. Identification of Actinobacteria taxa in these environments has been based on culture‐dependent approaches and 16S rRNA gene sequencing (De Mandal et al., 2017; Yasir, 2018). Culture‐dependent approaches limit community coverage and should, therefore, only be used as a supportive determinant to study their specialized metabolisms (Hamedi et al., 2019; Long et al., 2019). The 16S rRNA gene is the most frequently used marker for bacterial systematics; however, it is unable to resolve individual sequences to the species level (Fox et al., 1992; Hirsch et al., 2010). In addition, identical 16S rRNA gene sequences can be found in different taxa or different 16S rRNA gene sequences within a single species (Větrovský & Baldrian, 2013). However, other (protein‐coding) genes with high sequence polymorphisms used for multilocus sequence analysis (MLSA; i.e., rpoB, gyrB, and hsp65) may help distinguish closely related species from environmental DNA. Thus, they may present greater discriminative power at the species level compared with the 16S rRNA gene (Gao & Gupta, 2012; Takeda et al., 2010; Vos et al., 2012). Thus, using a metabarcoding approach, Aigle et al. (2021) utilized another gene (tpm) to evaluate the biodiversity of the bacterial community associated with the degradation of pollutants in anthropized environments at a species level. In the case of Actinobacteria, hsp65 encodes a molecular chaperone (a 65‐kDa heat‐shock protein), which, when amplified by specific primers (Telenti et al., 1993), has been used as a molecular marker to identify a large number of isolates (Rodríguez‐Nava et al., 2006, 2007). A single copy of this gene is present in Actinobacteria genomes, unlike the 16S rRNA gene marker (Colaco & MacDougall, 2014). Additionally, the length of the amplified hsp65 fragment (441 bp) is sufficient for amplicon sequencing. While this marker has been used to assess some Actinobacteria groups from environmental samples, it has mostly been used with regard to particular groups, such as Nocardia (Vautrin et al., 2021) or Mycobacterium (van der Wielen et al., 2013). Therefore, considering these features, the hsp65 gene may be a good candidate for detailed assessments of the whole Actinobacteria community in extreme environments, such as caves. To make this possible, a reference database encompassing the Actinobacteria taxonomic group is required, which should be publicly available for taxonomic identification. Since the 1960s, the Lascaux Cave has undergone several microbial outgrowth events until recently and has been subjected to (often unsuccessful) chemical treatments, which have resulted in the formation of various visual marks (including stains on walls) that have threatened the Paleolithic artwork (F. Bastian et al., 2010; Bontemps et al., 2021; Martin‐Sanchez et al., 2015). Lascaux was closed to the public in 1963 to ensure cave conservation; despite this, microbial imbalance persisted and surface alterations kept forming, leading to visual marks on wall surfaces (Bontemps et al., 2021). Although the few microbiological studies conducted in this cave have suggested that Actinobacteria is a prevalent bacterial group (Alonso et al., 2018, 2019; Martin‐Sanchez et al., 2012), a more complete investigation of the Actinobacteria community is lacking, especially at the species level. Actinobacteria possess broad metabolic variability, and key functional traits may be related to precise species within the Actinobacteria; therefore, we hypothesized that such an assessment would better discriminate Actinobacteria communities according to ecological conditions. The objective of this study was to assess the usefulness of hsp65 to complement 16S rRNA gene sequence data using a metabarcoding approach for a deeper, species‐level appraisal of the Actinobacteria community in caves, and to assess variation according to cave condition and human disturbance (Mammola, 2019). We compared communities belonging to the phylum Actinobacteria between pristine limestone caves (Reille and Mouflon Caves) and anthropized caves (Lascaux and Rouffignac Caves), and within Lascaux Cave between marked (wall visual marks) and unmarked areas in different rooms (i.e., Sas‐1, Passage, Apse, and Diaclase). The second objective was to create an hsp65‐based Actinobacteria database that is accessible to the scientific community.

MATERIALS AND METHODS

Study site description and sample collection

Samples were collected in May and June 2016 from the walls of four limestone caves located in the Dordogne department of southwestern France: Lascaux (45°03′13″N, 1°10′12″E, 235 m length), Rouffignac (45°00′31″N, 0°59′16″E, 8000 m length), Reille (45°07′09.5″N, 1°07′11.2″E, 2000 m length), and Mouflon (44°55′N, 1°5′E, 280 m length; Figure 1a).
Figure 1

 (a) Map of Dordogne area indicating the cave locations (Lascaux, Rouffignac, Reille, and Mouflon; white squares—pristine; gray squares—anthropized). (b) Map of Lascaux Cave (entrance Sas‐1, Passage, Apse, and Diaclase)

(a) Map of Dordogne area indicating the cave locations (Lascaux, Rouffignac, Reille, and Mouflon; white squares—pristine; gray squares—anthropized). (b) Map of Lascaux Cave (entrance Sas‐1, Passage, Apse, and Diaclase) Lascaux and Rouffignac Caves contain Paleolithic wall paintings and engravings and are listed as UNESCO World Heritage Sites. Both caves are anthropized; Rouffignac has been open to tourist visits since 1959 (with up to 500 visitors per day; Alonso et al., 2019), whereas Lascaux closed after 15 years of tourism (with up to 2000 visitors per day). Lascaux Cave was closed because various visual marks of microbial origin had developed on cave walls. Extensive chemical treatments have been applied to protect the wall paintings from microbial deterioration, which probably triggered further alterations (F. Bastian et al., 2010; De La Rosa et al., 2017; Martin‐Sanchez et al., 2012). Mouflon and Reille Caves remain in a pristine state (Alonso et al., 2019). The entrance of Mouflon Cave was locked shortly after discovery, whereas Reille is occasionally explored by seasoned speleologists. In Lascaux Cave, samples were taken from the walls of four distinct rooms representing different cave environments that are located progressively farther from the entrance in the following order: Sas‐1, Passage, Apse, and Diaclase (Figure 1b). Sas‐1 is a man‐made, calcareous airlock entrance, and is isolated from the cave interior and exterior by doors. The Passage is a central alley connecting different rooms of Lascaux Cave. In the Passage, samples were taken from two mineral substrates: clay deposits (Passage banks, later referred to as Passage B) and near‐vertical limestone walls (Passage inclined planes, later referred to as Passage IP). In the Apse, samples were collected from limestone inclined planes. The Diaclase is a distinct compartment located below the main part of the cave, which has been least affected by humans. It is separated from the Apse by a trap door, has received very limited biocide treatment, and was never open to tourists. Samples originated from limestone walls located immediately below the Apse, in an area of the Diaclase termed the Shaft of the Dead Man. Within each room, samples were collected from visual marks (when occurring) and unstained surfaces, as previously described (Alonso et al., 2018). Approximately 50 mg of wall material samples (3–6 replicates) were collected using sterile scalpels and placed in liquid nitrogen for transportation to the laboratory, where they were stored at −80°C until DNA extraction. Six samples from Rouffignac, six from Mouflon, five from Reille, and forty‐one from Lascaux (five from Sas‐1, six from Passage B, six from Passage IP, eighteen from Apse, and six from Diaclase) were used for subsequent metabarcoding analyses (Table A1). Sampling was performed in accordance with the cave rules and regulations.
Table A1

Location of cave samples and list of gene markers sequenced using Illumina MiSeq

Sample IDSample numberCave nameRoomAreaObtained sequences
Apse‐S1La568LascauxApse16S rRNA gene
Apse‐S2La572LascauxApseVisual mark hsp65, 16S rRNA gene
Apse‐S3La574LascauxApse hsp65, 16S rRNA gene
Apse‐U1La479LascauxApse hsp65, 16S rRNA gene
Apse‐U2La480LascauxApseUnmarked area hsp65, 16S rRNA gene
Apse‐U3La481LascauxApse hsp65, 16S rRNA gene
Apse‐DZ1La464LascauxApse16S rRNA gene
Apse‐DZ2La466LascauxApse hsp65
Apse‐DZ3La468LascauxApseVisual mark hsp65, 16S rRNA gene
Apse‐DZ4La470LascauxApse16S rRNA gene
Apse‐DZ5La472LascauxApse hsp65, 16S rRNA gene
Apse‐DZ6La474LascauxApse hsp65, 16S rRNA gene
Apse‐UDZ1La583LascauxApse16S rRNA gene
Apse‐UDZ2La584LascauxApse16S rRNA gene
Apse‐UDZ3La585LascauxApseUnmarked area hsp65, 16S rRNA gene
Apse‐UDZ4La589LascauxApse hsp65, 16S rRNA gene
Apse‐UDZ5La590LascauxApse16S rRNA gene
Apse‐UDZ6La591LascauxApse hsp65, 16S rRNA gene
Dia‐S1La440LascauxDiaclase hsp65, 16S rRNA gene
Dia‐S2La443LascauxDiaclaseVisual mark hsp65, 16S rRNA gene
Dia‐S3La444LascauxDiaclase16S rRNA gene
Dia‐U1La433LascauxDiaclase hsp65, 16S rRNA gene
Dia‐U2La434LascauxDiaclaseUnmarked area hsp65, 16S rRNA gene
Dia‐U3La435LascauxDiaclase hsp65, 16S rRNA gene
Passage B‐S1La457LascauxPassage banks hsp65, 16S rRNA gene
Passage B‐S2La458LascauxPassage banksVisual mark hsp65, 16S rRNA gene
Passage B‐S3La459LascauxPassage banks hsp65, 16S rRNA gene
Passage B‐U1La445LascauxPassage banks hsp65, 16S rRNA gene
Passage B‐U2La446LascauxPassage banksUnmarked area hsp65, 16S rRNA gene
Passage B‐U3La447LascauxPassage banks hsp65, 16S rRNA gene
Passage IP‐S1La555LascauxPassage inclined planes hsp65, 16S rRNA gene
Passage IP‐S2La556LascauxPassage inclined planesVisual mark hsp65, 16S rRNA gene
Passage IP‐S3La558LascauxPassage inclined planes hsp65, 16S rRNA gene
Passage IP‐U1La549LascauxPassage inclined planes hsp65, 16S rRNA gene
Passage IP‐U2La550LascauxPassage inclined planesUnmarked area hsp65, 16S rRNA gene
Passage IP‐U3La551LascauxPassage inclined planes16S rRNA gene
SAS‐1‐S1La530LascauxSas‐1 (airlock‐1 entrance zone, compartment 2) hsp65, 16S rRNA gene
SAS‐1‐S2La531LascauxSas‐1 (airlock‐1 entrance zone, compartment 2)Visual mark hsp65, 16S rRNA gene
SAS‐1‐S3La532LascauxSas‐1 (airlock‐1 entrance zone, compartment 2) hsp65, 16S rRNA gene
SAS‐U1La542LascauxSas‐1 (airlock‐1 entrance zone, compartment 2)Unmarked area hsp65
SAS‐U3La544LascauxSas‐1 (airlock‐1 entrance zone, compartment 2) hsp65
Rouf1Ro10Rouffignac hsp65, 16S rRNA gene
Rouf2Ro11Rouffignac hsp65
Rouf3Ro12Rouffignacxx hsp65
Rouf4Ro13Rouffignac hsp65, 16S rRNA gene
Rouf5Ro14Rouffignac hsp65, 16S rRNA gene
Rouf6Ro15Rouffignac16S rRNA gene
Mouf1Mf20Mouflon16S rRNA gene
Mouf2Mf22Mouflon hsp65, 16S rRNA gene
Mouf3Mf23Mouflonxx hsp65
Mouf4Mf24Mouflon hsp65, 16S rRNA gene
Mouf5Mf25Mouflon hsp65
Mouf6Mf26Mouflon16S rRNA gene
Reil1Re10Reille hsp65
Reil2Re11Reille16S rRNA gene
Reil3Re13Reillexx hsp65, 16S rRNA gene
Reil4Re9Reille hsp65, 16S rRNA gene
Reil5Re14Reille16S rRNA gene

DNA extraction and amplicon sequencing

DNA was extracted using the FastDNA SPIN Kit for Soil (MP Biomedicals) following the manufacturer's instructions, and adapted to the low sample size, as previously described (Alonso et al., 2018). The elution step was achieved using two volumes of 50 μl elution buffer per sample. The primers 341F (5′‐CCTACGGGNGGCWGCAG‐3′) and 805R (5′‐GACTACHVGGGTATCTAATCC‐3′), which target the V3–V4 region (428 bp fragments), were used for bacterial 16S rRNA gene amplification (Herlemann et al., 2011). The polymerase chain reaction (PCR) cycling protocol consisted of initial denaturation at 95°C for 5 min; followed by 25 cycles of denaturation (95°C for 40 s), annealing (55°C for 30 s), and extension (72°C for 1 min); and a final extension step at 72°C for 7 min. Amplification and sequencing were performed by the Fasteris company using the Illumina MiSeq Reagent Kit with V3 chemistry (600 cycles) in the paired‐end mode, resulting in 2 × 300 bp sequence reads. We used a subset of the sequences obtained by Alonso et al. (2018). The 441 bp fragments of the 65 kDa heat‐shock protein gene (hsp65) were amplified by PCR using the specific primers TB11 (5′‐ACCAACGATGGTGTGTCCAT‐3′) and TB12 (5′‐CTTGTCGAACCGCATACCCT‐3′) from Telenti et al. (1993). Amplifications were performed in a reaction mixture of 50 µl in packaged PCR tubes (PuReTaq Ready‐To‐Go PCR Beads; GE Healthcare; 2.5 U of Taq polymerase PuReTaq, 10 mM Tris–HCl [pH 9], 50 mM KCl, 1.5 mM MgCl2, and 200 µM of each deoxynucleoside triphosphate) with primers (0.2–0.4 µM, depending on the template concentration), and DNA (1–40 ng). The PCR cycling protocol consisted of initial denaturation at 94°C for 5 min, then 35 cycles of denaturation (94°C for 60 s), annealing (55°C for 60 s), and elongation (72°C for 60 s; Rodríguez‐Nava et al., 2006). Sequencing, purification, and quality control were performed by the Biofidal Company (http://www.biofidal.com) using the Illumina MiSeq Flow Cell V3 in paired‐end mode, resulting in 2 × 300 bp sequence reads. Overall, 50 and 45 samples were successfully sequenced for the 16S rRNA gene and hsp65, respectively, while sequences for both markers were obtained for only 37 samples (Table A1).

Processing and analysis of sequence data

Paired sequence reads obtained from sequencing were merged using Fast Length Adjustment of Short reads (FLASh; Magoč & Salzberg, 2011) with a maximum of 25% mismatches in the overlapping region. The sequences were then filtered and aligned using reference alignments of hsp65 gene sequences (this study) or 16S rRNA gene sequences from the Silva database V132 (Quast et al., 2012). Chimeric sequences were removed using the integrated Vsearch tool (Rognes et al., 2016) according to the MiSeq standard operating procedure (MiSeq SOP, February 2018; Kozich et al., 2013) in Mothur v1.39.5 software (Schloss et al., 2009). Sequence libraries were taxonomically assigned in Mothur using the hsp65 reference database for hsp65 sequences and the recreated SEED database subset of the Silva Small Subunit rRNA Database, release 132 (Yilmaz et al., 2014), adapted for use in Mothur (https://mothur.org/w/images/a/a4/Sylva.seed_v132.tgz), as the reference database for the 16S rRNA gene sequences. The sequences of plastids and mitochondria, and those not classified in the domain Bacteria (from the 16S rRNA gene sequence library), as well as sequences identified as homologs for hsp65 (groEL, in the database renamed as GROESL; see the hsp65 reference database design section; from the hsp65 sequence library), were discarded. The sequence library was clustered into operational taxonomic units (OTUs) using the Uparse pipeline in Usearch v10.0.240 software (OTUs at a 97% cutoff; Edgar, 2013) and Mothur (OTUs at a 99% cutoff). Two cutoffs were applied, as the 97% cutoff is used as a standard threshold for estimating bacterial diversity for the 16S rRNA gene. Therefore, it might underestimate total diversity, especially that of the hsp65 marker, which has higher variability than the 16S rRNA gene marker (see Figure 2). The tighter 99% cutoff was used for a more reliable estimation of Actinobacteria diversity at the lowest taxonomic ranks, particularly for the hsp65 marker (Chen et al., 2013). The OTU table was further processed using tools implemented in Mothur. For 16S rRNA genes, only sequences corresponding to Actinobacteria were used.
Figure 2

(a) Rarefaction curves for 37 common samples of the hsp65 and 16S rRNA genes at the 97% and 99% OTU cutoffs. The X‐axis denotes the number of samples, and the Y‐axis denotes the number of OTUs. (b) Pairwise molecular distances between sequences of the hsp65 (Y‐axes) and 16S rRNA gene (X‐axes) genes among Actinobacteria species from different taxonomical levels with the correlation coefficient (R 2) for each equation. OTU, operational taxonomic unit

(a) Rarefaction curves for 37 common samples of the hsp65 and 16S rRNA genes at the 97% and 99% OTU cutoffs. The X‐axis denotes the number of samples, and the Y‐axis denotes the number of OTUs. (b) Pairwise molecular distances between sequences of the hsp65 (Y‐axes) and 16S rRNA gene (X‐axes) genes among Actinobacteria species from different taxonomical levels with the correlation coefficient (R 2) for each equation. OTU, operational taxonomic unit To compare Actinobacteria among the caves, 25 samples for hsp65 and 24 samples for 16S rRNA genes were used (Table A1). Apse and Diaclase (using unmarked areas) were selected as representative samples for Lascaux Cave, except for the analysis of the core microbiome (i.e., common OTUs present in all caves), for which all samples from Lascaux Cave samples were included. To examine differences among locations in Lascaux Cave, 33 samples for hsp65 (16 from marked areas and 17 from unmarked areas) and 38 samples for the 16S rRNA gene (20 from marked areas and 18 samples from unmarked areas) were used (Table A1). For the 16S rRNA gene marker, samples from the Sas‐1 unmarked area were missing for the analysis, because only a low number of replicates were successfully sequenced. To obtain the highest number of replicates per sample, all samples were included in the analysis, even when they were not common to both markers. A total of 37 common samples for both markers were used to compare these markers, that is, rarefaction analysis, comparison of diversity indices, and several taxa recovered at different taxonomy ranks. Rarefaction analysis was performed to analyze the richness of the Actinobacteria OTUs based on two cutoffs (i.e., 97% and 99%) as a function of sample number. The alpha diversity indices (richness, Chao‐1; evenness, Simpson evenness; and diversity, inverse Simpson) were calculated in Mothur (97% and 99% OTU cutoff). Significant differences among samples were calculated by analysis of variance (ANOVA) with Tukey's post hoc tests (p < 0.05; for caves or locations in Lascaux Cave), Student's t‐tests, and F tests (p < 0.05; for marked/unmarked areas) in the Past 4.02 software (Hammer et al., 2001). Bray–Curtis distance matrices were calculated to describe differences in bacterial community composition among individual samples. Actinobacteria communities in the caves, in different locations of Lascaux Cave, and between marked and unmarked areas within each location were compared by nonmetric multidimensional scaling (NMDS) according to both gene markers (97% OTU cutoff). Analysis of molecular variance (AMOVA) and homogeneity of molecular variance (HOMOVA) were calculated in Mothur with 100,000 iterations for the same factors (97% OTU cutoff). Pairwise comparisons were made with the Metastats method using Fisher's exact tests (White et al., 2009), and the linear discriminant analysis (LDA) effect size (LEfSe; Segata et al., 2011) was calculated to identify the Actinobacteria OTUs that differed significantly among the respective caves, locations, and marked/unmarked areas in Lascaux Cave (99% OTU cutoffs). Metastats was also used to compare relative abundances of Streptomyces sequences among the marked/unmarked areas (hsp65 marker). Venn diagrams were created in Mothur to test the number of OTUs that encompassed the core microbiome for the different caves and rooms (i.e., Sas‐1, Passage, Apse, and Diaclase) in Lascaux Cave (99% OTU cutoff). Taxonomic classification of OTUs was performed with Mothur using the hsp65 and 16S rRNA gene SILVA V132 reference databases, and species‐level identification with the hsp65 marker was verified by BLASTN in the online databases of the National Center for Biotechnology Information (NCBI; US National Library of Medicine). In parallel, a phylogenetic analysis based on hsp65 was performed using retrieved sequences from caves belonging to most representative OTUs and those from the GenBank database after using the nucleotide BLAST (BLASTN) tool. Retrieved sequences from GenBank were those with the highest similarity with selected OTUs. Multiple alignments were generated using ClustalX (Thompson et al., 2003). MEGA6 software was used to compute the maximum likelihood of neighbor‐joining phylogenetic trees from the observed amino acid sequence divergence (%; Tamura et al., 2013). The taxonomical composition of the core microbiome was constructed using the Krona tool (Ondov et al., 2011). The number of taxa recovered with the common samples by hsp65 and 16S rRNA gene analyses at different taxonomic ranks was calculated and displayed using Venn diagrams. Co‐occurrence networks were used to predict how marked/unmarked areas and different locations influenced the relative abundance of Actinobacteria in Lascaux Cave. Spearman correlation coefficients were computed in Mothur for Lascaux Cave OTUs and were categorized based on their significantly different proportions in the marked/unmarked areas, regardless of the location in Lascaux Cave (Metastats) or for the Lascaux Cave locations (LEfSe; 99% OTU cutoff). Only significant (p < 0.03) correlations higher than 0.8/0.8 and lower than −0.35/−0.5 for the hsp65/16S rRNA gene markers were visualized in Gephi 0.9.2. (M. Bastian et al.) by Fruchterman–Reingold spatialization (Fruchterman & Reingold, 1991). The average degree, eigenvector centrality, and modularity were computed, and the minimum number of links was filtered to five (using a degree range filter). Figures were plotted using the vegan package (Oksanen et al., 2018) in the R computing environment (R Core Team, 2018) and Inkscape (v0.92; http://www.inkscape.org).

In silico analysis

Differences in the variability of the hsp65 and 16S rRNA gene partial sequences between pairs of Actinobacteria strains at different taxonomical levels (e.g., intraclass, intraorder, intrafamily, and intragenus) were determined using genomes retrieved from the Integrated Microbial Genomes and Microbiomes database (IMG, University of California, https://img.jgi.doe.gov/). For the analysis, sequences from the available genomes of 47 species from the order Streptomycetales (Streptomyces, Kitakatospora, Table A2), and 58 species from the order Corynebacteriales (family Corynebacteriaceae: Corynebacterium; family Gordoniaceae: Gordonia; family Mycobacteriaceae: Mycobacterium; family Nocardiaceae: Nocardia, Rhodococcus; Table A2) were used. Sequences were aligned and trimmed to the amplified length of both gene markers in BioEdit 7.2.5 software (Hall et al., 2011). Pairwise distances between sequences were calculated in Mothur v. 1.39.5 software (Schloss et al., 2009). Plots were created and the coefficient of determination (R 2) was calculated in Microsoft Excel (2016).
Table A2

Genomes of Actinobacteria reference strains from the orders Streptomycetales and Corynebacteriales retrieved from the Integrated Microbial Genome and Microbiome database and used for in silico analyses: comparison of the hsp65 and 16S rRNA gene partial sequences

OrderFamilyGenusSpeciesOrderFamilyGenusSpecies
CorynebacterialesCorynebacteriaceae Corynebacterium Corynebacterium ammoniagenes KCCM 40472StreptomycetalesStreptomycetaceae Streptomyces Streptomyces agglomeratus 37742
Corynebacterium atypicum R2070 Streptomyces albulus NK660
Corynebacterium aurimucosum ATCC 700975 Streptomyces albus J1074
Corynebacterium callunae DSM 20147 Streptomyces autolyticus CGMCC0516
Corynebacterium camporealensis DSM 44610 Streptomyces avermitilis MA‐4680
Corynebacterium crudilactis JZ16 Streptomyces bingchenggensis BCW‐1
Corynebacterium diphtheriae PW8 Streptomyces cattleya DSM 46488
Corynebacterium glutamicum CP Streptomyces cattleya NRRL 8057
Corynebacterium pseudotubrculosis 1002B Streptomyces clavuligerus F613‐1
Corynebacterium pseudotubrculosis MB14 Streptomyces coelicolor A3(2)
Corynebacterium ulcerans 131001 Streptomyces collinus Tu 365
Corynebacterium xerosis DSM 20743 Streptomyces flavogriseus IAF 45
Streptomyces formicae KY5
Gordoniaceae Gordonia Gordonia polyisoprenivorans VH2 DSM 44266 Streptomyces fulvissimus DSM40593
Gordonia sp. 1D Streptomyces globisporus C‐1027
Gordonia sp. KTR9 Streptomyces griseus susp. griseus NBRC13350
Gordonia sp. QH‐11 Streptomyces hygroscopicus jinggangensis 5008
Gordonia sp. YC‐JH1 Streptomyces hygroscopicus jinggangensis TL01
Gordonia terrae 3612 Streptomyces katrae S3/4
Streptomyces leewenhoekii DSM 42122
Mycobacteriaceae Mycobacterium Mycobacterium avium 2285 (R) Streptomyces lincolensis NRRL 2936
Mycobacterium avium paratuberculosis E1 Streptomyces lividans TK24
Mycobacterium bovis 1595 Streptomyces lunaelactis MM109
Mycobacterium canettii CIPT 140070008 Streptomyces lydicus A02
Mycobacterium indicus pranii MTCC 9506 Streptomyces lydicus GS93/23
Mycobacterium intracellulare 1956 Streptomyces malaysiensis DSM 4137
Mycobacterium kansasii 662 Streptomyces niveus SCSIO 3406
Mycobacterium lepraemurium Hawaii Streptomyces pactum KLBMP 5084
Mycobacterium leprae TN NC 002677 Streptomyces parvulus 2297
Mycobacterium liflandii 128FXT Streptomyces pluripotens MUSC 137
Mycobacterium marinum M Streptomyces pristinaespiralis HCCB 10218
Mycobacterium marseillense FLAC0026 Streptomyces puniciscabiei TW1S1
Mycobacterium shigaense UN‐152 Streptomyces purpureus KA281
Mycobacterium simiae MO323 Streptomyces reticuli TUE45
Mycobacterium tuberculosis 0A092DS Streptomyces sampsonii KJ40
Mycobacterium tuberculosis 26105 Streptomyces scabiei 87.22
Streptomyces sp. PAMC26508
Nocardiaceae Nocardia Nocardia brasiliensis ATCC 700358 Streptomyces sp. S10(2016)
Nocardia brasiliensis FDAARGOS 352 Streptomyces sp. SirexAA‐E
Nocardia cyriacigeorgica MDA3349 Streptomyces sp. Tu6071
Nocardia farcinica IFM 10152 Streptomyces sp. XZHG99
Nocardia nova SH22a Streptomyces venezuelae Shinobu 719
Nocardia seriolae EM150506 Streptomyces violaceusniger Tu 4113
Nocardia seriolae UTF1 Streptomyces xiamenensis 318
Nocardia terpenica NC YFY NT001 Streptomyces xiamenensis MCCC1A01550
Streptomyces xinghaiensis S187
Nocardiaceae Rhodococcus Rhodococcus aetherivorans IcdP1
Rhodococcus coprophilus NCTC 10994 Kitakatospora Kitakatospora setae KM‐6054
Rhodococcus equi 103S
Rhodococcus erythropolis CCM2595
Rhodococcus erythropolis PR4
Rhodococcus fascians D188
Rhodococcus hoagii DSSKP‐R‐001
Rhodococcus opacus B4
Rhodococcus opacus PD630
Rhodococcus pyridinivorans SB3094
Rhodococcus qingshengii djl‐6‐2
Rhodococcus rhodochrous NCTC 10210
Rhodococcus ruber P14
Rhodococcus sp. BCP1
Rhodococcus sp. RHA1

hsp65 reference database design

For taxonomic assignment using the hsp65 marker, the reference database of the Actinobacteria hsp65 gene was constructed similarly to that of the rpoB marker by (Ogier et al., 2019). Here, we built a new reference library based on the hsp65 gene encompassing both newly obtained and public sequences from the most important Actinobacteria taxa. Part of this new reference library was constructed with Nocardia and Gordonia sequences from all type strains, from strains from clinical collections (supplied by the French Observatory for Nocardiosis, OFN http://ofn.univ‐lyon1.fr), and from environmental strains (supplied by CRB‐EML http://eml‐brc.org/) sequenced by our means for which sequence quality was verified by double sense sequencing. For the Mycobacterium genus, hsp65 sequences were available via the BIBI database (https://umr5558-bibiserv.univ-lyon1.fr/lebibi/lebibi.cgi), which is fairly robust as it contains all described Mycobacterium species. The rest of the sequences was collected from the online IMG and NCBI databases using sequences homologous to the 65 kDa heat‐shock protein (hsp65) of the reference strain Nocardia asteroides ATCC 14759 (Rodríguez‐Nava et al., 2006) amplified by the TB11 and TB12 primers (Telenti et al., 1993). Paralogs of heat‐shock proteins, such as groEL genes from Escherichia coli (Colaco & MacDougall, 2014; Duchêne et al., 1994; C. M. S. Kumar et al., 2015), were identified using maximum likelihood, FastTree 2.1 (Price et al., 2010), and were retained in the reference database (renamed GROESL sequences) as an outgroup that enabled amplified sequences belonging to this variant to be discarded. This database was named “ACTIhsp65_V1.0.0.fas” and is available at https://doi.org/10.5281/zenodo.5576073 The hsp65 database contained 198 genera and 1066 unique taxa, the whole represented by 5165 sequences, of which 1782 were denoted as GROESL at the time of the analysis. TB11 and TB12 primer complementarity with sequences from the reference database was evaluated using the OligoAnalyzer 3.1 tool (http://www.idtdna.com/calc/analyzer). Percent coverage of primers for Actinobacteria genomes from different classes and orders was determined with primer BLAST using the RefSeq reference genomes (NCBI). Only targets with no mismatches for the last three nucleotides at the 3′ end and no more than four overall mismatches were included.

RESULTS

Sequence polymorphism of hsp65 versus 16S rRNA genes for cave Actinobacteria

The rarefaction curves of 16S rRNA genes for both 97% and 99% cutoffs were more tilted, indicating an accumulation of identical OTUs due to their repeated sampling, which did not increase with a stricter cutoff, in contrast to hsp65 (Figure 2a). These results are consistent with the in silico analysis of hsp65 and 16S rRNA gene partial sequences obtained from 105 genomes (47 species from the order Streptomycetales and 58 species from the order Corynebacteriales) available on IMG. Pairwise distances between hsp65 sequences, even for closely related species, were higher than those between 16S rRNA genes (Figure 2b). The hsp65 primers targeted hsp65 sequences from the reference database with lower numbers of mismatches compared with the outgroup (i.e., distant homologs renamed in the database as GROESL, GroEL of E. coli, and Chloroflexi members; Table A3). However, the primers only targeted select groups from the class Actinobacteria, as demonstrated in the analysis with representative genomes from online databases of the NCBI (US National Library of Medicine; Table A4). The number of taxa identified at class or lower taxonomic levels is shown in Figure A1. Data indicated that 20% of the classes, 32% of the orders, 36% of the families, and 25% of the genus‐level taxa detected with hsp65 were also recovered through 16S rRNA gene analysis. Although there was a trend for a higher number of taxa uniquely detected by the hsp65 marker at lower taxonomic ranks, contrary to the 16S rRNA gene marker, hsp65 sequences detected a lower number of taxa overall. However, at the species level, s 168 species were recovered with the hsp65 marker only, and the highest species numbers were found within the Streptomyces, Mycobacterium, and Nocardia genera (Table A5).
Table A3

Percentage complementarity between the hsp65‐specific forward (TB11) and reverse (TB12) primers and the hsp65 sequence database (hsp65 sequences and GROESL sequences, paralogs to hsp65) with respect to the number of mismatches

Number of mismatchesMatch to hsp65 (%)Match to GROESL (%)
Forward primer030.80
174.80
2864.2
398.156.2
499.185.4
5100100
Reverse primer06.50
144.90
289.752.1
396.364.6
410081.2
510089.6
Table A4

Percent coverage of primers to the Actinobacteria RefSeq representative genomes from NCBI of different classes and orders

ClassOrderNumber of RefSeq representative genomesPercentual primer matches
Acidimicrobiia838
Coriobacteriia6310
Nitriliruptoria50
Rubrobacteria743
Thermoleophilia714
Actinobacteria
Acidothermales10
Actinomycetales7527
Actinopolysporales8100
Bifidobacteriales8768
Catenulisporales3100
Corynebacteriales47383
Frankiales1894
Geodermatophilales34100
Glycomycetales1377
Kineosporiales580
Micrococcales48253
Micromonosporales106100
Nakamurellales520
Propionibacteriales12063
Pseudonocardiales15174
Streptomycetales34895
Streptosporangiales11288

Note: Only matches with no mismatches on the last three nucleotides of the 3′ end and no more than four overall mismatches were included.

Figure A1

Venn diagrams showing the number of different Actinobacteria taxa recovered with hsp65 (blue) or 16S rRNA gene (red) at different taxonomic ranks. (a) Class, (b) order, (c) family, and (e) genus

Table A5

The number of Actinobacteria species identified by the hsp65 marker for each respective genus

FamilyGenus (number of recovered species)
Nocardiaceae Nocardia (24) Rhodococcus (10)
Streptomycetaceae Streptomyces (30) Kitasatospora (1)
Mycobacteriaceae Mycobacterium (26)
Pseudonocardiaceae Amycolatopsis (7) Pseudonocardia (4) Lentzea (2) Actinomycetospora (1)
Kibdelosporangium (1) Thermocrispum (1) Saccharothrix (1) Alloactinosynnema (1)
Sciscionella (1) Actinoalloteichus (1) Actinokineospora (1)
Norcardioidaceae Nocardioides (6) Kribbella (2) Pimelobacter (1)
Marmoricola (1) Aeromicrobium (1)
Streptosporangiaceae Microbispora (1) Microtetraspora (1) Nonomuraea (1) Planomonospora (1)
Sinosporangium (1) Streptosporangium (1)
Micromonosporaceae Micromonospora (3) Longispora (1) Catelliglobosispora (1) Plantactinospora (1)
Intrasporangiaceae Janibacter (3) Knoellia (1)
Actinomycetaceae Actinomyces (3)
Jiangellaceae Jaingella (3)
Microbacteriaceae Agromyces (1) Microcella (1)
Propionibacteriaceae Cutibacterium (1) Propionibacterium (1)
Geodermatophilaceae Geodermatophilus (1) Modestobacter (1)
Micrococcaceae Micrococcus (1) Rothia (1)
Dermabacteraceae Brachybacterium (2)
Brevibacteriaceae Brevibacterium (2)
Corynebacteriaceae Corynebacterium (2)
Catenulisporaceae Catenulispora (1)
Dermacoccaceae Kytococcus (1)
Actinobacteria_incertae_sedis Thermobispora (1)
Nakamurellaceae Nakamurella (1)
Sporichthyaceae Sporichthya (1)
Nocardiopsaceae Thermobifida (1)
In summary, the 16S rRNA gene marker was more suited for broad taxonomic profiling of the Actinobacteria community. In comparison, the hsp65 marker could help distinguish between selected Actinobacteria species, which the 16S rRNA gene marker failed to achieve; therefore, it complemented the results obtained with the 16S rRNA gene marker (Table A5).

Actinobacteria diversity in caves based on hsp65 versus 16S rRNA genes

In the diversity analysis based on 37 common samples of both markers, the hsp65 marker recorded higher richness (Chao‐1 index) and evenness (Simpson evenness index) than the 16S rRNA gene marker when considering the 99% OTU cutoff (Table A6). The diversity analysis based on all samples indicated that Rouffignac Cave exhibited the highest Actinobacteria richness (Chao‐1 index, for the hsp65 marker; Figure A2) but lower evenness (Simpson evenness index; for both markers; Figure A2) and diversity (inverse Simpson index; for the 16S rRNA gene marker; Figure A2) among other caves. In contrast, the Lascaux and Rouffignac Caves had lower evenness than the pristine Reille (for the 16S rRNA gene marker) and Mouflon (for the hsp65 marker; Figure A2) caves. When comparing locations within Lascaux Cave, significantly higher Actinobacteria richness was detected in Sas‐1 compared with Passage B using only the 16S rRNA gene marker (Figure A2). The average diversity of the unmarked areas was higher than that of the marked areas for both markers (Figure A2).
Table A6

t and F tests to compare means and variation of diversity indices for 37 common samples of hsp65 and 16S rRNA gene markers at 97% and 99% OTUs cutoffs

t Test F test
hsp6516S rRNA t p Value F p Value
99% OTU
Chao‐1260.78 ± 137.05182.17 ± 82.022.980.0032.750.017
Simpson evenness0.29 ± 0.250.089 ± 0.054.72<0.00126.805<0.001
Inverse Simpson6.57 ± 4.9714.07 ± 6.295.66<0.0011.60.153
97% OTU
Chao‐175.74 ± 42.2689.12 ± 36.351.450.151.320.588
Simpson evenness0.38 ± 0.260.15 ± 0.114.91<0.0016.280.002
Inverse Simpson4.09 ± 2.749.11 ± 4.445.82<0.0012.640.013

Note: For each marker, averages and standard deviations are indicated.

Abbreviation: OTU, operational taxonomic unit.

Figure A2

Indices of alpha diversity (richness, Chao‐1; evenness, Simpson evenness; diversity, inverse Simpson) for Actinobacteria communities among caves, different locations within Lascaux Cave, and marked/unmarked areas. Significant differences between groups are shown with letters (ANOVA and Tukey post hoc test; p < 0.05; 97% OTU cutoff). ANOVA, analysis of variance; OTU, operational taxonomic unit

Actinobacteria community structure in caves based on hsp65 versus 16S rRNA genes

NMDS analysis was conducted to compare the Actinobacteria communities in caves (97% OTU cutoff). These communities did not differ significantly between pristine caves, Reille and Mouflon (AMOVA), based on both hsp65 and 16S rRNA genes. NMDS distinguished three groups of communities corresponding to Lascaux, Rouffignac, and the two pristine caves, Reille and Mouflon, which was further supported by AMOVA (Table A7 A). The AMOVA comparison of anthropized (Lascaux and Rouffignac) versus pristine (Reille and Mouflon) caves revealed that they significantly differed according to both markers (hsp65: F = 3.986, p < 0.001; 16S rRNA genes: F = 8.610, p < 0.001). Within Lascaux Cave, the Actinobacteria communities differed largely according to location (i.e., Sas‐1, Passage B, Passage IP, Apse, and Diaclase) with both markers, except that differences between Passage IP, Sas‐1 (both markers), and Diaclase (hsp65) were not significant due to the low number of samples (Table A7 A). Overall, the effect of surface alterations (i.e., marked vs. unmarked areas) in Lascaux Cave was significant for both markers (Table A7 A), with higher Actinobacteria homogeneity in unmarked versus marked areas (Table A7 B). Passage B presented the highest community stability compared with Passage IP, Apse, and Diaclase (Table A7 B), which was reflected in the NMDS plot, where the marked and unmarked areas in Passage IP were the least separated (Figure 3).
Table A7

Differences between Actinobacteria communities between (A) caves, (B) different locations within Lascaux Cave, and (C) marked (S) and unmarked (U) areas calculated by analysis of molecular variance (AMOVA) and homogeneity of molecular variance (HOMOVA) for the hsp65 and 16S rRNA gene markers (97% OTUs cutoff). Degrees of freedom (df), F ‐ statistics (F) and probability values (p).

CaveLascaux Cave locationSurface area
A. AMOVALascauxRouffignacReilleSas‐1Passage BPassage IPApseUnmarked
hsp 65 df F, p df F, p df F, p df F, p df F, p df F, p df F, p df F, p
Rouffignac 13 5.72***Passage B 10 7.858**Marked32 2.23**
Reille 11 3.614** 7 4.617Passage IP 9 3.978104.419**
Mouflon 12 6.265** 8 8.033* 6 4.736Apse 16 4.505***175.903***162.572***
Diaclase 9 4.518105.635** 9 2.786163.193***
Overall205.317***Overall324.279***

Abbreviation: df, degrees of freedom; F, F‐statistics; OTU, operational taxonomic unit; p, probability values.

Figure 3

Sammon projection of nonmetric multidimensional scaling (NMDS) based on the Bray–Curtis distance matrices of the hsp65 and 16S rRNA gene markers for different caves (a) and Lascaux Cave locations, and marked/unmarked areas (b). The F and p values of overall AMOVA (97% OTU cutoff) are indicated in Table A7. AMOVA, analysis of molecular variance; OTU, operational taxonomic unit

Sammon projection of nonmetric multidimensional scaling (NMDS) based on the Bray–Curtis distance matrices of the hsp65 and 16S rRNA gene markers for different caves (a) and Lascaux Cave locations, and marked/unmarked areas (b). The F and p values of overall AMOVA (97% OTU cutoff) are indicated in Table A7. AMOVA, analysis of molecular variance; OTU, operational taxonomic unit

Core and cave‐specific Actinobacteria microbiomes based on hsp65 versus 16S rRNA genes

Venn diagrams showed that the number of OTUs shared between different caves (Rouffignac, Lascaux, Mouflon, and Reille) was two (0.04%) for the hsp65 marker and 72 (11%) for the 16S rRNA gene marker (Figure A3). Similarly, the number of OTUs shared between different Lascaux rooms (Sas‐1, Passage, Apse, and Diaclase) was 23 (0.89%) for the hsp65 marker and 88 (15.9%) for the 16S rRNA gene marker. The core microbiome was mainly constituted by Pseudonocardiales and Streptomycetales, as determined by hsp65, and Gaiellales, Pseudonocardiales, and strain IMCC26256_ge, as determined by 16S rRNA genes (Figure A4).
Figure A3

Venn diagrams showing unique and shared OTUs between (a) different caves and (b) different locations within Lascaux Cave based on hsp65 and 16S rRNA gene markers (99% OTU cutoff). OTU, operational taxonomic unit

Figure A4

Taxonomic compositions of the core microbiome between (a) caves and (b) different locations within Lascaux Cave based on the hsp65 and 16S rRNA gene markers (99% OTU cutoff). OTU, operational taxonomic unit

Pairwise comparison of cave conditions (Rouffignac, Lascaux's Apse, and Diaclase, Mouflon, Reille) using significantly different OTUs (Metastats; White et al., 2009) showed that Rouffignac (based on hsp65) and Lascaux's Apse (based on 16S rRNA genes) were most enriched in OTUs, separating them from the other caves (Figure 4). Among them, Pseudonocardiaceae, Crosiella, and Nocardia were the most proportionally abundant taxa that distinguished Rouffignac (for both markers), while Nocardioides, Rhodococcus, and Pseudonocardia distinguished Lascaux's Apse from the other caves and Diaclase. Mycobacterium was uniquely found in Lascaux's Apse based on both markers. Pristine caves were typified by Streptomyces (hsp65 marker), Gaiellales, and Pseudonocardiales, and the environmental clones MB‐A2‐108_ge and IMCC26256_ge (16S rRNA genes; Figure 4).
Figure 4

Significantly different OTUs between pairs of caves (Metastats, p < 0.005). For each cave, the number of OTUs that differed proportionally from other caves and taxonomically assigned OTUs proportionally the most abundant in the respective cave is indicated (99% OTU cutoff). OTU, operational taxonomic unit

Significantly different OTUs between pairs of caves (Metastats, p < 0.005). For each cave, the number of OTUs that differed proportionally from other caves and taxonomically assigned OTUs proportionally the most abundant in the respective cave is indicated (99% OTU cutoff). OTU, operational taxonomic unit

Proportions of cave Actinobacteria in sequence libraries based on hsp65 versus 16S rRNA genes

A total of 1,799,680 hsp65 and 1,919,236 16S rRNA gene sequences were obtained, out of which 696,716 hsp65 gene sequences were mapped to 968 (97% cutoff) and 4269 (99% cutoff) OTUs, while 136,183 16S rRNA gene sequences were mapped to 299 (97% cutoff) and 718 (99% cutoff) OTUs. Within that, 696,007 hsp65 and 99,980 16S rRNA gene sequences were allocated to the Actinobacteria class, whereas 293,923 and 3803, respectively, could not be allocated to a defined order. Concerning the hsp65 gene, the Streptomyces genus was the most proportionally abundant, with 69,245 sequences representing about 9.9% of the identified Actinobacteria; however, 9283 sequences from this genus could not be affiliated to a specific species within the Streptomyces genus. The Mycobacterium and Nocardia genera were also important groups representing about 7.8% and 1.3% of the identified Actinobacteria, respectively. For the 16S rRNA gene data, the Streptomyces genus was the second most represented after Pseudonocardia, with 13,263 sequences representing about 9.7% of the identified Actinobacteria. The Mycobacterium and Nocardia genera were other important groups representing about 0.79% and 0.85% of the identified Actinobacteria, respectively. Taxonomic analysis showed that 27 families were identified by both gene markers, but five families were uniquely identified by the hsp65 marker but not by the 16S rRNA gene marker, while 40 families were identified by the 16S rRNA gene marker but not by the hsp65 marker. Families uniquely found by the hsp65 marker were Jiangellaceae, Actinobacteria incertae sedis, Brevibacteriaceae, Nocardiopsaceae, and Gordoniaceae (Figure 5).
Figure 5

Average proportions of Actinobacteria families based on hsp65 (a) and 16S rRNA gene (b) sequence libraries from different caves (Rouffignac, Lascaux, Mouflon, and Reille), Lascaux Cave locations (Sas‐1, Passage B, Passage IP, Apse, and Diaclase) and marked (S)/unmarked (U) areas within Lascaux

Average proportions of Actinobacteria families based on hsp65 (a) and 16S rRNA gene (b) sequence libraries from different caves (Rouffignac, Lascaux, Mouflon, and Reille), Lascaux Cave locations (Sas‐1, Passage B, Passage IP, Apse, and Diaclase) and marked (S)/unmarked (U) areas within Lascaux Nocardioidaceae, Streptomycetaceae, and Pseudonocardiaceae dominated the sequence libraries of both gene markers when considering all cave conditions together. On the basis of both gene markers, there was a higher proportion of Streptomycetaceae in marked areas compared with unmarked areas of Lascaux Cave (Figure 5). With a closer focus on Streptomyces using only the hsp65 marker, which can identify species or species‐like groups, an S. mirabilis‐like grouping (no more accurate association could be made and this was supported by a bootstrap of just over 60%, Figure A5), S. niveus and S. fulvissimus (bootstrap > 80%) dominated in marked areas within Lascaux Cave (Metastats p < 0.005; Figure A6). This marker could also identify other species, such as S. exfoliatus and S. albus, with good discriminatory power (supported by a high phylogenetic resolution n = 99% bootstrap) in Rouffignac. The opposite result was found for Pseudonocardiaceae, which were present in higher proportions in unmarked versus marked areas in Lascaux Cave, except for Passage IP (by hsp65) and Passage B (by 16S rRNA gene marker; Figure 5). Among the most proportionally abundant obtained OTU sequences belonging to Pseudonocardiaceae, none could be associated with a precise species. Mycobacteriaceae were found to be highly represented in Lascaux Cave, and the hsp65 marker also identified them in Mouflon. Three of the most proportionally abundant Mycobacteria species in Lascaux Cave uncovered with the hsp65 marker were M. sp., M. algericum, mainly in Passage B, and M. lentiflavum (Figure A7). Jiangellaceae was a typical group in Rouffignac and Passage IP (hsp65 marker). Closer analysis of Nocardiaceae with the hsp65 marker uncovered the greatest richness of Nocardia species in Rouffignac (including N. carnea, N. paucivorans, and N. abscessus). Moreover, high proportions of N. jejuensis were found in Lascaux and Mouflon compared with N. cummidelens in Rouffignac, Apse, and Reille (Figure A8). N. cyriacigeorgica was only found in Mouflon Cave and N. farcinica only in SAS‐1. Both pristine caves presented similar compositions of Actinobacteria communities, especially Gaiellaceae, taxa related to the environmental clones MB‐A2‐108_fa and IMCC26256_fa (16S rRNA gene marker), and high proportions of unclassified Actinobacteria (hsp65). High proportions of unclassified Actinobacteria were found in Lascaux's Diaclase, as found in the pristine caves (Figure 5).
Figure A5

Phylogenetic tree showing the taxonomic diversity and allocation of hsp65 sequences from caves retrieved by a metabarcoding approach. OTUs were used to build this figure. The evolutionary history was inferred using the neighbor‐joining method (Saitou & Nei, 1987) and reveals the relationship of sequences from caves obtained in this study with sequences belonging to type and reference strains classified within the Actinobacteria class. The tree is based on the Kimura two‐parameter method (Kimura, 1980) with the confidence values of the branches determined by bootstrap analyses (Felsenstein, 1985) based on 1000 replicates. Only values >80% are shown at the nodes. This analysis involved 116 nucleotide sequences. The scale bar represents 0.020 substitutions per nucleotide position. Evolutionary analyses were conducted in MEGA 6 (S. Kumar et al., 2018). OTU, operational taxonomic unit

Figure A6

Average proportions of species within the genus Streptomyces in the Actinobacteria hsp65 amplicon sequence libraries significantly different in marked (S) and unmarked areas (U) of Lascaux Cave (Metastats, p < 0.05).

Figure A7

Average proportions of genus Mycobacterium in the Actinobacteria hsp65 gene amplicon sequence libraries in different caves (Rouffignac, Lascaux, Mouflon, and Reille) and different locations within Lascaux Cave (Sas‐1, Passage B, Passage IP, Apse, and Diaclase).

Figure A8

Average proportions of genus Nocardia in the Actinobacteria hsp65 gene amplicon sequence libraries in different caves (Rouffignac, Lascaux, Mouflon, and Reille) and different locations within Lascaux Cave (Sas‐1, Passage B, Passage IP, Apse, and Diaclase).

The phylogenetic tree encompassing sequences of the most representative OTUs (99% cutoff) obtained in this study, together with their corresponding closest sequences obtained from GenBank is shown in Figure A5. This analysis revealed that the most proportionally abundant Mycobacterium (M. algericum and M. lentiflavum), Streptomyces (S. mirabilis‐like grouping, S. niveus and S. fulvissimus), Nocardia (N. jejuensis, N. salmonicida/cummidelens clade, N. cyriacigeorgica, and N. farcinica), and Pseudonocardia species are supported by a bootstrap >80%. Less represented species were also identified; for example, M. fluoranthenivorans, M. mucogenicum, and M. stephanolepidis/salmoniphilum clade, M. gallinarum (bootstrap > 80%), S. pratensis, and S. albus/sampsonii clade (bootstrap > 90%); and N. ninae (bootstrap = 98%). Identification of these OTUs according to the hsp65 reference database and corresponding closest sequences obtained from GenBank are listed in the Supplementary Table at https://doi.org/10.5281/zenodo.6312516.

Co‐occurrence of Actinobacteria in Lascaux Cave based on hsp65 versus 16S rRNA genes

Co‐occurrence networks revealed Spearman correlations between the relative abundances of Actinobacteria OTUs in Lascaux Cave (Figure 6), for both Lascaux locations (calculated by LEfSe; Segata et al., 2011) or marked/unmarked areas (calculated by Metastats; White et al., 2009). More co‐occurrence connections were identified for hsp65 than for the 16S rRNA gene. For the hsp65 marker, no more correlated OTUs were indicated by LEfSe or Metastats, as typical for the Lascaux locations or marked/unmarked areas, respectively. Negative correlations between the OTUs were only identified with the 16S rRNA gene marker.
Figure 6

Co‐occurrence networks of Actinobacteria OTUs: (a) hsp65 marker and (b) 16S rRNA gene marker; OTUs differed significantly between marked (black) and unmarked (white) areas in Lascaux Cave, and those that did not differ between these areas (gray) using Metastats (p < 0.05). The letters indicate OTUs that were specific for the respective Lascaux Cave locations (S, Sas‐1; PB, Passage banks; PI, Passage inclined planes; A, Apse; and D, Diaclase) using LEfSe (p < 0.03). Strong significant connections (Spearman's correlation >0.8 and <0.5 for 16S rRNA gene and <0.35 for hsp65) are displayed (99% OTU cutoff). Red lines indicate negative correlations and black lines indicate positive correlations. OTU, operational taxonomic unit

Co‐occurrence networks of Actinobacteria OTUs: (a) hsp65 marker and (b) 16S rRNA gene marker; OTUs differed significantly between marked (black) and unmarked (white) areas in Lascaux Cave, and those that did not differ between these areas (gray) using Metastats (p < 0.05). The letters indicate OTUs that were specific for the respective Lascaux Cave locations (S, Sas‐1; PB, Passage banks; PI, Passage inclined planes; A, Apse; and D, Diaclase) using LEfSe (p < 0.03). Strong significant connections (Spearman's correlation >0.8 and <0.5 for 16S rRNA gene and <0.35 for hsp65) are displayed (99% OTU cutoff). Red lines indicate negative correlations and black lines indicate positive correlations. OTU, operational taxonomic unit Clusters of correlated OTUs dominated the unmarked areas, which also differed significantly in the Apse and Diaclase based on both gene markers (Figure 6). Additionally, OTU clusters that dominated the marked areas were typical for the Diaclase and Sas‐1 areas based on the 16S rRNA gene marker. There was a correlation between OTUs from such distinct areas (Diaclase and Sas‐1), suggesting that the marked‐area factors affected the Actinobacteria communities in both locations (Figure 6). However, the hsp65 gene marker revealed that the OTU clusters typical of marked areas were not typical of any Lascaux Cave locations. Finally, based on the 16S rRNA gene marker, the highest number of correlations between OTUs that did not differ between the marked and unmarked areas was found for those that dominated in Passage B, Sas‐1, and Diaclase (Figure 6). For those OTUs, the location factor was more influential than the marked/unmarked areas. Networks based on both markers included variable actors (except for the OTUs in unmarked areas of Apse and Diaclase, regardless of marked/unmarked areas), which indicated that each marker covered different fractions of the community and their interactions.

DISCUSSION

This study represents an attempt to exploit the potential of hsp65 as a taxonomic marker to assess the whole Actinobacteria community in an extreme environment, such as caves, highlighting its advantages over the 16S rRNA gene marker. When comparing both genes, Venn results revealed higher variability for hsp65 sequences compared with Actinobacteria 16S rRNA gene sequences, and higher OTU richness (at the 99% cutoff) for Actinobacteria. Moreover, using the hsp65 marker, we found 168 species, which could not be identified in the same samples using the 16S rRNA gene marker. Therefore, the low interspecific polymorphism of 16S rRNA genes leads to an underestimation of diversity, which might be compensated for by using the hsp65 marker, as found for other protein‐coding genes, such as rpoB (Vos et al., 2012). However, a higher number of higher‐rank taxa were identified with the 16S rRNA gene compared with the hsp65 marker, which highlights gaps in the hsp65 reference database, preventing the complete taxonomic assignment of sequences. Another reason might be related to primer mismatches. Indeed, in silico analysis revealed that the primers amplified the gene from diverse Actinobacteria genomes; however, targets without perfect homology might be amplified with lower efficiency, leading to the underestimation of some taxa (Deagle et al., 2014). Overall, the data indicated that hsp65 is a suitable complement for the 16S rRNA gene marker in high‐throughput sequencing methods for Actinobacteria, especially for taxonomic analysis at the species level; however, primer bias may need to be considered for community analyses at higher taxonomic ranks. Moreover, the hsp65 reference database is biased against representation in nature, due to uneven selection of restricted taxa, especially compared with those available in online databases. The 16S rRNA gene is available to the scientific community for all species because it must be mandatorily supplied as part of the submission. However, hsp65 gene submission is not necessary when describing a new species, explaining the lack of databases. The availability of bacterial genomes is increasing and in the future, many more sequences will be added that will increase the coverage of our database, allowing for more complete detection of taxa within the Actinobacteria. In this study, the combination of hsp65 and 16S rRNA gene markers revealed that Actinobacteria diversity could vary according to anthropization in caves, on both higher (i.e., between caves) and lower (i.e., between locations within one cave) spatial scales. Indeed, the actinobacterial communities of anthropized (Lascaux and Rouffignac) and pristine caves (Reille and Mouflon) differed. The occurrence of these caves in the same region and limestone vein probably facilitated this observation, as geographic distance (Barraclough et al., 2012) and geological type (Zhu et al., 2019) are significant factors influencing cave communities. The number of Actinobacteria that could be identified as part of the core microbiome was relatively low, which suggested that different cave features can lead to different microbial communities (Alonso et al., 2019). Nevertheless, taxa belonging to this core microbiome (Pseudonocardiales, Streptomycetales, and Gaiellales) can resist anthropogenic disturbance (Shade et al., 2012). Mouflon and Reille are pristine caves with evenly distributed taxa in the Actinobacteria community, possibly as a result of their stable environments without man‐made disturbances (Mammola, 2019). Typical pristine cave taxa that were identified included Gaiellales (Zhu et al., 2019) and Actinobacteria related to the environmental clone MB‐A2‐108_ge (De, 2019; B. Zhang et al., 2019), according to the 16S rRNA gene marker. High proportions of Streptomyces and unclassified Actinobacteria based on hsp65 data suggest that each marker identifies particular Actinobacteria community members. Less anthropized areas, such as the pristine caves of Reille and Mouflon, and the Diaclase area of Lascaux, yielded a higher proportion of “Actinobacteria unclassified” when using the hsp65 gene compared with the 16S rRNA gene in the same zones. Thus, these areas host species of families whose hsp65 gene sequences are missing in our database. Species may already be described for which the hsp65 sequence is not available, or they may simply represent new and as yet undescribed species. Therefore, our database, which was conceived to reach the species level, seems to be more suitable to identify sequences derived from anthropized environments. Environmental selection in oligotrophic habitats may promote rapid molecular evolution (Kuo & Ochman, 2009; Sagova‐Mareckova et al., 2015) and result in a high number of novel species isolated from caves (De, 2019). A similar result was also found for the Streptomyces genus (Hamm et al., 2017), whose genomes may undergo a high rate of evolution (Cheng et al., 2015). For pristine caves, high proportions of Streptomyces were obtained from the Diaclase, which is an isolated compartment that has been exposed to little human impact within the anthropized Lascaux Cave. This observation seemed to confirm the hypothesis of Rangseekaew et al., who reported that, not only individual caves but also less‐exposed locations within anthropized caves maintained typical Actinobacteria cave communities, which probably include novel taxa (Rangseekaew & Pathom‐Aree, 2019). Contrary to a previous study based on the whole bacterial community (Alonso et al., 2019), high richness but low evenness was observed in the visited Rouffignac Cave compared with the pristine caves, based on hsp65 analysis. The high richness of Actinobacteria in this cave might reflect a disturbance effect, which promoted the cohabitation of ecologically different microorganisms (Galand et al., 2016). In all four caves, the most abundant Nocardia species were nonpathogenic, typically associated with caves. In Lascaux and Mouflon N. jejuensis dominated, a species that was first isolated from a natural cave, while in Reille and Rouffignac N. cummidelens dominated, a species previously isolated from rocks of visited Altamira cave (Jurado, Fernandez‐Cortes, et al., 2009). Conversely, certain opportunistic pathogenic Nocardia species were also identified. In Rouffignac, N. carnea (Boiron et al., 1992), N. paucivorans (Watanabe et al., 2006), N. testacea (Taj‐Aldeen et al., 2013), and N. abscessus complex (Kageyama et al., 2004) were identified, this latter already found in anthropized environments (Vautrin et al., 2021). Other opportunistic pathogenic species such as N. farcinica were found in SAS‐1, which is one of the most anthropized areas of Lascaux Cave. Its presence may be associated with human disturbance. The OTUs associated with this species were very close to the GenBank sequences obtained from a patient with pulmonary coinfection with M. tuberculosis (KF432743.1) and Madura foot (CP031418.1; Y. Y. Zhang et al., 2013). Other opportunistic pathogenic species of Streptomyces genera such as S. albus could also be found, at a low proportion, in Rouffignac cave, which may also be a consequence of human presence (Martín et al., 2004). However, pathogenic species were also found in pristine caves, including N. cyriacigeorgica, which is one of the most frequent Nocardia opportunistic pathogenic species in France. The finding in Mouflon represents the first detection of this species in caves. Thus, this species may belong to the autochthonous core microbiome of the caves. The OTUs associated with this species were close to the GenBank sequences obtained from patients (EF127505.1, EF127507.1, and EF127504.1) and urban sediments (VBUT00000000.1) positioned in phylogroups I and III of the N. cyriacigeorgica complex (Schlaberg et al., 2008; Vautrin et al., 2021). Our study has succeeded in positioning retrieved sequences in different phylogroups inside this complex. As shown by Zoropogui et al. (2013), the whole genome of N. cyriacigeorgica presents the acquisition of new genetic elements allowing it to thrive in multiple environments. This is confirmed by its isolation in a cave (this study), in the urban sediments of an infiltration basin (Vautrin et al., 2021), or even in humans. Its presence under different extreme environments could explain the evolution of this species into several different phylogroups, which may possess different levels of virulence. The sequences found in this cave may belong to the less virulent and most preserved phylogroups, unlike phylogroup II (the most virulent of this species), which was not identified here. Other opportunistic pathogens belonging to the Mycobacteriaceae family were also identified in Lascaux Cave. The two most proportionally abundant species, M. lentiflavum and M. algericum, are causal agents of pulmonary infections in humans (Chida et al., 2021) and animals (Sahraoui et al., 2011), respectively. In addition, the presence of these species has been reported in aquatic mediums (Makovcova et al., 2015; Moradi et al., 2019; Mrlik et al., 2012). OTUs obtained in our study that belonged to these two species were close to the GenBank sequences; one of them was obtained from Pinna nobilis (GenBank submission code MN854410.1). Thus, the presence of these species could be due to human input or the presence of water, possibly due to infiltration. This study reports the occurrence of the most frequent opportunistic pathogenic Actinobacteria in France from caves. It is unknown whether environmental strains from these species present any pathogenic potential; however, the occurrence of these species in caves suggests a possible allochthonous input by tourists. In turn, this raises potential health concerns, as previously proposed (Jurado et al., 2010), although Actinobacteria disease related to cave visitation has never been reported. In contrast, Jiangellaceae are a family typical of pristine caves (Rangseekaew & Pathom‐Aree, 2019) and are another important group in Rouffignac Cave. According to the intermediate disturbance hypothesis (Roxburgh et al., 2004), the coexistence of taxa typical of pristine or anthropized conditions in the same habitat suggests that Rouffignac Cave is under intermediate environmental pressure. The actinobacterial communities in caves were highly specific even within very short distances (Zhu et al., 2019) since each Lascaux room hosted its own Actinobacteria population. Lascaux Cave was typified by high relative abundances of Mycobacterium. Similar to Nocardia in Rouffignac, this group can signify external contamination (Jurado et al., 2010; Modra et al., 2017), although it is commonly found in natural environments (Kopecky et al., 2011). Confirming the previous results from Alonso et al. (2018), which were based on whole bacterial community analysis, the different geological substrates of Lascaux's Passage had a stronger role than the occurrence of visual marks; however, the marks had formed in the past and were stable. The effect of the geological substrate could also be observed when comparing Diaclase and Apse, because these two locations displayed different Actinobacteria communities, especially in unmarked areas, as shown by the network analysis. Relative isolation and distance from the cave entrance may represent efficient filters for alien microorganisms and enable the maintenance of the cave oligotrophic community, typical for unmarked areas (Cuezva et al., 2009; Mammola, 2019). Our results showed that the Actinobacteria community, mainly Streptomyces taxa, varied according to the presence of visual marks. Marked areas, where Streptomycetaceae dominated, exhibited much lower diversity compared with unmarked zones, where Pseudonocardiaceae were prevalent. Unfortunately, comparisons of retrieved sequences with those in public databases yield low similarity scores that do not permit species associations to be made; therefore, we cannot hypothesize whether the presence of these OTUs is due to human disturbance. Similar to our study, the group Pseudonocardiaceae has been confirmed as a true cave rock dweller (Zhu et al., 2019). Moreover, this group has been identified in pigmented zones of pristine caves (Lavoie et al., 2017). Therefore, retrieved sequences may correspond to autochthonous species of the caves. In addition, members of the group Pseudonocardiaceae degrade complex molecules (Lavoie et al., 2017; Porca et al., 2012), which suggests that the unmarked areas were not completely oligotrophic (Tomczyk‐Żak & Zielenkiewicz, 2016), perhaps as a result of past treatment with biocides. However, the higher community diversity in unmarked areas compared with marked areas suggests that cooperative relationships prevail, which is typical for oligotrophic cave environments (Tomczyk‐Żak & Zielenkiewicz, 2016). In this study, specific features of visual marks were not considered according to room location and geological substrate, as the number of replicates was not sufficient; therefore, we focused on findings obtained at the scale of all visual marks considered together. The lower diversity of marked areas might result from the competitive advantage of invading species (Hamm et al., 2017; Van Elsas et al., 2012). In isolated cave systems, invasions are mainly expected from the cave entrance, similar to Altamira Cave, where Streptomyces is the most dominant group, especially in stains (Groth et al., 1999). Our study reports the detection of S. mirabilis‐like grouping, S. fulvissimus, and S. niveus, in caves. These species, which were found in stained areas of Lascaux Cave, have not been previously reported as pathogenic, but rather as producers of secondary metabolites with antimicrobial activity, some of which are used for bioremediation (El‐Sayed, 2012; Flinspach et al., 2014; Kominek, 1972; Myronovskyi et al., 2013; Saberi‐Riseh & Moradi‐Pour, 2021; Schütze et al., 2014). Regarding S. fulvissimus and S. niveus, the OTUs belonging to these species were close to the GenBank sequences obtained from torrent muddy soil (CP071044.1), rhizosphere (CP048397.1), and deep‐sea sediment (CP018047.1). This seemed to confirm the ability of these species to survive in extreme environments away from human activity. Regarding the S. mirabilis‐like grouping, the most proportionally abundant species in Lascaux stains found in this study, OTUs were close to the GenBank sequences obtained from fresh creek bank soil (CP074102.1). The set of OTUs associated with this group is positioned in a phylogenetic clade with only 60% bootstrap, which suggests that they could represent a new taxon within Actinobacteria communities, producers of stains in Lascaux Cave. Considering the reported antimicrobial activity of S. mirabilis, we believe that the ability of this probable new taxon to produce secondary metabolites may assist, through interactions with other microorganisms, in its survival in this stained environment. Hypothetically, Streptomyces might also contribute to pigment production (Abdel‐Haliem et al., 2013; Cuezva et al., 2012), or affect the pigment‐forming fungi in Lascaux Cave (De La Rosa et al., 2017; Frey‐Klett et al., 2011) based on their ability to cooperate with fungi and promote mycelial extension and secondary metabolite production (Frey‐Klett et al., 2011). A previous study revealed the co‐occurrence of Streptomyces and pigment‐forming fungi, Acremonium and Exophiala, in Lascaux Cave, although only in unmarked areas (Alonso et al., 2018). Moreover, S. mirabilis is resistant to heavy metals (Schütze et al., 2014); this might play a role in the formation of pigmented marks since protection against toxicity of heavy metals and other chemicals has also been linked to melanin production (Nosanchuk & Casadevall, 2003). Therefore, the role of Streptomyces in the development of visual marks should be studied in more detail to evaluate whether this group may represent a missing link in our understanding of stain development in Lascaux Cave.

CONCLUSION

Despite the limitations of our database, which yielded a high number of unclassified sequences, the hsp65 gene demonstrated its utility to complement the 16S rRNA gene which cannot resolve species but encompasses a larger part of the actinobacterial community. The use of hsp65 gene allowed us to detect, with a robust bootstrap, several species not previously reported in caves, demonstrating that it can be used reliably to differentiate Actinobacteria species in such environments. We expect these limitations to be addressed with the enrollment of new Actinobacteria sequences. This can be performed periodically by requesting other public databases, such as BLAST, or by enrolling sequences of previously identified strains isolated from environmental studies. The Actinobacteria community at different spatial levels reflected the natural quality of the caves and different locations within Lascaux Cave. Anthropization was shown to shape Actinobacteria communities, which altered typical cave communities and was exhibited by the Actinobacteria indicator taxa. Even if rare opportunistic pathogens from the Actinobacteria phylum were detected in anthropized caves, it is unknown whether these detected microorganisms represent an important health risk for visitors. We also found that marked areas on the surfaces of Lascaux Cave are important for shaping Actinobacteria communities, with particular reference to Streptomyces species, whose role in the formation of visual marks requires further research. Further studies are needed to isolate the Actinobacteria taxa detected in these caves to determine the true infectious risk associated with these pathogens and their role in the pigmentation of the marked areas. A better understanding of Actinobacteria functioning in caves will be important to guide efforts in the conservation of Paleolithic cave heritage.

AUTHOR CONTRIBUTIONS

Data curation‐lead, formal analysis‐lead, investigation‐equal, methodology‐lead, and writing—original draft‐lead: Andrea Buresova. Formal analysis‐equal and software‐lead: Jan Kopecky. Investigation‐equal, validation‐equal, and writing—review and editing‐equal: Marketa Sagova‐Mareckova. Investigation‐supporting and resources‐equal: Lise Alonso. Data curation‐equal, investigation‐supporting, methodology‐supporting, and software‐supporting: Florian Vautrin. Conceptualization‐lead, funding acquisition‐lead, investigation‐equal, resources‐lead, and writing—review and editing‐equal: Yvan Moënne‐Loccoz. Conceptualization‐lead, funding acquisition‐lead, investigation‐lead, methodology‐lead, supervision‐lead, validation‐lead, and writing—review and editing‐lead: Veronica Rodriguez Nava.

CONFLICTS OF INTEREST

None declared.

ETHICS STATEMENT

None required.
  93 in total

1.  A low prevalence of mycobacteria in freshwater fish from water reservoirs, ponds and farms.

Authors:  V Mrlik; M Slany; J Kubecka; J Seda; A Necas; V Babak; I Slana; P Kriz; I Pavlik
Journal:  J Fish Dis       Date:  2012-04-26       Impact factor: 2.767

2.  Comparison of methods for the isolation of mycobacteria from water treatment plant sludge.

Authors:  Jitka Makovcova; Vladimir Babak; Michal Slany; Iva Slana
Journal:  Antonie Van Leeuwenhoek       Date:  2015-02-28       Impact factor: 2.271

3.  The fungal colonisation of rock-art caves: experimental evidence.

Authors:  Valme Jurado; Angel Fernandez-Cortes; Soledad Cuezva; Leonila Laiz; Juan Carlos Cañaveras; Sergio Sanchez-Moral; Cesareo Saiz-Jimenez
Journal:  Naturwissenschaften       Date:  2009-05-30

4.  Development of a dual-index sequencing strategy and curation pipeline for analyzing amplicon sequence data on the MiSeq Illumina sequencing platform.

Authors:  James J Kozich; Sarah L Westcott; Nielson T Baxter; Sarah K Highlander; Patrick D Schloss
Journal:  Appl Environ Microbiol       Date:  2013-06-21       Impact factor: 4.792

5.  Anthropization level of Lascaux Cave microbiome shown by regional-scale comparisons of pristine and anthropized caves.

Authors:  Lise Alonso; Thomas Pommier; Bernard Kaufmann; Audrey Dubost; David Chapulliot; Jeanne Doré; Christophe J Douady; Yvan Moënne-Loccoz
Journal:  Mol Ecol       Date:  2019-07-24       Impact factor: 6.185

6.  MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms.

Authors:  Sudhir Kumar; Glen Stecher; Michael Li; Christina Knyaz; Koichiro Tamura
Journal:  Mol Biol Evol       Date:  2018-06-01       Impact factor: 16.240

7.  Spatio-temporal variations in chemical pollutants found among urban deposits match changes in thiopurine S-methyltransferase-harboring bacteria tracked by the tpm metabarcoding approach.

Authors:  Axel Aigle; Yannick Colin; Rayan Bouchali; Emilie Bourgeois; Romain Marti; Sébastien Ribun; Laurence Marjolet; Adrien C M Pozzi; Boris Misery; Céline Colinon; Claire Bernardin-Souibgui; Laure Wiest; Didier Blaha; Wessam Galia; Benoit Cournoyer
Journal:  Sci Total Environ       Date:  2021-01-26       Impact factor: 7.963

8.  Antibiotic resistance is prevalent in an isolated cave microbiome.

Authors:  Kirandeep Bhullar; Nicholas Waglechner; Andrew Pawlowski; Kalinka Koteva; Eric D Banks; Michael D Johnston; Hazel A Barton; Gerard D Wright
Journal:  PLoS One       Date:  2012-04-11       Impact factor: 3.240

9.  Draft Genome Sequence of Streptomyces niveus NCIMB 11891, Producer of the Aminocoumarin Antibiotic Novobiocin.

Authors:  Katrin Flinspach; Christian Rückert; Jörn Kalinowski; Lutz Heide; Alexander Kristian Apel
Journal:  Genome Announc       Date:  2014-01-09

10.  Variation in Actinobacterial Community Composition and Potential Function in Different Soil Ecosystems Belonging to the Arid Heihe River Basin of Northwest China.

Authors:  Binglin Zhang; Xiukun Wu; Xisheng Tai; Likun Sun; Minghui Wu; Wei Zhang; Ximing Chen; Gaosen Zhang; Tuo Chen; Guangxiu Liu; Paul Dyson
Journal:  Front Microbiol       Date:  2019-09-24       Impact factor: 5.640

View more
  1 in total

1.  Comparison of Actinobacteria communities from human-impacted and pristine karst caves.

Authors:  Andrea Buresova-Faitova; Jan Kopecky; Marketa Sagova-Mareckova; Lise Alonso; Florian Vautrin; Yvan Moënne-Loccoz; Veronica Rodriguez-Nava
Journal:  Microbiologyopen       Date:  2022-02       Impact factor: 3.904

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.