| Literature DB >> 35456459 |
Virginia Veronica Visconti1,2, Chiara Greggi1,2, Ida Cariati2,3, Beatrice Gasperini2,3, Ambra Mastrogregori2, Annalisa Botta3, Umberto Tarantino1,2.
Abstract
Clusterin (CLU) is a secreted heterodimeric glycoprotein expressed in all organism fluids as well as in the intracellular matrix that plays key roles in several pathological processes. Its recent involvement in muscle degeneration of osteoporotic patients led to investigation of the role of CLU in bone metabolism, given the biochemical and biomechanical crosstalk of the bone-muscle unit. Quantitative real time-polymerase chain reaction (qRT-PCR) analysis of CLU expression was performed in both osteoblasts and Peripheral Blood Mononuclear Cells (PBMCs) from osteoporotic patients (OP) and healthy individuals (CTR). Furthermore, immunohistochemical analysis on femoral head tissues and enzyme-linked immunosorbent assay (ELISA) in plasma samples were performed to investigate CLU expression pattern. Finally, genotyping of CLU rs11136000 polymorphism has also been performed by qRT-PCR assays to explore a possible association with CLU expression levels. Data obtained showed a significantly increased expression level of secreted CLU isoform in PBMCs and osteoblasts from OP patients. Immunohistochemical analysis confirms the increased expression of CLU in OP patients, both in osteocytes and osteoblasts, while plasma analysis reveals a statistically significant decrease of CLU levels. Unfortunately, no functional association between CLU expression levels and the presence of CLU rs11136000 polymorphism in OP patients was found. These data suggest a potential role played by CLU as a potential biomarker for the diagnosis and prognosis of OP progression.Entities:
Keywords: biomarker; bone tissue; clusterin; osteoblasts; osteoporosis
Mesh:
Substances:
Year: 2022 PMID: 35456459 PMCID: PMC9024451 DOI: 10.3390/genes13040652
Source DB: PubMed Journal: Genes (Basel) ISSN: 2073-4425 Impact factor: 4.141
Clinical characteristics of OP patients and CTR subjects.
| Characteristics | OP ( | CTRs ( | |
|---|---|---|---|
| Age (years) | 63 ± 15.3 | 45.3 ± 17.8 | ** ( |
| BMI (Kg/cm2) | 24.6 ± 4.5 | 25.8 ± 2.3 | NS ( |
| −1.0 ± 1.2 | 0.3 ± 1.0 | ** ( | |
| −1.4 ± 1.1 | 1.0 ± 0.8 | **** ( | |
| −1.9 ± 0.6 | 0.2 ± 0.7 | **** ( | |
| BMD L1-L4 (g/cm2) | 1.0 ± 0.1 | 1.2 ± 0.1 | ** ( |
| BMD total femur (g/cm2) | 0.8 ± 0.1 | 1.2 ± 0.1 | **** ( |
| BMD femoral neck (g/cm2) | 0.7 ± 0.1 | 1.1 ± 0.1 | *** ( |
| Calcium (mg/dL) | 8.3 ± 0.4 | 8.4 ± 0.3 | NS ( |
| PTH (pg/mL) | 98.9 ± 70 | 73.3 ± 18.5 | NS ( |
| 25-(OH)-Vit D (ng/mL) | 16.2 ± 11 | 23.5 ± 4.5 | * ( |
BMI, body mass index; BMD, bone mineral density, PTH, parathyroid hormone; 25-(OH)-Vit D, 25-hydroxyvitamin D. * (p < 0.05); ** (p < 0.01); *** (p < 0.001); **** (p < 0.0001).
qRT-PCR primer sequences.
| Gene | Sequence (5′–3′) | |
|---|---|---|
|
| Forward | ACAGGGTGCCGCTGACC |
| Reverse | CAGCAGAGTCTTCATCATGC | |
|
| Forward | ACACTCCTCGCCCTATTG |
| Reverse | GATGTGGTCAGCCAACTC | |
|
| Forward | GATCATCAGCAATGCCTCCTG |
| Reverse | GTCTTCTGGGTGGCAGTGAT | |
|
| Forward | CTGGAACGGTGAAGGTGACA |
| Reverse | AAGGGACTTCCTGTAACAATGCA | |
|
| Forward | ACTCCATGCCCAGGAAGGAA |
| Reverse | GAGATGGCCACGGCTGCTT |
Figure 1Expression of sCLU isoform from OP patients and CTR subjects. (A) CLU expression level was analyzed in osteoblasts from 7 OP patients and 7 CTR subjects. OP patients show an increased expression level of CLU with respect to CTR (** p < 0.01). (B) CLU expression level was analyzed in PBMCs from 30 OP and 30 CTR. OP samples show an increased expression level of CLU with respect to CTR (* p < 0.05). GAPDH mRNA level was used to normalize the relative amount of CLU and relative expression values are expressed as 2−ΔΔCT.
Figure 2Immunohistochemical analysis of CLU protein expression in bone head biopsies. Image shows the strongly positive signal in osteocytes from the bone tissue of OP patients (A), whereas in the bone tissue from CTR subjects, the osteocytes were characterized by lower levels of CLU expression (B). The percentage of positive osteocytes was significantly higher in the experimental group of OP patients than in the CTR group (** p < 0.01) (C). Bone tissue osteoblasts from OP patients showed strong positivity to CLU signal (D), compared with the same bone tissue cells from CTR subjects, which were characterized by weak expression of the protein (E). The difference in expression intensity was evaluated semi-quantitatively and was statistically significant between OP and CTR groups (*** p < 0.001) (F). Black arrows indicate osteocytes (A,B) and osteoblasts (D,E), respectively. Images at 20× magnification, scale bar 50 μm.
Figure 3CLU plasma levels in OP patients and CTR subjects. OP patients showed a significantly lower mean circulating CLU level than CTR subjects (3.15 ± 0.87 ng/mL, 4.99 ± 2.07 ng/mL) (** p < 0.01).
Genotype distributions and allele frequencies of rs11136000 SNP in OP and CTR subjects.
| Genotype |
| Allele |
| Odds Ratio (95% CI) | ||||
|---|---|---|---|---|---|---|---|---|
| C/C | C/T | T/T | C | T | ||||
| OP ( | 10 (33.3%) | 18 (60%) | 2 (6.7%) | 0.162 | 38 (63.3%) | 22 (36.7%) | 1 | 1 (0.563–1.777) |
| CTRs ( | 11(37%) | 15 (50%) | 4 (13%) | 38 (63.3%) | 22 (36.7%) | |||