Literature DB >> 35472218

Atypical U3 snoRNA Suppresses the Process of Pterygium Through Modulating 18S Ribosomal RNA Synthesis.

Xin Zhang1, Yaping Jiang1, Qian Wang2, Weishu An2, Xiaoyan Zhang3, Ming Xu2, Yihui Chen1.   

Abstract

Background: The progression and recurrence of pterygium mainly occur due to the abnormal proliferation and migration of stromal pterygium fibroblasts. This research explores the aberrant expression of small nucleolar RNA U3 (U3 snoRNA) in pterygium and elucidates the molecular mechanisms of U3 snoRNA in pterygium development.
Methods: Primary human conjunctival fibroblasts (HCFs) and human pterygium fibroblasts (HPFs) were separated and cultured from fresh conjunctiva grafts and pterygium tissues. The PLKO.1 lentiviral system and CRISPR/Cas9 recombinant construct were, respectively, used to overexpress and silence U3 snoRNA in HPFs and HCFs for further specific phenotype analysis. RNA-seq and TMT-labeled quantitative protein mass spectrometry were utilized to evaluate the effect of U3 snoRNA on mRNA transcripts and protein synthesis.
Results: Reduced U3 snoRNA in pterygium promotes HCF or HPF cells' proliferation, migration, and cell cycle but has no significant effect on apoptosis. U3 snoRNA modulates 18S rRNA synthesis through shearing precursor ribosomal RNA 47S rRNA at the 5' external transcribed spacer (5' ETS). Moreover, the altered U3 snoRNA causes mRNA and protein differential expression in HCF or HPF cells. Conclusions: The atypical U3 snoRNA regulates the translation of specific proteins to exert a suppressive function in pterygium through modulating the 18S rRNA synthesis. Here, we uncover a novel insight into U3 snoRNA biology in the development of pterygium.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35472218      PMCID: PMC9055567          DOI: 10.1167/iovs.63.4.17

Source DB:  PubMed          Journal:  Invest Ophthalmol Vis Sci        ISSN: 0146-0404            Impact factor:   4.925


Pterygium is a prevalent ocular surface disease that manifests as an invasion of the normal corneal epithelium by a proliferation of fibrovascular tissue on the conjunctiva, which may cause corneal flashes and severe vision loss as the disease progresses., A meta-analysis showed that the global prevalence of pterygium was 12%, with the highest majority of 53% in China. Current treatment for pterygium is mainly surgical resection; however, the recurrence rate after surgery is still high (38%–88%). Although improved surgical approaches with various adjuvant treatments have reduced the recurrence rate, recurrence persists from 3% to 40.9%. Previous studies have revealed that heredity, fibrovascular proliferation and migration, anti-apoptosis, oxidative stress, extracellular matrix remodeling, and corneal stem cell dysfunction are implicated in pterygium pathogenesis., Heredity factors, such as the genetics of P53 gene mutations, deletions,, and epigenetics (including DNA methylation modification, histone modification, and noncoding RNA regulations) are emerging as the crucial mechanisms in pterygium.– Protein synthesis is an essential process for cell growth and development. The synthesis process requires a combination of ribosomes, translation factors, and tRNAs; however, dysregulation of protein translation may lead to cancer and other diseases. In ribosome biosynthesis, precise regulation of the synthesis and assembly of its components occurs, with rRNA maturation being one of the most crucial steps. Furthermore, 18S ribosomal RNA (18S rRNA) is the main constituent of the small 40S subunit of the ribosome. In mammalian cells, rDNA is transcribed by RNA polymerase I (Pol I) to produce the human precursor rRNA (47S rRNA), which then undergoes shearing, site-specific modifications (small nucleolar RNA [snoRNA]-mediated pseudouridine [ψ] and 2′-O-methyl ribose [2′ Ome]) to process into mature 18S, 5.8S, and 28S rRNA. In addition, certain snoRNAs, such as U3, U8, and U14, are crucial in the regulation and maturation of rRNA. SnoRNA is a noncoding RNA that consists of 60 to 300 nucleotides and mainly accumulates in the nucleolus. Based on the conserved sequence elements, snoRNAs can be classified as C/D box or H/ACA box snoRNAs. C/D box snoRNAs contain two sequence motifs (C box = TGATGA and D box = CTGA) and direct 2′‐O‐methylation (2′ Ome) modifications of rRNA or snRNA., H/ACA box snoRNAs contain two sequence motifs (H box = ANANNA and ACA box = ACA) and pseudouridylates the target RNA for modification. Small nucleolar RNA U3 (U3 snoRNA), a specific C/D box snoRNA, contains box C′, B, C, and box D, is mainly involved in the maturation of 18S rRNA and the shearing of the 5′ external transcribed spacer (5′ ETS) of 47S rRNA in humans, thereby facilitating the process of ribosome biosynthesis., However, whether U3 snoRNA was involved in the pathogenesis of pterygium remains to be elucidated. Our previous studies reported that atypical U3 snoRNA (Ensembl ID: ENSG00000212195) expression in pterygium tissues was significantly lower than that in conjunctiva tissues. Therefore, in this present study, we aimed to investigate the association between decreased U3 snoRNA and the occurrence of pterygium. We verified the expression and related functions of U3 snoRNA, and highlighted the relationship among U3 snoRNA and rRNA, ribosome synthesis, and protein translation in the development of pterygium.

Materials and Methods

Specimen Collection

In total, 23 patients with pterygium (mean age = 55.9 ± 6 years) were included in this study and were observed in the Ophthalmology Department of Yangpu Hospital, Tongji University. All patients were diagnosed with grade III or higher pterygium and underwent pterygium excision and autologous conjunctiva transplantation. The criteria for grading the severity of pterygium were as described in previous studies. Pterygium tissues and a small piece of normal conjunctiva tissue from an autograft at the contralateral corneal limbus were surgically obtained from one patient. Patients with other ocular diseases and/or those who underwent ophthalmic surgery were excluded from the study. This study was approved by the ethical committee of Yangpu Hospital, Tongji University, and conducted according to the principles of the Declaration of Helsinki. Written informed consent was obtained from all patients, and the surgically resected specimens were appropriately processed or preserved for quantitative reverse transcription PCR (RT-qPCR), primary cell culture, and in situ hybridization. The clinical information from 23 patients with pterygium was summarized in Supplementary Table S1.

Prepare Primary Human Conjunctival Fibroblasts and Pterygium Fibroblasts

All surgically removed fresh tissues were washed thrice with phosphate-buffered saline (PBS) and cut into small pieces (1–2 mm in diameter) under an ophthalmic microscope. Tissue blocks were incubated with Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12) medium supplemented with 10% fetal bovine serum, 100 U/mL penicillin, and 100 mg /mL streptomycin (materials originated from Gibco Life Technologies, Shanghai, China) in an incubator (37°C and 5% CO2). After 3 to 4 days of culture, fibroblasts migrated out from the edge of the explants and exhibited a typical spindle-shaped morphology. The medium was changed thrice per week after cell growth appeared in the explants. Moreover, when a sufficient number of fibroblasts were obtained around each explant, the passaged cultures were digested with trypsin-ethylenediaminetetraacetic acid (EDTA; 0.25%; Gibco Life Technologies, Shanghai, China) at 37°C and 5% CO2 for 3 to 4 minutes (the digestion time of cell passages was approximately 2 minutes). Cells from the third to the seventh generation were used for the experiments described in this report.

Plasmids

The pLKO.1 vector with puromycin resistance (SHC001; Sigma-Aldrich) was selected for lentivirus-mediated overexpression U3 snoRNA. The nested PCR amplified the full-length sequence of overexpressed U3 snoRNA. The complete U3 snoRNA was amplified using two pairs of PCR primers; U3 snoRNA-F1: TGTGTGAGTTTCTTTCGCATG and U3 snoRNA-R1: ACTACTCAGACTGCCTTCTC, U3 snoRNA-F2: TGGAAAGGACGAAACACCGGTAAGACTATATTTTGAGGGA, and U3 snoRNA-R2: CTCGAGGTCGAGAATTCACTACTCAGACTGCCTTCTC. The plasmid pSpCas9(BB)-2A-GFP (PX458), a gift from Feng Zhang (#48138; Addgene), was used for silencing endogenous U3 snoRNA. Briefly, two small guide RNAs (sgRNAs), with the sequence of TATCTGAACGTGTAGAACGC or TGACCGTTCTTCTCTAGAGA, were inserted into the Bbs I sites in pSpCas9(BB)-2A-GFP. The two recombinant plasmids containing specific sgRNA were co-transfected into human conjunctival fibroblasts (HCFs) by Lipofectamine 3000 Transfection Reagent (L3000015; Thermo Fisher Scientific, Waltham, MA, USA). After 36 hours, the strongly GFP-positive cells were screened by flow sorting and cultured for subsequent experiments. We meant to perform CRISPR to knockout U3 snoRNA in primary cultured human conjunctival fibroblasts; however, we failed to amplify individual positive cells for further investigations. Therefore, all the GFP-positive cells were collected and cultured with a similar effect to RNAi, termed CRISPRi in this work.

Antibodies

Antibodies Bax (#5023), Bcl2 (#4223), D-type cyclins D1 (cyclin D1, #55506), D-type cyclins D3 (cyclin D3, #2936), cyclin-dependent kinase 4 (CDK4, #12790), cyclin-dependent kinase 6 (CDK6, #13331), P21 (# 2947), proliferating cell nuclear antigen (PCNA, #2586), and β-actin (#58169) were from Cell Signaling Technology. Antibody Ki67 (sc-23900) was from Santa Cruz Biotechnology.

Immunofluorescence

HCFs and human pterygium fibroblasts (HPFs) were fixed in 4% paraformaldehyde (P0099, Beyotime, Peking, China), permeabilized with 0.5% Triton X-100 (T9284; Sigma-Aldrich, PBS-Tween dilution), and blocked with 5% bovine serum albumin (BSA; Sigma-Aldrich) for 30 minutes at room temperature. After washing thrice with PBS, primary antibodies against vimentin (Santa Cruz Biotechnology; 1:150, cat. no. SC6260) and cytokeratin (Santa Cruz Biotechnology; 1:150, cat. no. SC58719) were diluted with 1% BSA and blocked overnight at 4°C. After that, the samples were washed thrice with PBS and incubated with Alexa Fluor 488-labeled and 568-labeled secondary antibodies (A12379 and A11011; Thermo Fisher Scientific) at 1:200 dilutions for 2 hours at room temperature and protected from light. Next, the nuclei were labeled with 4′, 6-diamidino-2-phenylindole for 15 minutes, and the samples were washed thrice with PBS. Eventually, images were captured under a fluorescence microscope (Olympus, Tokyo, Japan).

Quantitative Reverse Transcription-PCR

According to the manufacturer's instructions, total RNA was isolated from 16 pterygium tissues and paired with normal conjunctiva tissues. The RNA quantity and quality were measured using NanoDrop 2000 (Thermo Fisher Scientific). RNA integrity was assessed using standard denaturing agarose gel electrophoresis. According to the manufacturer's protocol, total RNA was reverse transcribed to cDNA using a PrimeScript RT reagent kit with gDNA Eraser (RR047A; TaKaRa, Japan). The StepOnePlus real-time PCR detection system (Thermo Fisher Scientific) analyzed the RNA transcript levels. All samples were normalized to U6. The primers used for RT-qPCR are listed in Supplementary Table S2.

Wound Healing Assay

In this assay, 2 × 105 cells/well of HPFs overexpressing U3 snoRNA and HCFs knocking down U3 snoRNA were seeded into a 6-well plate. When the cells reached confluence, we performed serum-free starvation culture for 8 hours, and the monolayer was scratched and washed with PBS, followed by serum-free DMEM/F12. After that, the images were captured at 0, 24, and 48 hours after scratching. The scratch area was calculated using the ImageJ software (National Institutes of Health, Bethesda, MD, USA). The 24 hour scratch area ratio to the 0 hour scratch area was compared between the control and experimental groups.

Western Blotting

Cells were washed thrice with ice-cold PBS and lysed for 1 minute with 1.5% SDS lysis buffer (10 mM Tris-HCl [pH 7.4], 2 mM EDTA, and 1.5% SDS) supplemented with 1 mM phenylmethanesulfonyl fluoride (PMSF; ST505; Beyotime, Peking, China). After that, the cells were scraped off and collected into 1.5 mL EP tubes, sonicated, and incubated in a metal bath at 100°C for 10 minutes. The supernatant was collected via centrifugation at 12,000 rpm for 15 minutes, and the proteins were quantified using a BCA Protein Quantification Kit (P0012;, Beyotime). Equal amounts of protein were sampled and separated by SDS-PAGE and then transferred onto PVDF membranes (Millipore, Darmstadt, Germany). After incubation with specific antibodies, the signals of the detected proteins were visualized with enhanced chemiluminescence (Millipore, MA, USA) and captured using the ChemiDoc imaging system (BioRad, Hercules, CA, USA).

In Situ Hybridization

Three pairs of fresh conjunctiva and pterygium tissues were sliced after paraffin embedding. The slides were deparaffinized with xylene and gradient ethanol and washed with DEPC water. After digestion with protein K (20 ug/mL) at 37°C for 20 to 30 minutes, the slides were incubated for 1 hour in a pre-hybridized solution and hybridized with digoxigenin (DIG)-labeled U3 snoRNA probes at 37°C in a thermostat overnight. After hybridization, mouse anti-digoxigenin-labeled alkaline phosphatase (anti-DIG-AP) was added dropwise. Eventually, nitro blue tetrazolium chloride monohydrate (NBT) and nuclear solid red were used for staining. The sections were then sealed for image acquisition and analysis.

Data Analysis

All RT-qPCR experiments were set in triplicate and performed at least three times, and other presented experiments were performed at least three times. Statistical analyses were performed using the SPSS software (version 25.0., Cary, NC, USA) and GraphPad Prism software 7.0 (GraphPad Software, San Diego, CA, USA). The data were analyzed for normal distribution before the statistical analysis. Values are presented as mean ± standard deviation (SD). The student's t-test was used for normally distributed data, and nonparametric tests were used for abnormal distributions. Statistical significance was set at P < 0.05. Statistical significance is indicated as follows: *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

Results

U3 snoRNA Expression is Decreased in Pterygium

In our previous transcriptional profiling studies, we identified a series of genes and pathways in pterygium and found that several interesting noncoding RNAs were differentially expressed between conjunctiva and pterygium tissues. Therefore, we extracted and analyzed the data on these noncoding RNAs. We found that U3 snoRNA was the most variable of these noncoding RNAs, with a log2fold change ([log2FC] = −4.33, P < 0.0001), and was expressed much less in the pterygium tissues (Figs. 1A, 1B). The 26 differentially expressed noncoding RNAs are listed in Table 1. Moreover, we quantified U3 snoRNA levels and examined the localization of U3 snoRNA in the pterygium and normal conjunctiva tissues via in situ hybridization (ISH). It was observed that U3 snoRNA expression in pterygium tissues was markedly suppressed than that in normal conjunctiva tissues (Fig. 1C). The results of ISH and IHC showed that U3 snoRNA and proliferation-associated indicator Ki67 exhibited opposite expression trends, and ISH also revealed U3 snoRNA was mainly expressed in stromal fibroblasts and basal epithelial cells (Fig. 1D). Therefore, we suggest that reduced U3 snoRNA in pterygium tissues may be associated with pterygium development.
Figure 1.

U3 snoRNA expression is decreased in pterygium. (A) Heatmap of 26 differentially expressed noncoding RNAs in pterygium transcriptomics analysis (C: conjunctiva, n = 10; P: pterygium, n = 8). (B) U3 snoRNA is the most significantly differentially expressed of 26 noncoding RNAs. (C) Expression of U3 snoRNA was measured via RT-qPCR in 16 pairs of normal conjunctiva and pterygium tissues (n = 16). (D) in situ hybridization revealed the distribution and differential expression of U3 snoRNA in normal conjunctiva and pterygium tissues, and immunohistochemical staining showed the expression of Ki67 in normal conjunctiva and pterygium tissues (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

Table 1.

Transcriptomics Analysis of 26 Differentially Expressed Noncoding RNAs

Gene IDGene NameSymbolTypeBase Meanlog2Fold ChangeRegulation P Value P adj
ENSG00000230733AC092171.2lncRNANA4.8724140643.44120253up0.000004870.001145538
ENSG00000233237LINC00472lncRNANA3.7454253832.425835622up0.0008206230.042689045
ENSG00000237973MTCO1P12Unprocessed pseudogeneNA22.734793561.908951494up0.0006453730.036565528
ENSG00000255438AL354813.1lncRNANA10.27624542.196738839up0.00001790.00293655
ENSG00000275431AC244100.2lncRNANA4.5469100023.249354381up0.00001010.00187793
ENSG00000275684AL353644.5Novel miRNANA70.198807381.907936744up0.0008094330.042683752
ENSG00000279117AP001972.5TECNA4.6713281222.052222096up0.0004193970.028701683
ENSG00000279196AC135048.4TECNA6.2062930122.206597952up0.0004603060.030160806
ENSG00000279759AC118344.2TECNA7.4057208131.762637902up0.0003707590.026553234
ENSG00000281344HELLPARlncRNANA7.5891275052.987183413up0.0000006390.000228769
ENSG00000212195U3snoRNANA3.228619073-4.332995704down0.00004290.005795848
ENSG00000218281H2AC9PUnprocessed pseudogeneNA1.964733629-4.259420698down0.0006651380.03714885
ENSG00000224032EPB41L4A-AS1lncRNANA26.53611127-1.503206452down0.00003320.004819844
ENSG00000224769MUC20P1Unprocessed pseudogeneNA21.47735097-1.733404298down0.00003510.005001856
ENSG00000228417AL360182.2lncRNANA5.821310348-2.067415875down0.0000980.01093765
ENSG00000229732AC019349.1lncRNANA892.2293645-1.541518886down0.0000005710.000219712
ENSG00000233052AL513304.1lncRNANA8.35074879-2.419424699down0.000979870.046712191
ENSG00000245904AC025164.1lncRNANA80.63110854-1.322286854down0.0000001050.0000559
ENSG00000259768AC004943.2lncRNANA13.98243126-1.131414533down0.0004291590.029239779
ENSG00000261602AC092115.2lncRNANA9.913991879-1.657078691down0.0006221940.035967922
ENSG00000272734ADIRF-AS1lncRNANA34.47461863-2.230443225down0.00001690.002835918
ENSG00000274210RNVU1-27snRNANA5.70071146-3.204406227down0.0001229240.012703289
ENSG00000275719AC008622.2lncRNANA18.91827156-1.911216119down8.87E-080.0000506
ENSG00000276216AC245014.3lncRNANA2.823985747-2.940035781down0.0008605620.043969192
ENSG00000276402AL353644.8Novel miRNANA207.3666711-1.737381313down0.00001280.002338795
ENSG00000277145AL592188.7Novel miRNANA6621.40686-2.028523189down0.0004065260.028179096
U3 snoRNA expression is decreased in pterygium. (A) Heatmap of 26 differentially expressed noncoding RNAs in pterygium transcriptomics analysis (C: conjunctiva, n = 10; P: pterygium, n = 8). (B) U3 snoRNA is the most significantly differentially expressed of 26 noncoding RNAs. (C) Expression of U3 snoRNA was measured via RT-qPCR in 16 pairs of normal conjunctiva and pterygium tissues (n = 16). (D) in situ hybridization revealed the distribution and differential expression of U3 snoRNA in normal conjunctiva and pterygium tissues, and immunohistochemical staining showed the expression of Ki67 in normal conjunctiva and pterygium tissues (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001. Transcriptomics Analysis of 26 Differentially Expressed Noncoding RNAs

The Primary HPFs and HCFs Were Successfully Separated, Identified, and Compared on the U3 snoRNA Expression

To understand the expression and functional mechanism of U3 snoRNA in cells, we conducted primary cultures of HCFs and HPFs, and details are depicted in Figure 2A. To characterize the cultured HCFs and HPFs, we detected the expression of vimentin-positive and cytokeratin-negative in fibroblasts by the immunofluorescence staining. HeLa cells were set as the control cells of the epithelium with positive cytokeratin staining (Fig. 2B). According to the RT-qPCR analysis, U3 snoRNA expression was significantly lower in HPFs than HCFs, consistent with that in tissues (Fig. 2C). As reported, specific cytokines and UV light can induce the occurrence and development of pterygium. We exposed the HCFs to the different intensities of UV light (100, 200 mJ/cm2) and concentrations of TGF-β (10, 20, 40 ng/ml) to examine the expression alteration of U3 snoRNA. Surprisingly, U3 snoRNA was significantly downregulated in the HCFs subjected to UV light or TGF-β treatment compared with untreated HCF cells (Fig. 2D). Together, we successfully separated and validated the primary cells of HPF and HCF, which could be used further to investigate the biological function of U3 snoRNA in pterygium.
Figure 2.

The primary HPFs and HCFs were successfully separated, identified, and compared on the U3 snoRNA expression. (A) Flow chart of primary cell culture. (B) Immunofluorescence of cytokeratin and vimentin expression in HCFs and HPFs (HeLa cells were set as the control cells of the epithelium with positive cytokeratin staining). (C) Expression of U3 snoRNA in four pairs of HCFs and HPFs were detected via RT-qPCR (n = 4). (D) The expression of U3 snoRNA in different doses of UV light (100, 200 mJ/cm2) and TGF-β (10, 20, 40 ng/ml) induced HCFs was examined via RT-qPCR. *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

The primary HPFs and HCFs were successfully separated, identified, and compared on the U3 snoRNA expression. (A) Flow chart of primary cell culture. (B) Immunofluorescence of cytokeratin and vimentin expression in HCFs and HPFs (HeLa cells were set as the control cells of the epithelium with positive cytokeratin staining). (C) Expression of U3 snoRNA in four pairs of HCFs and HPFs were detected via RT-qPCR (n = 4). (D) The expression of U3 snoRNA in different doses of UV light (100, 200 mJ/cm2) and TGF-β (10, 20, 40 ng/ml) induced HCFs was examined via RT-qPCR. *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

U3 snoRNA Suppresses the Proliferation and Migration of HPF Cells

To explore the biological function of U3 snoRNA in HCFs and HPFs, we overexpressed U3 snoRNA in the HPF cells using the PLKO.1 lentiviral system and silenced U3 snoRNA in HCF cells using the CRISPR/Cas9 system (Figs. 3A, 3B). Increased U3 snoRNA significantly inhibited the capabilities of HPF cell proliferation (Fig. 3C) and migration (Fig. 3E). In contrast, U3 snoRNA-knocking down in HCFs promoted the relevant cell phenotypes (Figs. 3D, 3F). In addition, the expression of proliferating cell nuclear antigen (PCNA) yielded consistent outcomes that U3 snoRNA could suppress the cell proliferation in pterygium according to the western-blot analysis (Supplementary Fig. S1A). These results indicated that U3 snoRNA is involved in developing pterygium, at least in cell growth and cell mobility.
Figure 3.

U3 snoRNA suppresses the proliferation and migration of HPFs. (A, B) Efficacy of overexpression and knocking down of U3 snoRNA by RT-qPCR. (C, D) CCK8 assays depicted that the overexpression or knocking down of U3 snoRNA inhibited or promoted cell proliferation, respectively. (E, F) Cell scratching revealed that the overexpression and knocking down of U3 snoRNA inhibited and promoted cell migration, respectively. *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

U3 snoRNA suppresses the proliferation and migration of HPFs. (A, B) Efficacy of overexpression and knocking down of U3 snoRNA by RT-qPCR. (C, D) CCK8 assays depicted that the overexpression or knocking down of U3 snoRNA inhibited or promoted cell proliferation, respectively. (E, F) Cell scratching revealed that the overexpression and knocking down of U3 snoRNA inhibited and promoted cell migration, respectively. *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

U3 snoRNA Mainly Causes G0/G1 Phase Arrest, But Not Apoptosis in HPF Cells

To assess whether U3 snoRNA-associated cell proliferation is related to apoptosis, we analyzed the apoptosis ability of HPF cells with or without U3 snoRNA expression by the flow cytometric method. Unfortunately, no significant variation (sum of early apoptosis and late apoptosis cells) was observed in normal or UV-treated HPF cells upon U3 snoRNA expression (Figs. 4A, 4B). However, overexpressed U3 snoRNA in HPFs or silenced U3 snoRNA in HCFs respectively arrested or facilitated the cell cycle in the G0/G1 phase (Figs. 4C, 4D), which is supposed to be closely associated with the cell proliferation capability. To confirm that, Western blot detection of apoptosis- and cell cycle-related proteins in the HPFs overexpressing U3 snoRNA and HCFs knocking down U3 snoRNA supported the flow-cytometric analysis (Figs. 4E–H). Taken together, we suggest that decreased U3 snoRNA in pterygium may enhance the development of pterygium by arresting the G0/G1 phase, which further enhances the cell proliferation ability of fibroblast cells.
Figure 4.

U3 snoRNA mainly causes G0/G1 phase arrest, but not apoptosis in HPFs. (A) Flow analysis revealed that the overexpression of U3 snoRNA did not affect apoptosis (LR + UR). (B) Flow analysis depicted that the overexpression of U3 snoRNA also did not affect apoptosis after UV induction (LR + UR). (C) HPFs overexpressing U3 snoRNA were blocked in G0/G1 phase. (D) HCFs knocking down U3 snoRNA facilitated the progression of HCFs from G0/G1 phase to S and G2/M phases. (E, F) The expression levels of apoptosis-related proteins (Bax, Bcl2, CDK4, CDK6, Cyclin D1, Cyclin D3, and P21) were determined by Western blotting and the corresponding densitometric analysis results (G, H). *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

U3 snoRNA mainly causes G0/G1 phase arrest, but not apoptosis in HPFs. (A) Flow analysis revealed that the overexpression of U3 snoRNA did not affect apoptosis (LR + UR). (B) Flow analysis depicted that the overexpression of U3 snoRNA also did not affect apoptosis after UV induction (LR + UR). (C) HPFs overexpressing U3 snoRNA were blocked in G0/G1 phase. (D) HCFs knocking down U3 snoRNA facilitated the progression of HCFs from G0/G1 phase to S and G2/M phases. (E, F) The expression levels of apoptosis-related proteins (Bax, Bcl2, CDK4, CDK6, Cyclin D1, Cyclin D3, and P21) were determined by Western blotting and the corresponding densitometric analysis results (G, H). *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

U3 snoRNA Involves in the 47S rRNA Shearing and Maturation of 18S rRNA

Numerous studies have reported that U3 snoRNA is associated with the shearing of precursor rRNA (47S rRNA) and the synthesis of 18S rRNA., Therefore, we performed a comprehensive analysis of the location, structure, and interaction sites of U3 snoRNA with 18S rRNA. The target U3 snoRNA is located in the intron of the host gene TEX14 on chromosome 17 (Fig. 5A). Compared with human U3 (X14945, M14061, and AF020531) in Rfam (http://rfam.xfam.org/), we found that the atypical U3 snoRNA was presented with the differential base clusters, termed C′ (AGGAAGA [typical] vs. AGAGGGA [atypical]), B (GAGCGTGAAG [typical] vs. GAGTGGGATA [atypical]), C box (TGATGA [typical] vs TGGTGA [atypical]; Fig. 5B). The secondary structure was plotted based on ENSG00000212195 in Ensembl (https://asia.ensembl.org/index.html; Fig. 5C). The complementary base pairing between U3 snoRNA and the 5′ ETS and 18S rRNA in 47S rRNA was determined by the CLUSTALW tool (https://www.genome.jp/tools-bin/clustalw). A high degree of base complementary pairing was found at the four positions (i.e. positions 3 to 21, 23 to 27, 39 to 48, and 63 to 72 in U3 snoRNA, respectively; Fig. 5D). To identify the variations of 47S rRNA upon U3 snoRNA expression status in pterygium cells, we first plotted the model of precursor rRNA (47S rRNA) shearing into mature 18S rRNA, 28S rRNA, and 5.8S rRNA (Fig. 5E, upper panel)., A serious of distinctive primers were designed to detect 5′ ETS and mature 18S rRNA, 28S rRNA, and 5.8S rRNA (Primers F′ + R′ for 47S rRNA detection, F1 + R1 for 47S and 45S rRNA, F18p + R18p, F28p + R28p, and F5.8p + R5.8p for pre-18S, -28S, and -5.8S rRNA, and F18 + R18, F28 + R28, and F5.8 + R5.8 for total 18S, 28S, and 5.8S rRNA; Fig. 5E, lower panel). By RT-qPCR analysis, we found that A′ and A0 were significantly downregulated in HPFs overexpressing U3 snoRNA and significantly increased in HCFs with silenced U3 snoRNA, suggesting that altered U3 snoRNA can cause 5′ ETS shearing of 47S rRNA (Fig. 5F). Meanwhile, 18S rRNA maturing was accelerated in HPFs overexpressing U3 snoRNA while delayed in HCFs with silenced U3 snoRNA (Fig. 5G). In addition, the generation of mature 28S was correspondingly accelerated with the enhanced shearing of mature 18S and vice versa (see Fig. 5G). Taken together, atypical U3 snoRNA in pterygium participates in the 47S rRNA shearing and 18S rRNA maturation, and even 28S rRNA generation.
Figure 5.

U3 snoRNA involves in the 47S rRNA shearing and maturation of 18S rRNA. (A) Host gene of U3 snoRNA in TEX14 gene on chromosome 17. (B) Determination of the structure of our atypical U3 snoRNA box through available U3 snoRNA (including three U3 snoRNAs [X14945, M14061, and AF020531]) in Rfam (version 14.7) and the SNORD3A reported in the study as homology-based. (C) Spatial secondary structure of U3 snoRNA based on the structure on Ensembl. (D) Action site of atypical U3 snoRNA with precursor rRNA 47S rRNA. (E) Processing and primer design for precursor rRNA 47S rRNA and 18S rRNA, 28S rRNA, 5.8S rRNA. (F) Overexpression and knocking down of U3 snoRNA inhibited and promoted A′ and A0 in 5′ ETS, respectively. (G) Overexpression and knocking down of U3 snoRNA increased or decreased the maturity of 18S rRNA, respectively, even 28S rRNA generation (T_18S, T_28S, and T_5.8S represent total_18S, total_28S, and total_5.8S, respectively; M_18S, M_28S, and M_5.8S represent mature_18S, mature_28S, and mature_5.8S, respectively). *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

U3 snoRNA involves in the 47S rRNA shearing and maturation of 18S rRNA. (A) Host gene of U3 snoRNA in TEX14 gene on chromosome 17. (B) Determination of the structure of our atypical U3 snoRNA box through available U3 snoRNA (including three U3 snoRNAs [X14945, M14061, and AF020531]) in Rfam (version 14.7) and the SNORD3A reported in the study as homology-based. (C) Spatial secondary structure of U3 snoRNA based on the structure on Ensembl. (D) Action site of atypical U3 snoRNA with precursor rRNA 47S rRNA. (E) Processing and primer design for precursor rRNA 47S rRNA and 18S rRNA, 28S rRNA, 5.8S rRNA. (F) Overexpression and knocking down of U3 snoRNA inhibited and promoted A′ and A0 in 5′ ETS, respectively. (G) Overexpression and knocking down of U3 snoRNA increased or decreased the maturity of 18S rRNA, respectively, even 28S rRNA generation (T_18S, T_28S, and T_5.8S represent total_18S, total_28S, and total_5.8S, respectively; M_18S, M_28S, and M_5.8S represent mature_18S, mature_28S, and mature_5.8S, respectively). *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

U3 snoRNA Mainly Affects the Proteome Profile by Regulating the Ribosome Function in Pterygium

Because 18S rRNA and 28S RNA are the critical components of the ribosome, we performed mass spectrometry analysis to assess the biological significance of U3 snoRNA in pterygium. The differentially expressed proteins in HPF overexpressing U3 snoRNA or in HCFs with silenced U3 snoRNA were enriched and plotted as the Heatmaps compared to the proper control, respectively (Figs. 6A, 6B). The gene ontology (GO) analysis revealed that differentially expressed proteins are mainly involved in the single-organism process and biological regulation in both HPFs overexpressing U3 snoRNA and HCFs with silenced U3 snoRNA (Fig. 6C). After crossing analysis of two mass spectrometry datasets, we obtained eight potential proteins that may closely relate to the U3 snoRNA regulated translation process (Fig. 6D). To identify whether U3 snoRNA affects the transcription of genes, we performed RNA-seq for transcriptomic analysis in HPFs overexpressing U3 snoRNA, and only 30 differentially expressed genes were found (upregulated 19 genes and downregulated 11 genes; Fig. 6E). GO and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses revealed that differentially expressed genes were mainly enriched in growth and rhythmic processes (Supplementary Fig. S1B), involved in Wnt, cellular junctions, or proteoglycan signaling pathway (Fig. 6F). In addition, we did not find the mRNA expression change of any of the eight U3 snoRNA-associated proteins (Table 2). These implicated that the alteration of the protein caused by U3 snoRNA probably, to a larger extent, due to the ribosome function but not the mRNA transcription. Together, U3 snoRNA in pterygium mainly affects the proteome profile in pterygium through shearing the 5′ ETS of 47S rRNA to promote 18S rRNA synthesis and ribosome function, which could be a novel mechanism of pterygium formation and growth (Fig. 7).
Figure 6.

U3 snoRNA mainly affects the proteome profile by regulating the ribosome function in pterygium. (A) Heatmap of clustering depicting differentially expressed proteins in proteomic analysis of HPF overexpressing U3 snoRNA. (B) Heatmap of clustering presenting differentially expressed proteins in proteomic analysis of HCFs with knocked down U3 snoRNA. (C) Gene ontology (GO) process analysis of differential proteins in proteomic analysis of HPFs overexpressing U3 snoRNA and HCFs knocking down U3 snoRNA (biological processes section). (D) Venn diagram analysis of common differentially expressed proteins in HPFs overexpressing U3 snoRNA and HCFs knocking down U3 snoRNA. (E) Heatmap of differentially expressed genes in the transcriptomic analysis of HPF overexpressing U3 snoRNA in transcriptomics analysis. (F) Top 10 significantly enriched pathways of differential proteins in the transcriptomic analysis of HPFs overexpressing U3 snoRNA.

Table 2.

The mRNA Expression of the Eight Co-DEPs in HPFs Overexpressing U3 snoRNA and HCFs With Knocking Down U3 snoRNA

IDGeneCtrlCtrlU3_plko.1_1U3_plko.1_2P valueControl AverageOE AverageOE/Control
ENSG00000118855MFSD133.50884931.85382731.71444132.273860.513932.68133831.7841340.972546901
ENSG00000078043PIAS27.125164.4285626.7312346.4531670.60865.7768615.5798980.96590484
ENSG00000166634SERPINB120000NA00NA
ENSG00000184012TMPRSS20000NA00NA
ENSG00000087128TMPRSS11E0000NA00NA
ENSG00000137648TMPRSS40000NA00NA
ENSG00000187045TMPRSS60.0114410.04330800.0213370.47550.02737450.0216540.791028147
ENSG00000160183TMPRSS30000NA00NA
ENSG00000186452TMPRSS120000NA00NA
ENSG00000154646TMPRSS150000NA00NA
ENSG00000198092TMPRSS11F0000NA00NA
ENSG00000137747TMPRSS130000NA00NA
ENSG00000185873TMPRSS11B0000NA00NA
ENSG00000178297TMPRSS90.0945590.0661130.1518840.1394890.00020.0803360.10899851.356782762
ENSG00000187054TMPRSS11A0000NA00NA
ENSG00000176040TMPRSS70.0114080000.42260.00570400
ENSG00000166682TMPRSS50.0812290.0568450.08106300.570.0690370.0689540.998797746
ENSG00000153802TMPRSS11D0.0193860000.42260.00969300
ENSG00000156508EEF1A15390.2874025796.6133323801.6604016020.481630.60675593.4503674799.1368670.857992214
ENSG00000185127C6orf12016.18861814.09715516.06605114.5669540.90515.142886515.0816030.995952984

NA, not applicable.

Figure 7.

Graphic Abstract. U3 snoRNA functions on binding to the 5′ ETS and 18S rRNA in the precursor rRNA (47S rRNA) and promotes 18S rRNA maturation. U3 snoRNA involves in 40S ribosome function and ensures protein translation and synthesis. Once U3 snoRNA is suppressed in normal conjunctival fibroblasts or epidermal cells will lead to a delay of 18S rRNA maturation, ribosomal function deficiency, and aberrant protein synthesis, which may cause cell proliferation and migration changes, promoting the development of pterygium.

U3 snoRNA mainly affects the proteome profile by regulating the ribosome function in pterygium. (A) Heatmap of clustering depicting differentially expressed proteins in proteomic analysis of HPF overexpressing U3 snoRNA. (B) Heatmap of clustering presenting differentially expressed proteins in proteomic analysis of HCFs with knocked down U3 snoRNA. (C) Gene ontology (GO) process analysis of differential proteins in proteomic analysis of HPFs overexpressing U3 snoRNA and HCFs knocking down U3 snoRNA (biological processes section). (D) Venn diagram analysis of common differentially expressed proteins in HPFs overexpressing U3 snoRNA and HCFs knocking down U3 snoRNA. (E) Heatmap of differentially expressed genes in the transcriptomic analysis of HPF overexpressing U3 snoRNA in transcriptomics analysis. (F) Top 10 significantly enriched pathways of differential proteins in the transcriptomic analysis of HPFs overexpressing U3 snoRNA. The mRNA Expression of the Eight Co-DEPs in HPFs Overexpressing U3 snoRNA and HCFs With Knocking Down U3 snoRNA NA, not applicable. Graphic Abstract. U3 snoRNA functions on binding to the 5′ ETS and 18S rRNA in the precursor rRNA (47S rRNA) and promotes 18S rRNA maturation. U3 snoRNA involves in 40S ribosome function and ensures protein translation and synthesis. Once U3 snoRNA is suppressed in normal conjunctival fibroblasts or epidermal cells will lead to a delay of 18S rRNA maturation, ribosomal function deficiency, and aberrant protein synthesis, which may cause cell proliferation and migration changes, promoting the development of pterygium.

Discussion

Pterygium is a multifactorial disease. Chronic UV exposure is the predominant factor in pterygium development. In addition, chronic inflammation and some ocular surface diseases (e.g. xerophthalmia) are also involved., These environmental or self-induced factors can lead to conjunctival pathological changes, such as fibrosis, chronic inflammation, and extracellular matrix (ECM) remodeling., Moreover, previous studies have shown that the recurrence of pterygium mainly stems from excessive proliferation of fibroblasts. Therefore, we isolated and cultured the primary fibroblasts from patients for the functional observation of U3 snoRNA in pterygium development (see Figs. 2A–C). To identify the separated HPF or HCF cells, we found that U3 snoRNA was indeed significantly downregulated in HCFs subjected to UV irradiation and TGF-β treatment (Fig. 2D), which facilitated the investigation on the relationship between U3 snoRNA and the general etiology of pterygium. Epigenetics is relevant to ocular diseases,, and noncoding RNA regulation, including microRNAs, lncRNAs, and circRNAs, have been extensively studied in pterygium; however, studies on the mechanism of action of snoRNAs in pterygium development have not been reported. The snoRNAs, as a member of noncoding RNAs, are primarily involved in directing post-transcriptional modifications of rRNA and snRNA, and U3 snoRNA is a specific C/D box snoRNA, that involved in rRNA processing.– When base-paired with pre-rRNA, this hairpin (folded from 5′ end of the U3 snoRNA) opens and interacts with different 5′ ETS and/or 18S rRNA, guiding the 5′ ETS shearing in human 47S rRNA (35S rRNA in yeast) and the maturation of 18S rRNA to mediate ribosome synthesis. Shearing of the 5′ ETS is the most initial and critical step in rRNA maturation. The 5′ ETS in human precursor rRNA consists of three shearing sites, A′, A0, and A1, in which A′ is the first to be sheared (see Fig. 5E, upper panel). Consistent with our study, we found that the sites in 5′ ETS where atypical U3 snoRNA (C′, B, and C boxes are differing from boxes of Rfam's U3 snoRNA) binds are all located within the A′ region (approximately -3654 bp to -3230 bp) and trigger 18S rRNA maturing (see Figs. 5E–G). Suppressed U3 snoRNA in pterygium attenuates the 5′ ETS shearing of 47S rRNA, which results in the maturation disorder of 18S rRNA, and even 28S rRNA (see Fig. 1 and Figs. 5F, 5G), thereby causing the deficiency of ribosome function to induce pterygium cell formation, proliferation, and migration (see Fig. 3). Considering that, we analyzed the proteomic profile induced by U3 snoRNA regulation, and several interesting proteins were greeted (see Figs. 6A–D). Among them, the major facilitator superfamily domain containing 1 (MFSD1) is supposed to be the most relative to the U3 snoRNA regulation in pterygium because of the close correspondence between U3 snoRNA expression and ribosome synthesis. MFSD1 is a transporter protein that belongs to the major facilitator superfamily (MFS) and mainly mediates intestinal nutrient absorption, renal and hepatic clearance, metabolite transportation, causing severe liver disease, and average nutritional intake. However, the biological functions of MFSD1 in pterygium development still need to be further illustrated. In addition to protein spectrum analysis, we also investigated whether U3 snoRNA affects the alteration of the transcriptome in pterygium cells, but we only found that a minimal number of gene transcription may be associated with U3 snoRNA and mainly involved in the Wnt signaling pathway (see Figs. 6E, 6F), which can cause cell epithelial-mesenchymal transition (EMT) and cell migration and is also essential for pterygium development. More intriguingly, the gene transcripts of the screened differential proteins did not change significantly (see Table 2). Therefore, we speculated that the altered mRNA levels might result from specific protein actions. However, we do not exclude the potential function of U3 snoRNA in gene regulation in the development of pterygium.

Conclusion

We report that suppressed U3 snoRNA in the pterygium promotes pterygium cell growth, proliferation, migration, and even cell cycle arrest. In the mechanism, U3 snoRNA in pterygium can bind to 5′ ETS of 47S rRNA and participate in the shearing of 5′ ETS in precursor rRNA (47S rRNA) and thereby the 18S rRNA maturation, which mainly causes protein alteration through affecting ribosome biosynthesis (see Fig. 7). This work reveals the functions and mechanisms of U3 snoRNA in developing pterygium. It explains how U3 snoRNA regulates ocular surface tissue homeostasis through epigenetic evolution, which provides a novel biology insight into pterygium and suggests potential perspective targets for pterygium precision therapy. However, we need to address the challenge that U3 snoRNA is mainly located in the nucleolus, which is hard for drug developing and targeting. Thus, we need to explore a deeper regulatory mechanism of U3 snoRNA to obtain a feasible target for therapy.

Data Availability

The RNA-seq and mass spectrum datasets supporting this study's findings have been deposited in the Gene Expression Omnibus (GEO) under the number GSE193086 and the ProteomeXchange with identifier PXD030801, respectively.
  53 in total

Review 1.  Pathogenesis of pterygia: role of cytokines, growth factors, and matrix metalloproteinases.

Authors:  Nick Di Girolamo; Jeanie Chui; Minas T Coroneo; Denis Wakefield
Journal:  Prog Retin Eye Res       Date:  2004-03       Impact factor: 21.198

Review 2.  Noncoding RNAs in eukaryotic ribosome biogenesis and function.

Authors:  Denis L J Lafontaine
Journal:  Nat Struct Mol Biol       Date:  2015-01       Impact factor: 15.369

Review 3.  Eukaryotic Ribosome Assembly.

Authors:  Jochen Baßler; Ed Hurt
Journal:  Annu Rev Biochem       Date:  2018-12-19       Impact factor: 23.643

4.  Rrb1p, a yeast nuclear WD-repeat protein involved in the regulation of ribosome biosynthesis.

Authors:  T L Iouk; J D Aitchison; S Maguire; R W Wozniak
Journal:  Mol Cell Biol       Date:  2001-02       Impact factor: 4.272

Review 5.  The cell cycle in stem cell proliferation, pluripotency and differentiation.

Authors:  Lijun Liu; Wojciech Michowski; Aleksandra Kolodziejczyk; Piotr Sicinski
Journal:  Nat Cell Biol       Date:  2019-09-02       Impact factor: 28.824

Review 6.  Eukaryotic ribosome assembly, transport and quality control.

Authors:  Cohue Peña; Ed Hurt; Vikram Govind Panse
Journal:  Nat Struct Mol Biol       Date:  2017-09-07       Impact factor: 15.369

Review 7.  Prevalence and risk factors of pterygium: a systematic review and meta-analysis.

Authors:  Farhad Rezvan; Mehdi Khabazkhoob; Elham Hooshmand; Abbasali Yekta; Mohammad Saatchi; Hassan Hashemi
Journal:  Surv Ophthalmol       Date:  2018-03-16       Impact factor: 6.048

8.  UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly.

Authors:  Mirjam Hunziker; Jonas Barandun; Elisabeth Petfalski; Dongyan Tan; Clémentine Delan-Forino; Kelly R Molloy; Kelly H Kim; Hywel Dunn-Davies; Yi Shi; Malik Chaker-Margot; Brian T Chait; Thomas Walz; David Tollervey; Sebastian Klinge
Journal:  Nat Commun       Date:  2016-06-29       Impact factor: 14.919

Review 9.  Epigenetics in the Eye: An Overview of the Most Relevant Ocular Diseases.

Authors:  Hanan A Alkozi; Rafael Franco; Jesús J Pintor
Journal:  Front Genet       Date:  2017-10-12       Impact factor: 4.599

10.  MiR-199a-3p/5p participated in TGF-β and EGF induced EMT by targeting DUSP5/MAP3K11 in pterygium.

Authors:  Siying He; Yifang Huang; Shiqi Dong; Chen Qiao; Guohua Yang; Shuai Zhang; Chen Wang; Yuting Xu; Fang Zheng; Ming Yan
Journal:  J Transl Med       Date:  2020-09-01       Impact factor: 5.531

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.