Literature DB >> 35462794

PEM-seq comprehensively quantifies DNA repair outcomes during gene-editing and DSB repair.

Yang Liu1, Jianhang Yin1, Tingting Gan1, Mengzhu Liu1, Changchang Xin1, Weiwei Zhang1, Jiazhi Hu1.   

Abstract

The repair products of double-stranded DNA breaks (DSBs) are crucial for investigating the mechanism underlying DNA damage repair as well as evaluating the safety and efficiency of gene-editing; however, a comprehensively quantitative assay remains to be established. Here, we describe the step-by-step instructions of the primer extension-mediated sequencing (PEM-seq), followed by the framework of data processing and statistical analysis. PEM-seq presents a full spectrum of repair outcomes for both genome-editing-induced and endogenous DSBs in mouse and human cells. For complete details on the use and execution of this profile, please refer to Gan et al. (2021), Yin et al. (2019), Liu et al. (2021a), and Zhang et al. (2021).
© 2021 The Author(s).

Entities:  

Keywords:  Bioinformatics; CRISPR; High Throughput Screening; Molecular Biology; Sequence analysis; Sequencing

Mesh:

Year:  2022        PMID: 35462794      PMCID: PMC9019705          DOI: 10.1016/j.xpro.2021.101088

Source DB:  PubMed          Journal:  STAR Protoc        ISSN: 2666-1667


Before you begin

Double-stranded DNA breaks (DSBs) are intrinsic to DNA metabolism processes, including DNA replication (Liu et al., 2021b; Tubbs et al., 2018), transcription (Liu et al., 2021a; Meng et al., 2014), DNA damage repair (Tubbs and Nussenzweig, 2017), V(D)J recombination (Hu et al., 2015), and antibody class switch recombination (Dong et al., 2015). Besides, the emerging nuclease-mediated genome editing also induces DSBs, including FokI domain-containing nucleases, transcription activator-like effector nucleases (TALENs), and clustered regularly interspaced palindromic repeats (CRISPR)-Cas (Li et al., 2020). DSBs are sealed by two main DSB repair pathways in mammalian cells, homologous recombination (HR) and non-homologous end joining (NHEJ) (Figure 1A). Although alternative end joining (a-EJ), including microhomology-mediated end joining (MMEJ), is discovered when NHEJ is deficient, it also participates in DSB repair in the presence of NHEJ and HR (Figure 1A). These DSB repair pathways are triggered under different scenarios and generate diverse repair outcomes that are mirrors of both DSBs and involved repair process(es) (Liu et al., 2021a). For instance, the repair of a single DSB would lead to perfect re-joinings, small indels, microhomology-mediated deletions, and large deletions (Figure 1A). While the repair of multiple DSBs induce not only the above mentioned products but also large deletions and intra- or inter-chromosomal translocations (Figure 1A). Regarding genome editing, large deletions and translocations usually are unwanted editing products. With these regards, a quantitative assay to profile a full spectrum of repair outcomes is urgently demanded to study DSB repair pathway(s) and evaluate the efficiency and safety of gene-editing tools (Saha et al., 2021).
Figure 1

The design and experimental procedure of PEM-seq

(A) DSB repair pathways and repair outcomes. A DSB formed at the designed site, termed bait DSB, is mainly repaired by two types of repair processes, which are characterized by the end resection or not. With ends resection, bait DSB will be repaired by 1) the homologous recombination (HR) to form an error-free product that is identical to the reference sequence of bait DSB, termed perfect re-joining, 2) microhomology-mediated end joining (MMEJ) inducing microhomology (MH)-mediated deletions, or 3) non-homologous end joining (NHEJ) producing large deletions if 3′-overhang at the resected ends are removed and DNA ends are ligated. Without end resection, bait DSB will be re-joined by NHEJ to form perfect re-joining and small insertion or deletions (indels). When another DSB (prey DSB) is formed simultaneously with the bait DSB, they may join together and form intra- or inter-chromosomal translocations. The orange boxes are microhomology around the bait DSB.

(B) Procedures for the preparation of PEM-seq library and following analysis. With one round primer extension of a biotinylated primer and the following on-beads ligation with the barcoded bridge adapter, PEM-seq captures and quantifies multiple types of DSB repair outcomes at the bait DSB and genome-wide translocations. The major steps of PEM-seq are shown on the left; the right panel highlights indicated operations. Green boxes, with yellow-shadow background, show the bio-primer targeted regions. RMB, random molecular barcode.

The design and experimental procedure of PEM-seq (A) DSB repair pathways and repair outcomes. A DSB formed at the designed site, termed bait DSB, is mainly repaired by two types of repair processes, which are characterized by the end resection or not. With ends resection, bait DSB will be repaired by 1) the homologous recombination (HR) to form an error-free product that is identical to the reference sequence of bait DSB, termed perfect re-joining, 2) microhomology-mediated end joining (MMEJ) inducing microhomology (MH)-mediated deletions, or 3) non-homologous end joining (NHEJ) producing large deletions if 3′-overhang at the resected ends are removed and DNA ends are ligated. Without end resection, bait DSB will be re-joined by NHEJ to form perfect re-joining and small insertion or deletions (indels). When another DSB (prey DSB) is formed simultaneously with the bait DSB, they may join together and form intra- or inter-chromosomal translocations. The orange boxes are microhomology around the bait DSB. (B) Procedures for the preparation of PEM-seq library and following analysis. With one round primer extension of a biotinylated primer and the following on-beads ligation with the barcoded bridge adapter, PEM-seq captures and quantifies multiple types of DSB repair outcomes at the bait DSB and genome-wide translocations. The major steps of PEM-seq are shown on the left; the right panel highlights indicated operations. Green boxes, with yellow-shadow background, show the bio-primer targeted regions. RMB, random molecular barcode. To capture and quantify the DSB repair outcomes, we developed the primer extension-mediated sequencing (PEM-seq) by using primer-extension amplification and introducing random molecular barcode (RMB) (Liu et al., 2021a; Yin et al., 2019). As shown in Figure 1B, the procedure starts with the generation of DSB at the target site, followed by a limited duration to allow the formation of DSB repair products (Step 1). Extracted genomic DNA (Step 2) is sheared to 300–700 bp fragments by sonication (Step 3). All products containing the complementary sequence of the biotinylated primer are then amplified by a one-round primer extension (Step 4). After removal of exceeded biotinylated primer (Step 5), biotin-labeled ssDNA is enriched by streptavidin C1 beads (Step 6) and ligated with a bridge adapter containing a 14-bp RMB (Step 7). Adapter-ligated ssDNA fragments are subjected to nested PCR (Step 8), size selection (Step 9), amplification with indexed Illumina primers (Step 10), size selection again (Step 11), and finally are sequenced by Hi-seq with 2×150 bp reads (Step 12). PEM-Q is applied to data processing and statistical analysis (Step 13) (Liu et al., 2021a). PEM-seq can be used to determine the editing efficiency, off-target sites, and unwanted products of genome editing (Yin et al., 2019; Zhang et al., 2021). In addition, PEM-seq can also be applied to interrogate the DSB level, endogenous DSB hotspots, DSB repair pathway choice, and the underlying molecular mechanism (Liu et al., 2021a). Though couples of high-throughput sequencing approaches have been developed to evaluate the efficiency or off-target activity of gene-editing tools, including LAM-HTGTS, GUIDE-seq, DISCOVER-seq, CIRCLE-seq, SITE-seq, Digenome-seq, BLESS, etc., which have been well-reviewed elsewhere (Hu et al., 2016; Kim et al., 2019). However, PEM-seq is the only one that quantitively profiles a full spectrum of repair outcomes. Here, we provide a step-by-step protocol for PEM-seq, based on our earlier publications (Gan et al., 2021; Liu et al., 2021a; Yin et al., 2019; Zhang et al., 2021). The protocol described below depicts the specific steps for using HEK-293T cells. However, we have also successfully applied this protocol in human primary T cells, cancer cell lines (HeLa, MRC-5, K562, etc.), and mouse abelson virus-transformed pro-B, CH12F3, and mouse embryonic stem cells (mESCs). Before initiating the experiment, the audience should select a desired DSB site, termed the bait DSB, and design primers for PEM-seq.

Bait DSB selection

PEM-seq depends on the use of recurrent DSB as bait DSB to achieve the best performance. If there is a recurrent DSB site in your experiments, such as V(D)J recombination loci in lymphocytes, antibody class-switch recombination loci in B cells, or genome editing target sites, please skip this section and start to design primers for PEM-seq analysis. If not, the audience should introduce a bait DSB into the cell. PEM-seq is compatible with multiple types of DSB, including blunt ends, sticky ends, ends with adducts, hairpin, and nick transformed DSBs (Figure 2A). Therefore, the bait DSB can also be generated by a broad scope of enzymes, such as AsiSI, I-SceI, RAG, AID, transposons (e.g., Cre), and genome editing tools, e.g., FokI domain-containing nucleases, TALENs, and CRISPR-Cas. Typically, we use CRISPR-SpCas9 to introduce the bait DSB at the c-Myc locus in mouse and human cells, which are provided in Table 1.
Figure 2

Principles for PEM-seq analysis

(A) PEM-seq is compatible with multiple types of bait and prey DSBs. Left: different types of bait DSBs, including blunt or sticky ends, ends with adducts, hairpin, nick-transformed DSB, etc., that can be analyzed by PEM-seq. Right: both off-target dependent and independent DSBs can be captured and analyzed by PEM-seq.

(B) Principles for the primer design. Generally, the distance from the start site of the nested primer to the cleavage site ranges from 50 to 110 bp, termed bait length, and the optimized distance between biotinylated primer (bio-primer) and nested primer is 10–50 bp.

(C) Definition of the repair products in PEM-Q. Events located in the ±500 kb of bait DSB are grouped into insertions or deletions, and events out of the ±500 kb of bait DSB are translocations.

Table 1

Bait DSBs for PEM-seq analysis

The red bases show the protospacer adjacent motif (PAM) sequences of indicated sgRNA.

Principles for PEM-seq analysis (A) PEM-seq is compatible with multiple types of bait and prey DSBs. Left: different types of bait DSBs, including blunt or sticky ends, ends with adducts, hairpin, nick-transformed DSB, etc., that can be analyzed by PEM-seq. Right: both off-target dependent and independent DSBs can be captured and analyzed by PEM-seq. (B) Principles for the primer design. Generally, the distance from the start site of the nested primer to the cleavage site ranges from 50 to 110 bp, termed bait length, and the optimized distance between biotinylated primer (bio-primer) and nested primer is 10–50 bp. (C) Definition of the repair products in PEM-Q. Events located in the ±500 kb of bait DSB are grouped into insertions or deletions, and events out of the ±500 kb of bait DSB are translocations. Bait DSBs for PEM-seq analysis The red bases show the protospacer adjacent motif (PAM) sequences of indicated sgRNA.

Primer design

For each bait DSB, at least two primers are required, including one biotinylated primer for the one-round primer extension and a second primer for the nested PCR. The two primers should be anchored on the same side of the bait DSB, either upstream or downstream, with nested primer in proximity to the cleavage site (Figure 2B). Genomic DNA is sonicated to 300–700 bp to generate PEM-seq libraries, which are sequenced with a read length at 2 × 150 bp. Moreover, each R1 read shares an identical sequence, termed bait sequence, which is the same sequence from the nested primer to the bait cleavage site (Figure 2B). Hence, to achieve the best performance, the bait length between the nested primer and bait cleavage site should be 50–110 bp and the flanking length between the biotinylated and nested primer is best at 10–50 bp (Figure 2B). Of note, both the two primers and bait sequence should avoid any potential repetitive regions. Regarding multiple PEM-seq libraries with the same bait DSB, we recommend user-defined barcode sequences to be included at the 5′ of the nested primer (Exampled in Table 2). Finally, the universal primers for PEM-seq should also be synthesized before initiating the experiment, including bridge adapters, I7-index, P5-I5, and P7-tag (Listed in Table 2). Of note, primers with or without modification(s) should be purified by HPLC (High-Performance Liquid Chromatography) or PAGE (Polyacrylamide gel electrophoresis), respectively, when ordering.
Table 2

DNA sequences for PEM-seq analysis

1. The orange bases with underline are the random molecular barcode (RMB) sequences on the bridge adapter. 2. The red and blue bases show the index on the I5-Nested and I7-Index primer, respectively. 3. The bold characters mark the primer sequences for primer extension or nested PCR. "+" and "–" is the strand of genome where the primer lies on.

DNA sequences for PEM-seq analysis 1. The orange bases with underline are the random molecular barcode (RMB) sequences on the bridge adapter. 2. The red and blue bases show the index on the I5-Nested and I7-Index primer, respectively. 3. The bold characters mark the primer sequences for primer extension or nested PCR. "+" and "–" is the strand of genome where the primer lies on.

Key resources table

Representative images for preparing PEM-seq libraries (A) Size distribution of fragmented DNA after sonication. The lane labeled sufficient shows the best length distribution of DNA fragments for PEM-seq, while the insufficient means DNA fragments are larger than the targeted length distribution. (B) PCR products after the tagged PCR are separated by a 1.5% agarose gel. C. Size distribution of PEM-seq libraries after the last size selection. Each lane is a PEM-seq library DNA.

Materials and equipment

DMEM/10% FBS medium Filter-sterilize the medium with a 0.22 μm filter and store it at 4°C for up to one month. CRITICAL: β-mercaptoethanol is toxic. Wear gloves, goggles, and face-shield to avoid skin exposure and inhalation. PEI, 1 mg/mL Dissolve PEI in water that has been heated to 80°C; cool the solution to 25°C, and neutralize it to pH 7.0 by hydrochloric acid (HCl). Filter-sterilize the medium with a 0.22 μm filter, aliquot 1 mL into sterile tubes, and store it at −20°C for up to one year. CRITICAL: Hydrochloric acid is toxic. Wear gloves, goggles, and face-shield to avoid skin exposure and inhalation. Cell lysis buffer Store it at room temperature (22°C–26°C, hereafter) for up to 6 months. CRITICAL: SDS is toxic. Wear gloves and a mask to avoid skin exposure and inhalation. TE buffer Store it at room temperature for up to 1 year. 1× B&W buffer Store it at room temperature for up to 1 year. 10 mM Tris-HCl, pH7.5 Store it at room temperature for up to 1 year. 10% (vol/vol) Triton X-100 Filter the solution through a 0.22 μm filter and store it at room temperature for up to 1 year. Bridge adapter-upper/-lower Dissolve the oligonucleotides in water, aliquot 50 μL into sterile tubes, and store it at −20°C for up to one year. 50% (wt/vol) PEG8000 Dissolve PEG8000 in ddH2O at 50°C, and then adjust the volume to 10 mL. Prepare 1 mL aliquots and store them at −20°C for up to 1 year. 10 mM NaOH Prepare 1 mL aliquots and store them at room temperature for up to 3 months. CRITICAL: NaOH is toxic. Wear gloves to avoid skin exposure.

Step-by-step method details

Generating bait DSB

Timing: 2 days This step is aimed to introduce a bait DSB into cells and allow the formation of DSB repair products. The bait DSB can be induced by multiple approaches, including transfection, viral transduction, and nucleofection. Here, we describe the procedure of polyethylenimine (PEI)-mediated transfection with a plasmid containing SpCas9-MYC1 in HEK-293T cells. If a bait DSB has been generated and then it underwent DSB repair in cells already, please skip this part and proceed with the genomic DNA isolation. Culture HEK-293T cells in DMEM/10% FBS medium to a 60%–80% coverage in the 6-cm dish. Two dishes of cells should be prepared. One is set as the control that is without the bait DSB, the other one is for bait DSB generation. PEI-mediated plasmid transfection. Before transfection, bring all reagents to room temperature. Remove the cell culture medium by aspiration, and add 4–5 mL pre-warmed (37°C) DMEM/10% FBS medium. Prepare the transfection mixture. Add 200 μL opti-MEM and 5 μg plasmid containing SpCas9-MYC1 (inducing bait DSB by pX330-MYC1) or GFP (control, pX330-GFP) in a 1.5 mL tube. Mix well with gentle flaps. Prepare two 1.5 mL tubes, each containing 200 μL opti-MEM and 10–15 μL PEI (1 mg/mL). Mix well by vortexing or pipetting. Add one diluted PEI (from ii) to one diluted DNA (from i), and the total volume should be less than 450 μL. Mix immediately with gentle flaps and incubate at room temperature for 15 min. Dropwise add the DNA/PEI mixture to the cell culture by a pipette and put cells into a CO2 incubator for 8–12 h. Remove the medium by aspiration and add 5 mL pre-warmed (37°C) DMEM/10% FBS medium. Harvest transfected cells at 48–72 h post-transfection. Typically, over 0.1 million live cells are required for one PEM-seq library, and 1–3 million cells are recommended. Aspirate the cell culture medium, wash cells with 3 mL 1× PBS, and aspirate the PBS. Add 400 μL 0.05% trypsin to cover all cells and incubate at 37°C for 2 min to allow cell detachment and separation. Add 400 μL DMEM/10% FBS medium to quench trypsin and collect cells into a 1.5 mL tube. Spin at 300 g, 4°C, for 5 min and remove supernatant. Wash once with 1 mL 1× PBS, spin, and discard the supernatant.

Isolating genomic DNA

Timing: 1 day The genomic DNA for PEM-seq analysis is isolated and purified in this major step. Besides the procedures provided below, genomic DNA can be also isolated by any mainstream commercial kits, such as the PureLink Genomic DNA Purification Kit (Thermo), GenElute Mammalian Genomic DNA Miniprep Kits (Sigma-Aldrich), Monarch Genomic DNA Purification Kit (NEB), etc. Prepare cell lysis master mixture for each sample by mixing 495 μL of cell lysis buffer and 5 μL of proteinase K (20 mg/mL). Loose the cell pellet with flaps, add 500 μL of cell lysis master mixture, and incubate them in a thermomixer at 56°C, 500 rpm, for overnight (10–16 h). Add 500 μL of Isopropanol, mix immediately and thoroughly by inverting and shaking the microtube until the white pellet forms. Troubleshooting 1 Pick up the DNA pellet with a pipette tip, transfer it to a new 1.5 mL microtube containing 1 mL 70% (vol/vol) ethanol, and mix thoroughly by inverting and shaking. Centrifuge it at 13,000 g for 5 min at 4°C. Remove the supernatant completely, and air-dry the DNA pellet for 2–5 min. Dissolve the DNA pellet in 150 μL TE buffer and incubate at 56°C, 500 rpm, for at least 4 h. CRITICAL: The DNA must be dissolved completely. Determine the concentration of 1 μL of the isolated genomic DNA with a spectrophotometer; the value of A260/280 should be 1.8–2.0. Pause point: Purified genomic DNA can be stored at −20°C for months or 4°C for a week.

Sonication

Timing: 2 h In this section, the isolated genomic DNA should be sheared to small fragments with a peak length of 300–700 bp. Turn on the Covaris M220 focused-ultrasonicator and pre-cool it to 4°C. Transfer 20–50 μg DNA to a microtube-130 and adjust the final volume to 130 μL with nuclease-free water. Set the Covaris M220 by following the manufacturer’s instructions (https://www.covaris.com/wp/wp-content/uploads/resources_pdf/pn_010252.pdf), and fragment the DNA to a target peak at 300–700 bp: CRITICAL: The performance of sonication varies with different samples. Carry out a time course based on the above settings. In our lab, we usually set the treatment time at 60 or 50 s for human or mouse genomic DNA, respectively. Run 1 μL of the sonicated DNA on a 1% (wt/vol) agarose gel in 1× TAE buffer; the size of DNA should be with a target peak at 300–700 bp. Troubleshooting 2 CRITICAL: The length distribution of DNA fragments is important, as the too short or too long DNA fragments will be lost in PEM-seq libraries. Of note, if the library DNA of PEM-seq is sequenced with a 2 × 250 bp read, the size of fragmented DNA can be larger, such as with a peak at 500–1000 bp. The longer sequencing reads are more precise to identify outcomes, however, a 2 × 150 bp read is good enough for most experiments and is much cheaper. Pause point: DNA fragments can be stored at −20°C for months or 4°C for a week.

Primer extension

Timing: 1.5 h DNA fragments containing the complementary sequence of the biotinylated primer are tagged with biotin at their 5′ end by a one-round primer extension. Prepare the primer anneal mixture on ice for each sample as below: CRITICAL: The total amount of sonicated DNA for each sample should be 1–40 μg with an optimal amount of about 20 μg. If a larger amount of DNA is needed, scale up the mixture. Aliquot each of the primer anneal mixtures into 4 PCR tubes. Perform the primer anneal reaction with the following settings: CRITICAL: The annealing temperature should be changed according to the melting temperature of biotinylated primer(s). Set up the primer extension mixture on ice for each sample as below: CRITICAL: The amount of Bst 3.0 DNA polymerase is approximately 2 U/μg DNA. If the amount of DNA is more than 20 μg, scale up the polymerase. Add 10 μL aliquots of the primer extension mixture to each PCR tubes in step 18, mix thoroughly by vortex. Set the primer extension reaction as follows: A 15-min of primer extension is sufficient to amplify DNA fragments with a peak length at 500–1000 bp.

Primer removal

Timing: 40 min The exceeded biotinylated primers are removed in this major step, as the residual will be captured by streptavidin beads as well. Place the AMpure XP beads at room temperature for at least 30 min before use. Add 50 μL of pre-warmed AMpure XP beads to each PCR tube with primer extension product by pipetting up and down 15–20 times and then incubate at room temperature for 5 min. CRITICAL: The volume of AMpure XP beads, every new batch or after a long-time storage, should be tested before use by following the manufacturer’s instructions (https://www.beckman.com/reagents/genomic/cleanup-and-size-selection/pcr/a63880). Principally, all of the free bio-primer should be removed and all DNA fragments larger than 200 bp should be kept. Typically, we use the beads ratio at 1.0×, which means that 50 μL of the AMpure beads are mixed with 50 μL of the primer extension product. Place PCR tubes on the magnetic stand (DynaMa-PCR Magnet) at room temperature for 5 min. Remove and discard the supernatant completely. CRITICAL: Hold the PCR tubes on the magnetic stand and do not disturb the AMpure beads. Moreover, during the whole process of primer removal, the AMpure beads cannot be over air-dry. Add 200 μL of 70% ethanol to each tube and remove the supernatant completely. CRITICAL: Leave the PCR tubes on the magnetic stand and do not disturb the AMpure beads. Repeat step 26. Add 50 μL of 10 mM Tris-HCl, pH 7.5, and mix thoroughly by pipetting up and down 15–20 times. Incubate at room temperature for 2 min. Place PCR tubes on the magnetic stand at room temperature for 2 min. Transfer 50 μL of the clear supernatant from each PCR tube and pool the same sample together in a 1.5 mL microtube. CRITICAL: Do not disturb or transfer any of the AMpure beads. Check the concentration of the supernatant with a spectrophotometer; the total amount of the recovered DNA should be closed to the initial amount. Troubleshooting 3 Pause point: DNA fragments can be stored at −20°C for months.

Streptavidin purification

Timing: 5 h In this section, the biotinylated single-stranded DNA is captured by the streptavidin beads. Incubate the purified DNA at 95°C for 5 min and immediately chilled on ice for 3 min. Prepare the streptavidin binding mixture: Prepare the streptavidin C1 beads. Transfer 20 μL of streptavidin C1 beads for each sample to a new 1.5 mL microtube. If multiple samples are handled, scale up the amount of C1 beads. Add 400 μL of 1× B&W buffer, mix well by pipetting. Place it on a DynaMag-2 holder at room temperature for 1 min. Remove and discard the supernatant completely. Repeat b-d for twice. Suspend the C1 beads with 20 μL of 1× B&W buffer. Add 20 μL of washed streptavidin C1 beads to the binding mixture from step 34 and incubate on a rotator at room temperature for 4 h. CRITICAL: A 2 h incubation is sufficient to capture most of the biotinylated products, however, a 4 h incubation is recommended. Pause point: The incubation can be sustained overnight (12–16 h). Spin the mixture at 200 g for 5 s. CRITICAL: The centrifuge speed must be lower than 3000 rpm (or 1000 x g), otherwise, the C1 beads will be broken, resulting in the loss of biotinylated products. Regarding this, a mini benchtop microcentrifuge is not recommended. Place the mixture on a DynaMag-2 holder at room temperature for 1 min and remove the supernatant completely. Suspend the C1 beads with 400 μL of 1× B&W buffer, capture the beads on the magnet stand for 1 min and remove the supernatant completely. Repeat step 39. Resuspend the beads with 400 μL of 10 mM NaOH, immediately place the mixture on the magnet stand for 1 min, and discard the supernatant completely. CRITICAL: The total incubation time with 10 mM NaOH must be less than 2 min. Suspend the C1 beads with 400 μL of 10 mM Tris-HCl, pH 7.5, capture the beads on the magnet stand for 1 min and discard the supernatant completely. Repeat step 42. Suspend the C1 beads with 42.4 μL of 10 mM Tris-HCl, pH 7.5.

On-beads ligation

Timing: 5 h The 3′ end of single-stranded DNA, on the streptavidin beads, is ligated with the bridge adapter containing a 14-bp RMB. Prepare the bridge-adapter mixture in a PCR tube: Set the bridge adapter assembly program: CRITICAL: The ramp rate must be set at 0.1°C/s during the annealing processes. Add 120 μL of nuclease-free water to bring the final concentration of annealed bridge adapter to 50 μM, prepare 80 μL aliquots and store them at −20°C for up to 1 year. Set up an 80 μL ligation reaction as below: CRITICAL: Mix well all the reagents except PEG8000 by flaps, then add the PEG8000 with a cut-off P200 pipette tip and mix gently but thoroughly by pipetting up and down 10–15 times. Incubate the ligation reaction at room temperature for 4 h or overnight (12–16 h) on a rotator with a rotation rate at 8 rpm. CRITICAL: Do not spin the mixture. It is recommended to resuspend the mixture every 2 h during the incubation, however, the resuspension can be skipped during overnight ligation. Add 320 μL of 1× B&W buffer and mix thoroughly, capture the beads on the magnet stand for 1 min and remove the supernatant completely. Resuspend the beads with 400 μL of 1× B&W buffer, place the mixture on the magnet stand for 1 min, and discard the supernatant completely. Repeat step 51. Resuspend the beads with 400 μL of 10 mM Tris-HCl, pH 7.5, place the mixture on the magnet stand for 1 min, and discard the supernatant completely. Repeat step 53. Resuspend the on-beads ligated DNA with 73 μL of 10 mM Tris-HCl, pH 7.5.

Nested PCR

Timing: 1.5 h The nested PCR is used to enrich DNA fragments around the bait DSB. Moreover, it also introduces Illumina indexes to distinguish multiple samples that will be sequenced in the same lane. Set up a 100 μL nested PCR mixture as below: Mix thoroughly, aliquot the nested PCR mixture into 2 PCR tubes and perform amplification with the following program: CRITICAL: DNA polymerase used in this step should be without the nuclease-dependent proofreading activity, as it will digest the beads-bound ssDNA. Moreover, do not spin the PCR mixture as it will greatly reduce the amplification efficiency.

Size selection

Timing: 40 min DNA fragments larger than 300 bp are kept during the size selection to achieve the best performance of PEM-seq analysis. Place the AMpure XP beads at room temperature for at least 30 min before use. Add 40 μL of pre-warmed AMpure XP beads to each PCR tube after the nested PCR by pipetting up and down 15–20 times and then incubate at room temperature for 5 min. CRITICAL: The volume of AMpure XP beads should be tested before use. Principally, all DNA fragments larger than 300 bp should be kept. Typically, we use 40 μL of the AMpure beads for 50 μL of the PCR product. Place PCR tubes on the magnetic stand (DynaMa-PCR Magnet) at room temperature for 5 min. Remove and discard the supernatant completely. CRITICAL: Hold the PCR tubes on the magnetic stand and do not disturb the AMpure beads. Moreover, the AMpure beads can be not air-dry. Add 200 μL of 70% ethanol to each tube and remove the supernatant completely. CRITICAL: Leave the PCR tubes on the magnetic stand and do not disturb the AMpure beads. Repeat step 62. Add 35 μL of 10 mM Tris-HCl, pH 7.5, and mix thoroughly by pipetting up and down 15–20 times. Incubate at room temperature for 2 min. Place PCR tubes on the magnetic stand at room temperature for 2 min. Transfer 33 μL of the clear supernatant from each PCR tube and pool the same sample together in a 1.5 mL microtube. CRITICAL: Do not disturb or transfer the AMpure beads, as the AMpure beads greatly reduce the amplification efficiency of tagged PCR. Check the concentration of 1 μL of the supernatant with a spectrophotometer; the concentration of the recovered DNA is less than 4 ng/μL, commonly ranging from 1 to 3 ng/μL. Troubleshooting 4

Tagged PCR

Timing: 1 h In this section, PCR products are tagged by the Illumina adapter sequences with different indexes. Set up a 100 μL tagged PCR mixture as below: Mix thoroughly, aliquot the tagged PCR mixture into 2 PCR tubes and perform PCR with the following program: CRITICAL: To enhance the compatibility to different PCR machines and the efficiency of PCR, two 50 μL of aliquots are recommended. Moreover, the cycle number of PCR depends on the concentration of DNA in step 68. If the concentration is less than 2 ng/μL, perform 15 cycles; if the concentration is 2–4 ng/μL, perform 11–13 cycles; if the concentration is higher than 4 ng/μL, perform 10 cycles. Pause point: The PCR products can be stored at −20°C for months. Timing: 3 h PCR products ranging from 300 to 700 bp are kept for sequencing. Besides the procedures provided below, library DNA can be also size selected by AMpure XP beads (https://www.beckman.com/reagents/genomic/cleanup-and-size-selection/pcr/a63880) or SPRIselect beads (https://www.mybeckman.cn/reagents/genomic/cleanup-and-size-selection/size-selection/b23317) by following the manufacturer’s instructions. Principally, DNA fragments ranging from 300 to 700 bp should be kept. Moreover, any mainstream gel extraction kit for DNA should work as well as the GeneJET Gel Extraction Kit. Pool the same sample together, add 20 μL of 6× DNA loading buffer, mix well, and run the PCR products on a 1.5% (wt/vol) agarose gel in 1× TAE buffer. CRITICAL: The time should be long enough to separate desired DNA products from by-products. Typically, the running time is over 1 h. Excise gel with DNA fragments ranging from 300 bp to 700 bp, cut into small pieces, and transfer them to a 15 mL tube. Troubleshooting 5 Add 2 mL binding buffer from the GeneJET Gel Extraction Kit, mix thoroughly, and incubate at 56°C until all gel is dissolved. Spin the mixture through a column, included in the GeneJET Gel Extraction Kit, at 10,000 g for 1 min, and then discard the flow-through. Add 800 μL of wash buffer (from the gel extraction kit) to wash the column, spin it at 10,000 g for 1 min, and then discard the flow-through. Spin the column at 10,000 g for 2 min, and transfer it to a new 1.5 mL microtube. Add 50 μL of nuclease-free water to the column, incubate at room temperature for 2 min. Spin the column at 10,000 g for 2 min and collect the eluted fraction. Check the concentration of 1 μL of the library DNA with a spectrophotometer. The total amount of DNA should be 0.3–1 μg, with a concentration at 6–20 ng/μL. Troubleshooting 6 Pause point: The library DNA can be stored at −80°C for months.

High-throughput sequencing

Timing: 3 days In this section, pooled libraries with compatible indexes are sequenced on Illumina platforms. Pool a proper number of PEM-seq libraries equally, and apply the mixed library DNA to be sequenced on Illumina sequencers. CRITICAL: Make sure the pooled libraries have compatible indexes. Moreover, an optimal sequencing platform also has to be decided on, typically, we use Hi-seq 2500, with a 2 × 150 bp. For each library, 3–5 million raw reads, with coverage at 1.5–2.5× as 1–2 million cells are recommended for one PEM-seq library, are sufficient for the following analysis. Demultiplex each library based on its index(es), typically, this can be done with the bcl2fastq2 conversion software by following the manufacturer’s instruction (https://support.illumina.com/content/dam/illumina-support/documents/documentation/software_documentation/bcl2fastq/bcl2fastq2-v2-20-software-guide-15051736-03.pdf).

Sequence reads processing

Timing: 3 h Reads are processed by PEM-Q, which is available with a test sample datasheet and detailed instructions (https://github.com/liumz93/PEM-Q). Please install the pipeline following the instructions on the website. Prepare information in the following order for each library: CRITICAL: “Genome” is the reference assembly, e.g. hg38, mm10 for alignment. “Name” stands for the basename of the input .fastq files, e.g. “/path/LY001_R1.fastq” should be “LY001”. “Cut-site” is the breakpoint of the bait DSB on the strand of nested primer resident. “P-start”, “P-end”, “P-strand”, and “P-sequence” are the starting point, endpoint, resident strand, and sequence of the nested primer. Of note, “P-sequence” must be in Upper characters, while lower characters are for the rest items except for the “Name”. Information for Myc6, MYC1 (+/–), and MYC-YH have been provided in the following table. The following information is only used for the vector integration analysis. Skip the following table, if no vector is used in your experiments. The “Name”, “Genome”, “Chromosome”, and “P-strand” are the same as the essential information for PEM-Q processing. The “Name of vector sequence file” is the full title of the .fa file, e.g., “SpCas9_pX330.fa”. “sgRNA-start” and “sgRNA-end” are the start and end point of the single guide (sg) RNA sequence on the vector. Examples are provided in the online instruction of PEM-Q. Make a folder for each sample. Move the sequence files to the indicated file folder and then execute step 85 under this folder. Run the PEM-Q pipeline with the following command. >PEM-Q.py “Genome” “Name” “Cut-site” “Chromosome” “P-start” “P-end” “P-strand” “P-sequence” CRITICAL: The command must be executed in the folder containing the sequence files. Execute the following command to identify vector integrations: >vector_analyze.py “Name” “Name of the vector sequence file” “Genome” “Chromosome” “P-strand” “sgRNA-start” “sgRNA-end” After that, the output contains two types of files in the “results” folder, which will be used for the following analysis (Table below). The statistics file contains the number of each kind of editing event and the editing efficiency. Each .tab file is a kind of editing event, e.g., deletions, insertions, and intra- or inter-chromosomal translocations. Use the separated files for the analysis presented in the Quantification and statistical analysis section. CRITICAL: Each line in the .tab file represents an editing event. The detailed description of output files is presented in the documentation of PEM-Q (https://github.com/liumz93/PEM-Q). Convert the .tab files to .bdg files with commands listed below, and visualize the .bdg files in IGV. >tab2bdg_PEMQ.py “Full name of the .tab file” “Genome” Execute the following command to visualize reads aligned to the vector sequence. >vectorTab2bdg.py “Full name of the .tab file containing vector” “the path/ Name of the vector sequence file (.fa)”

Expected outcomes

Figure 3 shows representative examples of the size distribution of fragmented DNA for PEM-seq analysis, library DNA after tagged PCR, and library DNA for Hi-seq sequencing. Regarding the fragmented DNA by sonication, the peak length of DNA fragments should be at 300–700 bp (Figure 3A). A good DNA library should be 300–700 bp. Of note, the PCR products at 100–200 bp mainly only contain the Illumina primers (Figure 3B). Moreover, the total amount of DNA after size selection is from 300 ng to 1 μg. DNA subjected to sequencing should range from 300 to 700 bp as well, without any contaminations (Figure 3C).
Figure 3

Representative images for preparing PEM-seq libraries

(A) Size distribution of fragmented DNA after sonication. The lane labeled sufficient shows the best length distribution of DNA fragments for PEM-seq, while the insufficient means DNA fragments are larger than the targeted length distribution.

(B) PCR products after the tagged PCR are separated by a 1.5% agarose gel. C. Size distribution of PEM-seq libraries after the last size selection. Each lane is a PEM-seq library DNA.

Quantification and statistical analysis

PEM-seq quantifies all types of DSB repair outcomes, including perfect re-joinings or non-cuttings, insertions, deletions, and genome-wide translocations (Tables 3 and 4). Moreover, it also quantifies the editing efficiency and identifies the off-target activity of nuclease-dependent genome-editing tools. Following are the summary descriptions about the utilization:
Table 3

Statistics analysis after PEM-Q processing

Libray nameControlSpCas9-MYC1 treated
Host & cell linesHuman, HEK-293THuman, HEK-293T
Bait DSBNoneSpCas9-MYC1
Bio-primer & nested primerBio-/nested MYC1 (+)Bio-/nested MYC1 (+)
EventsHits or percentageHits or percentage
NoJunction (perfect re-joinings or non-cuttings)587,577118,768
Deletions2,455104,408
Small_deletions (<=100bp)2,36899,899
Large_deletions (>100bp)874,509
Insertions2,06241,190
1_bp insertions47225,977
Small_insertions (<20bp)98534,048
Large_insertions (≥20bp)1,0777,142
Translocations10611,170
Vector integrations1063,119
Editing events4,623156,768
Total events592,222282,624
Editing efficiency (%)0.78%55.47%
Deletions (%)0.41%36.94%
Insertions (%)0.35%14.57%
Translocations (%)0.02%3.95%
Table 4

Off-targets of SpCas9-MYC1 in HEK-293T cells

Off targetChrStart positionEnd positionOff-target sequences with PAM (5' > 3′)Junctions in controlJunctions in treated cells
OT1chr9127166926127166949AGGAAGTGGAGCTTGGCCTT GGG062
OT2chr81917184619171869AGGAAGTGGAGCTTGGCCTT GGG031
OT3chr81917176819171791GGGGTGTGGAGCTTGACTAT GAG031
OT4chr4144444276144444299TGGGAGTGGAGCTTGGTTTT GGG025
OT5chr31506529015065313AGGATGAAGAGATTGGCTAT GGG024
OT6chr122129914521299168GGGAAGTGGAACCTGGCTCT GGG014
OT7chr3159731043159731066TGGATGTGCAGCCTGGCTAT TGG010
OT8chr81917190519171928GGAATTTGGCGCTTGATTAT AGA05
OT9chr1232507723250795GGTATGCAGAGCTTGGCTTT CGG03
The editing efficiency (E.E., Figure 4A) is output in the last row of the statistics file, calculated by the following formula:
Figure 4

PEM-seq comprehensively quantifies editing outcomes of genome editing tools

(A) The editing efficiency of SpCas9 at MYC1 locus in HEK-293T cells. The frequency of deletion, insertion and translocation events are indicated. Con, control.

(B) The top ten editing events generated by SpCas9-MYC1 in HEK-293T cells. The red characters show the inserted bases and the dashed blue line marks the cleavage site. The underline shows microhomology. Mut% shows the frequency of each product in total editing events. Ref., sequence of the reference assembly.

(C) The frequency of small (<= 100 bp) and large (> 100 bp) deletions induced by SpCas9-MYC1 in HEK-293T cells.

(D) The length distribution of small deletions (purple), small (< 20 bp) and large (≥ 20 bp) insertions (blue) generated by SpCas9-MYC1 in HEK-293T cells.

(E) Microhomology with indicated length in small or large deletions among the total deletions.

(F) The distribution of inserted sequence across the vector backbone (schematics on the top) at MYC1 in HEK-293T cells. The maximum reads and total event in control (black) and SpCas9-MYC1 (red) are showed.

(G) Circos plot showing the genome-wide translocations (blue bars) and the off-target sites (the color lines linked to the bait DSB, labeled with scissor) of SpCas9-MYC1 in HEK-293T cells.

PEM-seq comprehensively quantifies editing outcomes of genome editing tools (A) The editing efficiency of SpCas9 at MYC1 locus in HEK-293T cells. The frequency of deletion, insertion and translocation events are indicated. Con, control. (B) The top ten editing events generated by SpCas9-MYC1 in HEK-293T cells. The red characters show the inserted bases and the dashed blue line marks the cleavage site. The underline shows microhomology. Mut% shows the frequency of each product in total editing events. Ref., sequence of the reference assembly. (C) The frequency of small (<= 100 bp) and large (> 100 bp) deletions induced by SpCas9-MYC1 in HEK-293T cells. (D) The length distribution of small deletions (purple), small (< 20 bp) and large (≥ 20 bp) insertions (blue) generated by SpCas9-MYC1 in HEK-293T cells. (E) Microhomology with indicated length in small or large deletions among the total deletions. (F) The distribution of inserted sequence across the vector backbone (schematics on the top) at MYC1 in HEK-293T cells. The maximum reads and total event in control (black) and SpCas9-MYC1 (red) are showed. (G) Circos plot showing the genome-wide translocations (blue bars) and the off-target sites (the color lines linked to the bait DSB, labeled with scissor) of SpCas9-MYC1 in HEK-293T cells. Statistics analysis after PEM-Q processing Off-targets of SpCas9-MYC1 in HEK-293T cells E.E.=Editing Events/ Total Events Calculate the frequency of each DSB repair outcome, including perfect re-joining (NoJunction in the statistics file), deletions, insertions, intra- or inter-chromosomal translocations (Figures 4A and 4B). All required numbers can be found in the statistics file. The length distribution of deletion is important to determine the end resection process during DSB repair. According to the distance, deletions are divided into small (shorter than 100 bp) and large deletions (ranging from 100 bp to 500 kb) (Figures 4C and 4D). If NHEJ defects, the frequency of large deletions will be increased. Microhomology-mediated deletions (Figure 4E) are an important feature of the MMEJ pathway, as defective NHEJ promotes cells to utilize MMEJ, resulting in an increased frequency of microhomology-mediated deletion and a longer length of utilized microhomology. Microhomology used by each editing event has been identified and listed in the .tab files. Small (<20 bp) and large (≥20 bp) insertions (Figure 4D) can be used to analyze the end of DSB and exogenous DNA integration, respectively. For instance, the staggering cleavage of SpCas9 at the target site induces a recurrent single-nucleotide insertion (Liu et al., 2021a). Moreover, the P-nucleotides resulting from RAG1/2-mediated cleavage can also be detected in the small insertions fraction. Any exogenous DNA, such as the vector integrations during genome editing, can be identified from the large insertion fractions (Figure 4F). The insertion sequence has also been identified and listed in the .tab files. Translocation (Figure 4G) results from the joining between bait DSB and prey DSBs. The prey DSB may come from the off-target activity of nuclease-dependent genome-editing tools (restriction enzymes, FokI, TALEN, CRISPR/Cas), fragmented plasmids, endogenous DNA enzymes (such as RAG1/2 and AID), and DNA metabolism (DNA replication, transcription, and DNA damage repair) (Figure 2A). Hence, the frequency of translocations indicates the DSB level and the translocation junctions indicate the breakpoints of prey DSBs. Combining the translocation frequency and junction positions help to identity recurrent DSBs in the genome. Specifically, for off-target identification, multiple translocation junctions should accumulate at the presumable cleavage sites of the off-target sequence that is similar to the target sequence. For example, the off-target activity of CRISPR-Cas9 induces DSBs at sequences similar to the sgRNA (Table 4). Of note, the vector integration can also be found in the translocation fractions. Our PEM-Q pipeline has already combined the insertion and translocation fractions during the vector integration analysis (Figure 4F).

Limitations

PEM-seq identifies the DSB repair outcomes and genome-wide DSBs by analyzing events around the bait DSB and chromosomal translocations between the bait DSBs and prey DSBs. Thus, samples without a bait DSB can’t be used to prepare the PEM-seq library. Chromosomal translocation is a rare event formed between the bait and prey DSBs and requires a repair time of hours to days. Therefore, after the induction of DSB at the bait site, the treated cells must be cultured for at least 24 h, best at 48–72 h. In addition, a relatively large number of cells, typically > 0.1 million live cells are required for one library. PEM-seq tends to capture intra-chromosomal translocations with a higher frequency than inter-chromosomal translocations, similar to other translocation capture assays (Hu et al., 2016). In addition, both unsealed DSBs and repair outcomes losing bio- or nested primer binding site(s) are missed in the PEM-seq analysis. However, editing products without the primer binding site(s) are only less than 2.6% of total editing events (Liu et al., 2021a).

Troubleshooting

Problem 1

The genomic DNA forms a transparent and gel-like pellet in step 6.

Potential solution

The mixing procedure is not sufficient. Continuously invert and shake the microtube by hand until the white pellet is formed.

Problem 2

The peak length distribution of sonicated DNA is larger than 700 bp or smaller than 300 bp in step 15. If the peak length of DNA fragments is larger than 700 bp, do the sonication again with an alternation of duration. If the DNA fragments are too small, take a new aliquot of 20–50 μg DNA and perform the sonication again with a shorter treatment time.

Problem 3

The total amount of recovered DNA is too low in step 32. Two potential reasons will cause this, little DNA is bound on the beads, and (or) little beads-bound DNA is eluted. If little DNA is bound on the beads, more AMpure beads, thorough mixing, and a longer incubation time with beads will be helpful. A longer incubation time of beads with 10 mM Tris-HCl and the thorough mixing will increase the yield of purified DNA.

Problem 4

The concentration of purified DNA from nested PCR is too low or too high in step 68. If the amount of DNA product is too little, it may result from multiple possibilities, including little DNA on the streptavidin C1 beads, insufficient on-beads ligation, and insufficient amount of AMpure beads. However, the most potential cause for a higher concentration is the insufficient removal of biotinylated primer, due to poor quality or inadequate storage of AMpure beads. The residual bio-primer can be captured by streptavidin C1 beads, ligated with the bridge adapter, and amplified during the nested PCR. Therefore, every new batch of commercial AMpure beads or any old beads after a long-time storage should be tested before use. Check and solve the problem based on these possibilities.

Problem 5

No or little DNA smear, a bright band between 100–200 bp, or very long DNA smear tail in step 72. If there is no or little DNA smear, it can result from that: 1) AMpure beads are in the PCR reactions and (or) 2) the cycle number of PCR is few. The insufficient biotinylated primer removal will result in a bright band at 100–200 bp. Finally, a very long DNA smear tail indicates that the cycle number of tagged PCR is too many.

Problem 6

The concentration of purified DNA from tagged PCR is too low or too high in step 79. Increase or decrease the cycle number of tagged PCR if the amount of purified DNA is too few or too many, respectively.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Jiazhi Hu (hujz@pku.edu.cn).

Materials availability

This study did not generate new unique reagents. The PEM-Q pipeline is available at GitHub with instructions (https://github.com/liumz93/PEM-Q).
REAGENT or RESOURCESOURCEIDENTIFIER
Chemicals and recombinant proteins

Nuclease-free waterMilli-Q, 0.22 mm filteredN/A
DMEMCorningCat#10-013-CV
opti-MEMGibcoCat#31985070
Fetal Bovine SerumGibcoCat#10091148
L-GlutamineCorningCat#25-005-CI
Penicillin-Streptomycin Solution, 100×CorningCat#30-002-CI
β-mercaptoethanolSigma-AldrichCat#M3148
1× PBS, pH 7.4GibcoCat#10010031
PolyethylenimineSigma-AldrichCat#919012
TrypsinCorningCat#25-052-CV
1 M Tris-HCl, pH 7.5InvitrogenCat#15567027
5 M NaClSigma-AldrichCat#S6546
0.5 M EDTA, pH 8.0InvitrogenCat#15575020
10% (wt/vol) SDS solutionInvitrogenCat#15553027
Proteinase K (20 mg/mL)InvitrogenCat#AM2546
IsopropanolSigma-AldrichCat#I9516
EthanolSigma-AldrichCat#1085430250
10× Isothermal Amplification Buffer II PackNew England BioLabsCat#B0374S
Bst 3.0 DNA PolymeraseNew England BioLabsCat#M0374L
dNTPs, 2.5 mM eachTransGen BiotechCat#AD101-01
Betaine solution, 5MSigma-AldrichCat#B0300
Triton X-100Sigma-AldrichCat#T8787
Sodium hydroxide solution, 10 MSigma-AldrichCat#72068
10× T4 DNA ligase bufferThermo ScientificCat#EL0011
T4 DNA ligaseThermo ScientificCat#EL0011
PEG8000Sigma-AldrichCat#89510
10× EasyTaq bufferTransGen BiotechCat#AP111-01
EasyTaq DNA PolymeraseTransGen BiotechCat#AP111-01
AMPure XPBeckman CoulterCat#A63880
5× FastPfu bufferTransGen BiotechCat#AP221-01
FastPfu DNA PolymeraseTransGen BiotechCat#AP221-01
AgaroseThermo ScientificCat#75510019
Trans DNA Marker IITransGen BiotechCat#BM411-01
6× DNA loading bufferBeyotime BiotechCat#D0072
50× TAE bufferThermo ScientificCat#B49
GelRed Nucleic Acid Stain 10000× WaterMerck MilliporeCat#SCT123
GeneJET Gel Extraction KitThermo ScientificCat#K0692

Critical commercial assays

Dynabeads MyOne streptavidin C1 beadsInvitrogenCat#65002

Experimental models: Organisms/strains

Human cell line: HEK-293TLab stockN/A

Oligonucleotides

See Tables 1 and 2 for detailsSangon BiotechN/A

Recombinant DNA

pX330(Cong et al., 2013)Addgene; Cat#42230
pX330-MYC1Lab stockN/A; sgRNA targeting human c-MYC is cloned into pX330 by BsaI
pX330-GFPLab stockN/A; SpCas9 is replaced by EGFP

Deposited data

Example sequencing datasets & Original pictures for Figure 3This paper; Mendeley Datahttp://doi.org/10.17632/gjhk3wk4h4.1

Software and algorithms

ImageJ 1.53c(Schneider et al., 2012)https://imagej.nih.gov/ij/download.html
PEM-Q(Liu et al., 2021a)https://github.com/liumz93/PEM-Q
Circos 0.69(Krzywinski et al., 2009)http://circos.ca/software/download/circos/
Prism 8GraphPad Softwarehttps://www.graphpad.com/scientific-software/prism/

Others

CO2 incubatorNuaireCat#NU-5700
ThermomixerEppendorfCat#5382000023
CentrifugeEppendorfCat#5406000291
SpectrophotometerDeNovixCat#DS-11 FX+
M220 Focused-ultrasonicatorCovarisCat#500295
MicroTUBE-130 AFA FiberCovarisCat#520045
PCR machineEppendorfCat#6336000074
DynaMag-2InvitrogenCat#12321D
DynaMa-PCR MagnetInvitrogenCat#492025
Vortex Genie 2VWRCat#G560E
VWR tube rotator UK plugVWRCat#10136-084
Electrophoresis systemThermo ScientificCat#FB-SBR-2025
UV TransilluminatorsUVPCat#95-0461-02
ChemiDoc MP imaging systemBio-Rad LaboratoriesCat#17001402
1.5 mL MicrotubesAxygenCat#MCT-150-C
0.2 mL PCR strip tubesAxygenCat#PCR-0208-CP-C

DMEM/10% FBS medium

ReagentFinal concentrationAmount
DMEMn/a440 mL
Fetal bovine serum10% (vol/vol)50 mL
L-Glutamine, 100× (vol/vol)1× (vol/vol)5 mL
Penicillin-Streptomycin Solution, 100× (vol/vol)1× (vol/vol)5 mL
β-mercaptoethanol (50 mM)50 μM0.5 mL
Totaln/a500 mL

Filter-sterilize the medium with a 0.22 μm filter and store it at 4°C for up to one month.

PEI, 1 mg/mL

ReagentFinal concentrationAmount
Polyethylenimine1 mg/mL10 mg
ddH2On/a10 mL
Totaln/a10 mL

Dissolve PEI in water that has been heated to 80°C; cool the solution to 25°C, and neutralize it to pH 7.0 by hydrochloric acid (HCl). Filter-sterilize the medium with a 0.22 μm filter, aliquot 1 mL into sterile tubes, and store it at −20°C for up to one year.

Cell lysis buffer

ReagentFinal concentrationAmount
Tris-HCl, pH 7.5 (1 M)10 mM0.5 mL
NaCl (5 M)200 mM2 mL
EDTA, pH 8.0 (0.5 M)2 mM0.2 mL
10% SDS (wt/vol)0.2% (wt/vol)1 mL
ddH2On/a46.3 mL
Totaln/a50 mL

Store it at room temperature (22°C–26°C, hereafter) for up to 6 months.

TE buffer

ReagentFinal concentrationAmount
Tris-HCl, pH 7.5 (1 M)10 mM0.5 mL
EDTA, pH 8.0 (0.5 M)0.5 mM0.05 mL
ddH2On/a49.45 mL
Totaln/a50 mL

Store it at room temperature for up to 1 year.

1× B&W buffer

ReagentFinal concentrationAmount
Tris-HCl, pH 7.5 (1 M)5 mM0.25 mL
NaCl (5 M)1 M10 mL
EDTA, pH 8.0 (0.5 M)1 mM0.1 mL
ddH2On/a39.65 mL
Totaln/a50 mL

Store it at room temperature for up to 1 year.

10 mM Tris-HCl, pH7.5

ReagentFinal concentrationAmount
Tris-HCl, pH 7.5 (1 M)10 mM0.5 mL
ddH2On/a49.5 mL
Totaln/a50 mL

Store it at room temperature for up to 1 year.

10% (vol/vol) Triton X-100

ReagentFinal concentrationAmount
Triton X-10010%1 mL
ddH2On/a9 mL
Totaln/a10 mL

Filter the solution through a 0.22 μm filter and store it at room temperature for up to 1 year.

Bridge adapter-upper/-lower

ReagentFinal concentrationAmount
Bridge adapter-upper/-lower400 μM100 nmol
ddH2On/a250 μL
Totaln/a250 μL

Dissolve the oligonucleotides in water, aliquot 50 μL into sterile tubes, and store it at −20°C for up to one year.

50% (wt/vol) PEG8000

ReagentFinal concentrationAmount
PEG800050% (wt/vol)5 g
ddH2On/a10 mL
Totaln/a10 mL

Dissolve PEG8000 in ddH2O at 50°C, and then adjust the volume to 10 mL. Prepare 1 mL aliquots and store them at −20°C for up to 1 year.

10 mM NaOH

ReagentFinal concentrationAmount
NaOH (10 M)10 mM0.05 mL
ddH2On/a49.95 mL
Totaln/a50 mL

Prepare 1 mL aliquots and store them at room temperature for up to 3 months.

ParameterSetting value
Temperature (°C)4
Peak Incident Power (W)50
Duty Factor (%)20
Treatment Time (sec)50–65
Cycles per Burst (cpb)200
ReagentFinal concentrationAmount
10× Bst buffer16 μL
Bio-primer-MYC1 (+) (1 μM)25 nM4 μL
5 M Betaine1 M32 μL
sonicated DNA6.25–250 ng/μL1–40 μg
ddH2On/aTo 160 μL
Totaln/a160 μL
PCR cycling conditions
StepsTemperatureTimeCycles
Initial Denaturation95°C3 min1
Denaturation95°C2 min5 cycles
Annealing58°C3 min
Final Annealing58°C3 min1
Hold10°CForever
ReagentFinal concentrationAmount
10× Bst buffer4 μL
dNTPs (2.5 mM each)50 μM4 μL
Bst 3.0 DNA polymerase (8 U/μL)0.1 U/μL2.5 μL
ddH2On/a29.5 μL
Totaln/a40 μL
PCR cycling conditions
StepsTemperatureTimeCycles
Primer extension65°C15 min1
Inactivation80°C5 min1
Hold25°CForever
ReagentFinal concentrationAmount
Denatured DNA (from step 33)n/a200 μL
NaCl (5 M)1 M50 μL
EDTA (0.5 M, pH 8.0)5 mM2.5 μL
10% (vol/vol) Triton X-1000.02%0.5 μL
Totaln/a253 μL
ReagentFinal concentrationAmount
Bridge adapter-upper (400 μM)200 μM20 μL
Bridge adapter-lower (400 μM)200 μM20 μL
Totaln/a40 μL
PCR cycling conditions
StepsTemperatureTimeCycle
Denaturation95°C3 min1
Annealing85°C, Ramp at 0.1°C/s1 min1
Annealing80°C, Ramp at 0.1°C/s1 min1
Annealing75°C, Ramp at 0.1°C/s1 min1
Annealing70°C, Ramp at 0.1°C/s1 min1
Annealing65°C, Ramp at 0.1°C/s1 min1
Annealing60°C, Ramp at 0.1°C/s1 min1
Annealing55°C, Ramp at 0.1°C/s1 min1
Annealing50°C, Ramp at 0.1°C/s1 min1
Annealing45°C, Ramp at 0.1°C/s1 min1
Annealing40°C, Ramp at 0.1°C/s1 min1
Annealing35°C, Ramp at 0.1°C/s1 min1
Annealing30°C, Ramp at 0.1°C/s1 min1
Hold10°Cforever
ReagentFinal concentrationAmount
ssDNA on C1 beads (from step 44)n/a42.4 μL
10× T4 DNA ligase buffer8 μL
Bridge adapter (50 μM from step 47)1 μM1.6 μL
T4 DNA ligase (400 U/μL)20 U/μL4 μL
50% (wt/vol) PEG800015%24 μL
Totaln/a80 μL
ReagentFinal concentrationAmount
On-beads ligation products (from step 55)n/a73 μL
10× EasyTaq buffer10 μL
dNTPs (2.5 mM each)200 μM8 μL
I5-Nested-1-MYC1 (+) (10 μM)400 nM4 μL
I7-index primer (10 μM)400 nM4 μL
EasyTaq DNA polymerase (5 U/μL)0.05 U/μL1 μL
Totaln/a100 μL
PCR cycling conditions
StepsTemperatureTimeCycles
Initial Denaturation95°C5 min1
Denaturation95°C1 min15 cycles
Annealing58°C45 s
Extension72°C1 min
Final Extension72°C5 min1
Hold10°Cforever
ReagentFinal concentrationAmount
PCR products (from step 67)n/a63 μL
5× FastPfu buffer20 μL
dNTPs (2.5 mM each)200 μM8 μL
P5-I5 (10 μM)400 nM4 μL
P7-tag (10 μM)400 nM4 μL
FastPfu DNA polymerase (2.5 U/μL)0.025 U/μL1 μL
Totaln/a100 μL
PCR cycling conditions
StepsTemperatureTimeCycles
Initial Denaturation95°C2 min1
Denaturation95°C30 s15 cycles
Annealing58°C45 s
Extension72°C1 min
Final Extension72°C5 min1
Hold10°Cforever
Essential information for PEM-Q processing
GenomeNameCut-siteChromosomeP-startP-endP-strandP-sequence
Example information for PEM-Q analysis
Name of bait DSBGenomeNameCut-siteChromosomeP-startP-endP-strandP-sequence (5' > 3′)
Myc6mm10Name of your .fastq file61986726chr156198663361986652+GGAAACCAGAGGGAATCCTC
MYC1 (+)hg38Name of your .fastq file127743326chr8127743238127743257+CCTCAGAATAGGAGAGAGTG
MYC1 (–)hg38Name of your .fastq file127743326chr8127743381127743400AGAGCCATTCTCTGGCTCAG
MYC-YHhg38Name of your .fastq file127738978chr8127738879127738898+AGTCCTGCGCCTCGCAAGAC
Information for vector integration analysis only (Optional)
NameName of the vector sequence file (.fa file)GenomeChromosomeP-strandsgRNA-startsgRNA-end
Editing events after PEM-Q analysis
TypesCategoriesDefinitionAnalysisFiles
Editing eventsAll editing eventsDeletions, insertions, inversions, and translocationsEditing efficiency; Frequency of each type of editing events, & The top rank of editing events∗_Editing_events.tab ∗_Editing_events_dot_plot.pdf ∗_Editing_events.html ∗_statistics.txt
DeletionsSmall deletionsDeletions, 1–100 bp around the bait DSBLength distribution & Microhomology∗_Deletion.tab∗_deletion_length.txt∗_del_len_statistics.txt
Large deletionsDeletions, 0.1–500 kb around the bait DSB
InsertionsSmall insertionsInsertions, < 20 bp in size, 0–500 kb around the bait DSBLength distribution, Inserted sequences & Plasmid integration∗_Insertion.tab∗_insertion_length.txt∗_inser_len_statistics.txt
Large insertionsInsertions, ≥ 20 bp in size, 0–500 kb around the bait DSB
TranslocationsIntra-chromosomal translocationsJunctions on the bait chromosome, but out of the +/- 500 kb around the bait DSBPrey DSBs & Off-targets analysis∗_Translocation.tab
Inter-chromosomal translocationsJunctions on other chromosomes
Vector integrationsVector integrationsJunctions on vectorDistribution of vector integrations∗_all_vector_2.2.tab
  17 in total

1.  Circos: an information aesthetic for comparative genomics.

Authors:  Martin Krzywinski; Jacqueline Schein; Inanç Birol; Joseph Connors; Randy Gascoyne; Doug Horsman; Steven J Jones; Marco A Marra
Journal:  Genome Res       Date:  2009-06-18       Impact factor: 9.043

Review 2.  Endogenous DNA Damage as a Source of Genomic Instability in Cancer.

Authors:  Anthony Tubbs; André Nussenzweig
Journal:  Cell       Date:  2017-02-09       Impact factor: 41.582

3.  Dual Roles of Poly(dA:dT) Tracts in Replication Initiation and Fork Collapse.

Authors:  Anthony Tubbs; Sriram Sridharan; Niek van Wietmarschen; Yaakov Maman; Elsa Callen; Andre Stanlie; Wei Wu; Xia Wu; Amanda Day; Nancy Wong; Mianmian Yin; Andres Canela; Haiqing Fu; Christophe Redon; Steven C Pruitt; Yan Jaszczyszyn; Mirit I Aladjem; Peter D Aplan; Olivier Hyrien; André Nussenzweig
Journal:  Cell       Date:  2018-08-02       Impact factor: 41.582

Review 4.  Evaluating and Enhancing Target Specificity of Gene-Editing Nucleases and Deaminases.

Authors:  Daesik Kim; Kevin Luk; Scot A Wolfe; Jin-Soo Kim
Journal:  Annu Rev Biochem       Date:  2019-03-18       Impact factor: 23.643

5.  Convergent transcription at intragenic super-enhancers targets AID-initiated genomic instability.

Authors:  Fei-Long Meng; Zhou Du; Alexander Federation; Jiazhi Hu; Qiao Wang; Kyong-Rim Kieffer-Kwon; Robin M Meyers; Corina Amor; Caitlyn R Wasserman; Donna Neuberg; Rafael Casellas; Michel C Nussenzweig; James E Bradner; X Shirley Liu; Frederick W Alt
Journal:  Cell       Date:  2014-12-04       Impact factor: 41.582

6.  Chromosomal Loop Domains Direct the Recombination of Antigen Receptor Genes.

Authors:  Jiazhi Hu; Yu Zhang; Lijuan Zhao; Richard L Frock; Zhou Du; Robin M Meyers; Fei-long Meng; David G Schatz; Frederick W Alt
Journal:  Cell       Date:  2015-10-22       Impact factor: 41.582

7.  Orientation-specific joining of AID-initiated DNA breaks promotes antibody class switching.

Authors:  Junchao Dong; Rohit A Panchakshari; Tingting Zhang; Yu Zhang; Jiazhi Hu; Sabrina A Volpi; Robin M Meyers; Yu-Jui Ho; Zhou Du; Davide F Robbiani; Feilong Meng; Monica Gostissa; Michel C Nussenzweig; John P Manis; Frederick W Alt
Journal:  Nature       Date:  2015-08-26       Impact factor: 49.962

Review 8.  Applications of genome editing technology in the targeted therapy of human diseases: mechanisms, advances and prospects.

Authors:  Hongyi Li; Yang Yang; Weiqi Hong; Mengyuan Huang; Min Wu; Xia Zhao
Journal:  Signal Transduct Target Ther       Date:  2020-01-03

9.  In-depth assessment of the PAM compatibility and editing activities of Cas9 variants.

Authors:  Weiwei Zhang; Jianhang Yin; Zhengrong Zhang-Ding; Changchang Xin; Mengzhu Liu; Yuhong Wang; Chen Ai; Jiazhi Hu
Journal:  Nucleic Acids Res       Date:  2021-06-16       Impact factor: 16.971

10.  Detecting DNA double-stranded breaks in mammalian genomes by linear amplification-mediated high-throughput genome-wide translocation sequencing.

Authors:  Jiazhi Hu; Robin M Meyers; Junchao Dong; Rohit A Panchakshari; Frederick W Alt; Richard L Frock
Journal:  Nat Protoc       Date:  2016-03-31       Impact factor: 13.491

View more
  2 in total

1.  C-terminal deletion-induced condensation sequesters AID from IgH targets in immunodeficiency.

Authors:  Xia Xie; Tingting Gan; Bing Rao; Weiwei Zhang; Rohit A Panchakshari; Dingpeng Yang; Xiong Ji; Yu Cao; Frederick W Alt; Fei-Long Meng; Jiazhi Hu
Journal:  EMBO J       Date:  2022-04-26       Impact factor: 14.012

2.  Comprehensive assessment of miniature CRISPR-Cas12f nucleases for gene disruption.

Authors:  Changchang Xin; Jianhang Yin; Shaopeng Yuan; Liqiong Ou; Mengzhu Liu; Weiwei Zhang; Jiazhi Hu
Journal:  Nat Commun       Date:  2022-09-24       Impact factor: 17.694

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.