| Literature DB >> 35463822 |
Marjan Khorsand1,2, Zohreh Mostafavi-Pour1,3,4, Vahid Razban5,6,4, Sahar Khajeh7, Razieh Zare1.
Abstract
The epithelial-to-mesenchymal transition (EMT) is a unique process resulting in enhanced cell motility, invasiveness, and metastasis in cancer. The EMT is regulated by several transcription factors, including Snail and Slug, which exert crucial roles during cancer progression. We have studied the effects of Docetaxel as the first-line chemotherapy agent for prostate cancer, and Telmisartan as an anti-hypertensive drug on the expression level of Snail and Slug. In addition, the effects of Docetaxel, Telmisartan and their combination on cancer cell proliferation were investigated. The PC3, DU145, MDA-MB468, and HEK cell lines were used for this study. Quantitative RT-PCR analysis and MTT assay were used to study the expression of Snail and Slug level and cell proliferative assay, respectively. We found that a combination of Docetaxel + Telmisartan effectively inhibits the cell proliferation in cancerous cells in comparison with each drug alone (P<0.05). Furthermore, in these cell lines, Docetaxel, Telmisartan and their combination significantly diminished the expression level of Snail and Slug genes compared to control cells (P<0.001), however, in the HEK cell line, this effect was seen only in the combination group. Our data imply that Telmisartan and its combination with Docetaxel exert strong inhibitory effects on the expression level of Snail and Slug genes. Also, these drugs and their combination could inhibit cancer cell proliferation. In conclusion, the combination of Telmisartan and Docetaxel has the potential to suppress the metastasis of prostate and breast cancer cells.Entities:
Keywords: Cancer; Combination index; EMT; Slug; Snail
Year: 2022 PMID: 35463822 PMCID: PMC9012430 DOI: 10.22099/mbrc.2022.42638.1700
Source DB: PubMed Journal: Mol Biol Res Commun ISSN: 2322-181X
List of primers were used for Real-time PCR
|
|
|
|
|---|---|---|
| Glucuronidase Beta (GUSB) | F: TCGCTCACACCAAATCCTT | 205 bp |
| Snail | F: CCTGCGTCTGCGGAACCTG | 163 bp |
| Slug | F: AAGGACACATTAGAACTCACA | 198 bp |
Data summary of dose-effect curves and Chou-Talalay method parameters of drug combinations against prostate cancer cell lines, MDA-MB468, and HEK cell lines after 48 h treatment period
|
|
|
|
|
| |
|---|---|---|---|---|---|
|
| 0.46 | 0.08 | 17.8 | 36.6 | |
| 0.61 | 0.5 | 3.09 | 5.4 | ||
|
| 0.39 | 0.001 | 1248.8 | 1444.4 | |
| 0.47 | 0.09 | 11.9 | 121.3 | ||
| 0.54 | 0.11 | 8.8 | 577 | ||
|
| 0.43 | 0.018 | 260 | 66.3 | |
| 0.45 | 0.038 | 270 | 28.7 | ||
| 0.55 | 0.31 | 10 | 4.6 | ||
|
| 0.55 | 0.002 | 401 | 197346 | |
| 0.65 | 0.09 | 10.7 | 37446 | ||
| 0.7 | 0.33 | 2.9 | 22071 | ||
Fa; Fraction inhibition, CI; Combination index, DRI; Dose-Reduction Index.
Figure 1The effect of combination treatment with DTX and Tel on Snail mRNA expression in cancer cell lines (PC3, DU145, MDA-MB468) and HEK cell line. The graph shows the percentage of relative expression of Snail gene in the treated groups to compare with the control (mean ± standard deviation, n=6). DTX; Docetaxel, Tel; Telmisartan
Figure 2The effect of combination treatment with DTX and Tel on Slug mRNA expression in cancer cell lines (PC3, DU145, MDA-MB468) and HEK cell line. The graph shows the percentage of relative expression of Slug gene in the treated groups to compare with the control (mean ± standard deviation, n=6). DTX; Docetaxel, Tel; Telmisartan