Literature DB >> 35443683

Determination of the regulatory network and function of the lysR-type transcriptional regulator of Lactiplantibacillus plantarum, LpLttR.

Xin-Xin Liu1, Lei Liu1, Xin Song1, Guang-Qiang Wang1, Zhi-Qiang Xiong1, Yong-Jun Xia1, Lian-Zhong Ai2.   

Abstract

BACKGROUND: Lactiplantibacillus plantarum has various healthcare functions including the regulation of immunity and inflammation, reduction of serum cholesterol levels, anti-tumor activity, and maintenance of the balance of intestinal flora. However, the underlying metabolic and regulatory mechanisms of these processes remain unclear. Our previous studies have shown that the LysR type transcriptional regulator of L. plantarum (LpLttR) regulates the biotransformation of conjugated linoleic acids (CLAs) through the transcriptional activation of cla-dh (coding gene for CLA short-chain dehydrogenase) and cla-dc (coding gene for CLA acetoacetate decarboxylase). However, the regulatory network and function of LpLttR have not yet been characterized in L. plantarum.
RESULTS: In this study, the regulatory role of LpLttR in various cellular processes was assessed using transcriptome analysis. The deletion of LpLttR had no evident influence on the bacterial growth. The transcriptome data showed that the expression of nine genes were positively regulated by LpLttR, and the expression of only two genes were negatively regulated. Through binding motif analysis and molecular interaction, we demonstrated that the regulatory region of the directly regulated genes contained a highly conserved sequence, consisting of a 15-base long box and rich in AT.
CONCLUSION: This study revealed that LpLttR of L. plantarum did not play a global regulatory role similar to that of the other transcriptional regulators in this family. This study broadens our knowledge of LpLttR and provides a theoretical basis for the utilization of L. plantarum.
© 2022. The Author(s).

Entities:  

Keywords:  Lactiplantibacillus plantarum; LysR type transcriptional regulator (LttR); Regulon; Transcriptional regulation

Mesh:

Substances:

Year:  2022        PMID: 35443683      PMCID: PMC9019972          DOI: 10.1186/s12934-022-01774-9

Source DB:  PubMed          Journal:  Microb Cell Fact        ISSN: 1475-2859            Impact factor:   6.352


Background

The LysR type transcriptional regulatory factor (LttR) is a ubiquitous regulatory factor in prokaryotes. Many studies have shown that this family of regulators plays a regulatory role in many cellular processes including primary metabolism, secondary metabolism, stress response, cell division, toxicity, quorum sensing and protection, etc. [1, 2]. In Pseudomonas putida KT2440, CatR regulates the expression of catBCA, which is involved in the catechol gene cluster [3]. The CbnR in Ralstonia eutropha regulates the transcription of the catechol explanation related gene cluster cbnABCD [4]. The TfdR of R. eutropha JMP134 not only controls the expression of the o-phenylene diene gene cluster tfdDCEFB, but also regulates the transcription of tfdA to metabolize 2,4-dichlorophenoxyacetic acid isooctyl ester [5]. Moreover, LttRs regulate the genes involved in virulence, metabolism, quorum sensing and exercise [1]. As more target genes have been identified, LttRs have been identified as global regulators. LttRs are structurally conserved, with most containing 276–324 amino acid residues. Their N-terminal is a typical DNA binding domain named the HTH domain, and the C-terminal is the substrate or co-inducer binding domain, which is less conservative and is convenient for the recognition and binding of substrates [6]. LttRs are often induced or suppressed by small molecules, and usually form dimers or tetramers to activate or inhibit the expression of target genes [1]. L. plantarum is a common lactic acid bacteria (LAB) used in the production of several functional and fermented foods [7]. However, there have been few studies on its metabolism and regulatory mechanisms. Our previous studies have shown that L. plantarum ATCC BAA-793 can convert linoleic acid (LA) to conjugated linoleic acid (CLA), which plays an important role in reducing weight and regulating immunity. The LysR family transcriptional regulator, LpLttR, activates the transcription of cla-dh and cla-dc during this process and promotes the biosynthesis of CLA [8]. In addition to cla-dh and cla-dc, it is still unknown which genes are regulated by LpLttR and the biological processes in which it participates. With continuous study of prokaryotic transcriptional regulation, more target genes of LttRs have been identified. However, the regulatory mechanisms in different species remain to be clarified, especially in L. plantarum, which has a wide range of application prospects in the food industry. Here, we studied the regulon of LpLttR of L. plantarum ATCC BAA-793. The sequence analysis of LpLttR was performed to predict its function. We then performed transcriptome sequencing of the WT and LplttR knockout mutant strains (ΔLplttR) to identify the differentially expressed genes. Moreover, the presumed binding sites of the target genes were predicted and verified using molecular interactions based on interferometric techniques. The findings of this study revealed the regulatory network of LpLttR in L. plantarum and provided new insights into the functions of LttRs.

Results

LpLttR conservative analysis

The primary structure of LpLttR in L. plantarum ATCC BAA-793 was analyzed in this study. It was encoded by LP_RS00230 and composed of 295 amino acids. Pfam domain analysis showed that LpLttR contained an HTH domain and a LysR substrate binding domain at the C and N terminals at residues 3–64 and 85–293, respectively (Fig. 1A). The amino acid sequence of the HTH domain of LpLttR was aligned with other LttRs which have been extensively studied and reported as CatR in P. putida KT2440 [4], ClcR in P. putida [9], TcbR in Pseudomonas sp. strain P51 [10], CbnR in R. eutropha [11], TfdR in R. eutropha JMP134 [12], CatR in P. putida PaW85 [13], CatR in P. putida PRS1 [4], TfdR in Ralstonia [12], TfdS in Ralstonia [5], CatM in Acinetobacter [14], PcaQ in Agrobacterium [15], BenM in Acinetobacter [16], TfdT in Burkholderia [12], NtdR in Acidovorax [17], and LinR in Sphingomonas [18]. The sequence alignment showed a high sequence conservation between the HTH domain of LpLttR and other LttRs, especially for the first 50 amino acid residues (Fig. 1B). This suggests that LpLttR might also directly bind to DNA regulatory regions and play a regulatory role in a variety of cellular processes, similar to other LttRs.
Fig. 1

LpLttR conservative analysis. A The illustration of the domain organization of LpLttR. LpLttR was composed of two domains: one HTH domain (position 3–64) at the N-terminal and one LysR substrate-binding domain (position 85–293) at the C-terminal. B Sequence conservatism analysis of the HTH domain of LttRs including CatR (Pseudomonas putida KT2440), ClcR (P. putida), CbnR (Ralstonia eutropha), TfdR (R. eutropha JMP134), CatR (P. putida), CatM (Acinetobacter) PcaQ (Agrobacterium), BenM (Acinetobacter), TfdT (Burkholderia), NtdR (Acidovorax), LinR (Sphingomonas), and LpLttR (Lactobacillus plantarum)

LpLttR conservative analysis. A The illustration of the domain organization of LpLttR. LpLttR was composed of two domains: one HTH domain (position 3–64) at the N-terminal and one LysR substrate-binding domain (position 85–293) at the C-terminal. B Sequence conservatism analysis of the HTH domain of LttRs including CatR (Pseudomonas putida KT2440), ClcR (P. putida), CbnR (Ralstonia eutropha), TfdR (R. eutropha JMP134), CatR (P. putida), CatM (Acinetobacter) PcaQ (Agrobacterium), BenM (Acinetobacter), TfdT (Burkholderia), NtdR (Acidovorax), LinR (Sphingomonas), and LpLttR (Lactobacillus plantarum)

LpLttR knockout strain construction

To study the function of LpLttR, we constructed the knockout strain(ΔLplttR) based on CRISPR-Cas9 gene editing technology. As shown in Fig. 2A, the upstream and downstream 1000 bp of LplttR were selected as the upstream and downstream homologous arms (Ha-1 and Ha-2), respectively. The homologous arms and sgRNA were inserted into the pLCNICK knockout plasmid. Verification primers were designed on both sides of the homologous arms to verify the transformers using colony PCR. As shown in Fig. 2B, the amplified product of the putative knockout strain (ΔLplttR) was approximately 1000 bp smaller than that of the WT, suggesting that the LplttR gene was deleted successfully. To study the effect of LplttR on bacterial growth, the growth curves of WT and ΔLplttR strains were investigated. As shown in Fig. 2C, during the first 24 h, the ΔLplttR strain grew slower than the WT but not thereafter.
Fig. 2

Construction of the LplttR knockout strain and its effects of on bacterial growth. A Schematic diagram of the LplttR knockout principle. Ha-1 and Ha-2 represent the upstream and downstream homologous arms respectively. The black arrows indicate the location of colony PCR primers used for verification. B Identification of LplttR knockout by colony PCR; C Effect of the LpLttR mutation on bacterial growth. Error bars indicate the standard deviations of three independent experiments

Construction of the LplttR knockout strain and its effects of on bacterial growth. A Schematic diagram of the LplttR knockout principle. Ha-1 and Ha-2 represent the upstream and downstream homologous arms respectively. The black arrows indicate the location of colony PCR primers used for verification. B Identification of LplttR knockout by colony PCR; C Effect of the LpLttR mutation on bacterial growth. Error bars indicate the standard deviations of three independent experiments

Identification of the LpLttR regulon

As the main family of transcriptional regulators in prokaryotes, LttRs regulate a variety of genes and even play a global regulatory role in P. aeruginosa, S. thermophilus, and Salmonella enterica [19-21]. To identify the regulons of LpLttR in L. plantarum, we analyzed the mRNA expression levels of WT and ΔLplttR. As shown in Fig. 3A, in ΔLplttR, there were 11 mRNAs with a fold difference of more than two- fold, of which the expression of nine genes were down-regulated. Among the differentially expressed genes, LP_RS15475 and LP_RS15480 expressions were down regulated most substantially (Fig. 3B), and were described as replication proteins and hypothetical proteins, respectively. The expression of LP_RS14775 and LP_RS14610, separately annotated as SLC45 family MFS transporter and IS1182 family transposase, were upregulated. The transcriptional levels of these 11 genes were analyzed using RT-qPCR. Although the genes differed with respect to fold-change, the trend of up-regulation and down-regulation was similar, thus, confirming the reliability of the transcriptome data. All of the differentially expressed genes and their descriptions are listed in Table 1. Base on the number and function of the differential genes, we inferred that unlike other LttRs, LpLttR did not play a global regulatory role in L. plantarum.
Fig. 3

Analysis of the target genes with more than twofold difference in expression. A Scatter plot of the differentially expressed genes. The X-axis and Y-axis represent the expression of genes in the WT and LplttR knockout strains. The values are all log-transformed. Each dot in the image represents a specific gene. The red dots indicate the up-regulated genes and green dots indicate the down-regulated genes. B Heatmap of the differentially expressed genes. Each column represents different strains and each row represents a gene. The depth of the color in the heatmap indicates the amount of the gene expression. For the specific amount of the expression, please see the digital label on the color bar

Table 1

Differential expressed genes with the difference more than twofold

Gene nameGene descriptionFC(ΔlttR/WT)
LP_RS00230LysR family transcriptional regulator0.291
LP_RS15475replication protein0
LP_RS15480hypothetical protein0
LP_RS14775SLC45 family MFS transporter2.198
LP_RS14610IS1182 family transposase100.747
LP_RS13240cell wall hydrolase/muramidase0.46
LP_RS11700MFS transporter0.443
LP_RS13245SH3 domain-containing protein0.47
LP_RS07440ABC transporter permease0.44
LP_RS01255LysM peptidoglycan-binding domain-containing protein0.423
LP_RS12305APC family permease0.436
Analysis of the target genes with more than twofold difference in expression. A Scatter plot of the differentially expressed genes. The X-axis and Y-axis represent the expression of genes in the WT and LplttR knockout strains. The values are all log-transformed. Each dot in the image represents a specific gene. The red dots indicate the up-regulated genes and green dots indicate the down-regulated genes. B Heatmap of the differentially expressed genes. Each column represents different strains and each row represents a gene. The depth of the color in the heatmap indicates the amount of the gene expression. For the specific amount of the expression, please see the digital label on the color bar Differential expressed genes with the difference more than twofold To further analyze the regulatory role of LpLttR in L. plantarum, we also analyzed the differentially expressed genes with a change of more than 1.5-fold. As shown in Table 2, there were 70 genes with a fold difference of more than 1.5-fold, with a P-value < 0.05. LpLttR mainly acted as a transcriptional activator, since 49 of the 70 differential genes were down-regulated, whereas the remaining 21 genes were up-regulated in ΔLplttR (Fig. 4A). The 70 differentially expressed genes were assigned to different groups based on KEGG pathway analysis. As shown in Fig. 4B, 12 genes participated in metabolism, nine in environmental information processing, three in genetic information processing, and three in human disease. Notably, eight of the environmental information processing genes were carbon transport and sensing related proteins, that were closely correlated with carbohydrate metabolism, especially the fatty acid metabolism (Table 3). The PTS sugar transporters (agaF and celB), galactose mutarotase (galM), glycoside hydrolase (bglA), fatty acid metabolism-related enzymes (fabD, fabZ, fabH), and several ABC transporter proteins (oppA, agaF, fliY, oppC, metI, and oppD) were under the control of LpLttR, suggesting that LpLttR might play an important role in carbohydrate metabolism in L. plantarum.
Table 2

Differential genes identified by transcriptome analysis

Gene nameGene descriptionTypeRegulateFC(ΔlttR/WT)
LP_RS14610IS1182 family transposasemRNAUp100.747
LP_RS14775SLC45 family MFS transportermRNAUp2.198
LP_RS15415DUF916 and DUF3324 domain-containing proteinmRNAUp1.935
LP_RS01010DUF871 domain-containing proteinmRNAUp1.931
LP_RS11220GntR family transcriptional regulatormRNAUp1.702
LP_RS12660Glycoside hydrolase family 1 proteinmRNAUp1.7
LP_RS01000PTS sugar transporter subunit IICmRNAUp1.696
LP_RS13760Hemolysin III family proteinmRNAUp1.613
treRTrehalose operon repressormRNAUp1.611
LP_RS01020DgaE family pyridoxal phosphate-dependent ammonia lyasemRNAUp1.572
LP_RS02110Serine transportermRNAUp1.57
spxTranscriptional regulator SpxmRNAUp1.541
LP_RS10520Hypothetical proteinmRNAUp1.535
LP_RS14565Galactose mutarotasemRNAUp1.532
LP_RS05750Aspartate-semialdehyde dehydrogenasemRNAUp1.52
LP_RS06040Hypothetical proteinmRNAUp1.512
LP_RS15420WxL domain-containing proteinmRNAUp1.512
LP_RS11200PTS sugar transporter subunit IIAmRNAUp1.506
LP_RS12525DUF916 and DUF3324 domain-containing proteinmRNAUp1.503
LP_RS05765NADH-dependent flavin oxidoreductasemRNAUp1.503
LP_RS00610Helix-turn-helix transcriptional regulatormRNAUp1.5
LP_RS05365Peptide ABC transporter substrate-binding proteinmRNADown0.668
LP_RS12020LysM peptidoglycan-binding domain-containing proteinmRNADown0.668
LP_RS13890HIT family proteinmRNADown0.663
LP_RS01675AraC family transcriptional regulatormRNADown0.659
LP_RS00140Hypothetical proteinmRNADown0.656
LP_RS00290ASCH domain-containing proteinmRNADown0.655
LP_RS06330Response regulator transcription factormRNADown0.654
LP_RS13055ABC transporter ATP-binding proteinmRNADown0.646
LP_RS06150DUF916 and DUF3324 domain-containing proteinmRNADown0.643
LP_RS06145LPXTG cell wall anchor domain-containing proteinmRNADown0.643
LP_RS05380ABC transporter ATP-binding proteinmRNADown0.642
mvkMevalonate kinasemRNADown0.642
LP_RS07140ACP S-malonyltransferasemRNADown0.637
LP_RS07130Ketoacyl-ACP synthase IIImRNADown0.636
LP_RS05375ABC transporter permeasemRNADown0.633
LP_RS11365LysR family transcriptional regulatormRNADown0.629
LP_RS07625GIY-YIG nuclease family proteinmRNADown0.625
fabZ3-hydroxyacyl-ACP dehydratase FabZmRNADown0.623
LP_RS05800Membrane proteinmRNADown0.619
LP_RS12295Helix-turn-helix transcriptional regulatormRNADown0.615
LP_RS04070MucBP domain-containing proteinmRNADown0.611
LP_RS04675AraC family transcriptional regulatormRNADown0.609
LP_RS08765Hypothetical proteinmRNADown0.609
LP_RS13480Transporter substrate-binding domain-containing proteinmRNADown0.606
LP_RS14300C40 family peptidasemRNADown0.603
LP_RS07570Ribonuclease HI family proteinmRNADown0.601
LP_RS12415Zinc ribbon domain-containing proteinmRNADown0.597
LP_RS12410Zinc-ribbon domain-containing proteinmRNADown0.59
LP_RS11005Viroplasmin family proteinmRNADown0.589
LP_RS11130Hypothetical proteinmRNADown0.583
LP_RS11350Aminotransferase class I/II-fold pyridoxal phosphate-dependent enzymemRNADown0.576
LP_RS12030Methylated-DNA–[protein]-cysteine S-methyltransferasemRNADown0.571
LP_RS153752-keto-4-pentenoate hydratasemRNADown0.558
LP_RS02570AEC family transportermRNADown0.544
LP_RS08575ISL3 family transposasemRNADown0.532
LP_RS13185YxeA family proteinmRNADown0.528
LP_RS13235Ldh family oxidoreductasemRNADown0.524
LP_RS12675LysM peptidoglycan-binding domain-containing proteinmRNADown0.521
LP_RS08270GNAT family N-acetyltransferasemRNADown0.511
LP_RS00810Peptide ABC transporter substrate-binding proteinmRNADown0.51
LP_RS13245SH3 domain-containing proteinmRNADown0.47
LP_RS13240Cell wall hydrolase/muramidasemRNADown0.46
LP_RS11700MFS transportermRNADown0.443
LP_RS07440ABC transporter permeasemRNADown0.44
LP_RS12305APC family permeasemRNADown0.436
LP_RS01255LysM peptidoglycan-binding domain-containing proteinmRNADown0.423
LP_RS00230LysR family transcriptional regulatormRNADown0.291
LP_RS15475Replication proteinmRNADown0
LP_RS15480Hypothetical proteinmRNADown0
Fig. 4

Analysis of the target genes with more than 1.5-fold difference. A Volcano diagram of the LpLttR regulon. Abscissa is the multiple change value of the difference of gene expression between the WT and LplttR knockout strains; namely the FC value. The ordinate is the statistical test value of the difference of gene expression, P value. Note the logarithmic scale of horizontal and vertical coordinates. Each dot in the picture represents a specific gene. B Functional annotation analysis of target genes. The ordinate is the name of the KEGG metabolic pathway, and the abscissa is the number of genes annotated to the pathway

Table 3

Differential genes involved in carbohydrate metabolism, lipid metabolism, and environmental information processing in KEGG pathway analysis

Gene IDDescriptionKO NameKO Description
Carbohydrate metabolism
LP_RS11200PTS sugar transporter subunit IIAagaFPTS system, N-acetylgalactosamine-specific IIA component [EC:2.7.1.-]
LP_RS14565galactose mutarotasegalMaldose 1-epimerase [EC:5.1.3.3]
LP_RS12660glycoside hydrolase family 1 proteinbglA6-phospho-beta-glucosidase [EC:3.2.1.86]
LP_RS01000PTS sugar transporter subunit IICcelBPTS system, cello
Lipid metabolism
LP_RS07140ACP S-malonyltransferasefabD[acyl-carrier-protein] S-malonyltransferase [EC:2.3.1.39]
fabZ3-hydroxyacyl-ACP dehydratase FabZfabZ3-hydroxyacyl-[acyl-carrier-protein] dehydratase [EC:4.2.1.59]
LP_RS07130ketoacyl-ACP synthase IIIfabH3-oxoacyl-[acyl-carrier-protein] synthase III [EC:2.3.1.180]
Environmental information processing
LP_RS05365peptide ABC transporter substrate-binding proteinoppAoligopeptide transport system substrate-binding protein
LP_RS13055ABC transporter ATP-binding proteiniron complex transport system ATP-binding protein [EC:3.6.3.34]
LP_RS11200PTS sugar transporter subunit IIAagaFPTS system, N-acetylgalactosamine-specific IIA component [EC:2.7.1.-]
LP_RS13480transporter substrate-binding domain-containing proteinfliYL-cystine transport system substrate-binding protein
LP_RS05375ABC transporter permeaseoppColigopeptide transport system permease protein
LP_RS07440ABC transporter permeasemetID-methionine transport system permease protein
LP_RS05380ABC transporter ATP-binding proteinoppDoligopeptide transport system ATP-binding protein
LP_RS01000PTS sugar transporter subunit IICcelBPTS system, cellobiose-specific IIC component
LP_RS06330response regulator transcription factornreCtwo-component system, NarL family, response regulator NreC
Differential genes identified by transcriptome analysis Analysis of the target genes with more than 1.5-fold difference. A Volcano diagram of the LpLttR regulon. Abscissa is the multiple change value of the difference of gene expression between the WT and LplttR knockout strains; namely the FC value. The ordinate is the statistical test value of the difference of gene expression, P value. Note the logarithmic scale of horizontal and vertical coordinates. Each dot in the picture represents a specific gene. B Functional annotation analysis of target genes. The ordinate is the name of the KEGG metabolic pathway, and the abscissa is the number of genes annotated to the pathway Differential genes involved in carbohydrate metabolism, lipid metabolism, and environmental information processing in KEGG pathway analysis

Preliminary exploration of the regulatory mechanism of LpLttR

To better understand the sequence characteristics of the LpLttR binding box, a MEME search was performed to analyze the conserved motifs. The binding motif of LpLttR was predicted using MEME (https://meme-suite.org/meme/) according to the binding sites reported in previous studies, including the LplttR and cla operon regulated by LpLttR in L. plantarum [8], catBCA regulated by CatR in P. putida [4], clcABD operon on plasmid pAC27 regulated by ClcR [9], tcbCDEF on plasmid pP51 controlled by TcbR of Pseudomonas sp. strain P51 [10], cbnABCD controlled by CbnR in R. eutropha [22], tfdA regulated by TfdR/S in R. eutropha JMP134 [5], catBCIJFD regulated by CatM in Acinetobacter sp. benABCDE controlled by BenM in Acinetobacter, and linE-linD regulated by LinR in Sphingomonas [23]. Default settings were used in the site distribution (zero or one occurrence per sequence (zoops)). As shown in Fig. 5A, the predicted motif of LpLttR possessed a conserved binding motif 5′- (A/T)TAC-n7-(G/A)( T/A) a(T/A) -3′.
Fig. 5

LpLttR binding sites analysis. A Detecting the conserved binding motif of LpLttR using the MEME online tool. The LttRs used as the MEME input included the LpLttR and cla operon regulated by LpLttR in Lactobacillus plantarum, catBCA regulated by CatR in Pseudomonas putida, clcABD operon on plasmid pAC27 regulated by ClcR, tcbCDEF on plasmid pP51 controlled by TcbR of Pseudomonas sp. strain P51, cbnABCD controlled by CbnR in Ralstonia eutropha, tfdA regulated by TfdR/S in R. eutropha JMP134, catBCIJFD regulated by CatM in Acinetobacter sp. benABCDE controlled by BenM in Acinetobacter, and linE-linD regulated by LinR in Sphingomonas. The motif count setting was searching for one motif. Motif width was between 6 and 50. B The predicted binding sites of LplttR on the target gene promoters. The operons of the differential genes were predicted by the website (http://www.microbesonline.org/operons/gnc220668.html). C Molecular interaction of LpLttR to the regulatory region of the target genes. Both the correspondence of the gene names annotated in KEGG database and that used in the transcriptome sequencing are listed. The interaction mainly contains two processes: association and dissociation. During the association process, the spectral interference shift increased, while the wavelength shift decreased during dissociation. Different colors represent different target gene promoters

LpLttR binding sites analysis. A Detecting the conserved binding motif of LpLttR using the MEME online tool. The LttRs used as the MEME input included the LpLttR and cla operon regulated by LpLttR in Lactobacillus plantarum, catBCA regulated by CatR in Pseudomonas putida, clcABD operon on plasmid pAC27 regulated by ClcR, tcbCDEF on plasmid pP51 controlled by TcbR of Pseudomonas sp. strain P51, cbnABCD controlled by CbnR in Ralstonia eutropha, tfdA regulated by TfdR/S in R. eutropha JMP134, catBCIJFD regulated by CatM in Acinetobacter sp. benABCDE controlled by BenM in Acinetobacter, and linE-linD regulated by LinR in Sphingomonas. The motif count setting was searching for one motif. Motif width was between 6 and 50. B The predicted binding sites of LplttR on the target gene promoters. The operons of the differential genes were predicted by the website (http://www.microbesonline.org/operons/gnc220668.html). C Molecular interaction of LpLttR to the regulatory region of the target genes. Both the correspondence of the gene names annotated in KEGG database and that used in the transcriptome sequencing are listed. The interaction mainly contains two processes: association and dissociation. During the association process, the spectral interference shift increased, while the wavelength shift decreased during dissociation. Different colors represent different target gene promoters Next, the regulatory regions of the differentially expressed genes that increased or decreased more than twice were analyzed using bioinformatics. As shown in Fig. 5B, the regulatory regions of LP_RS00230, LP_RS13240 (located in the same transcription unit with LP_RS13245), LP_RS11700, LP_RS07440, LP_RS01255, and LP_RS12305 contained the potential LttR binding motif, suggesting that the promoter of these genes might be directly bound to LpLttR. LP_RS15475 and LP_RS15480 were located on plasmids p0203 and p0203, respectively. The cis-element analysis of these two genes was not performed. To further verify whether LpLttR regulates the expression of these genes directly, we used the purified LpLttR-His protein and the regulatory region DNA of the target genes to carry out molecular interaction experiments. LP_RS14775, with no predicted LttR-binding motif, was used as the negative control. As shown in Fig. 5C, LpLttR had the strongest affinity to the promoter of LP_RS12305 (KD = 0.104 uM) and different degrees of binding with LP_RS00230, LP_RS13240, LP_RS11700, LP_RS07440, and LP_RS01255, but not with LP_RS14775, which was consistent with the results of the binding site analysis. The specific binding between LpLttR and its own promoter region suggested that LpLttR in Lactiplantibacillus plantarum was self-regulated, similar to other LttRs. These results suggested that LP_RS00230, LP_RS15475, LP_RS15480, LP_RS11700, LP_RS07440, and LP_RS12305 were directly regulated by LpLttR in L. plantarum.

Discussion

L. plantarum was one of the best studied lactobacilli; hundreds of studies and dozens of reviews have described its metabolism and regulation of metabolism. In our previous study, we found that the CLA biotransformation was transcriptionally regulated by LpLttR. However, the regulon of LpLttR in this species remained uncharacterized. In this study, we identified the regulon of LpLttR by transcriptomic analysis of the WT and LplttR knockout strains. LpLttR was highly conserved in sequence, and its knockout caused the transcriptional difference of 70 genes to be more than 1.5-fold, and 11 genes to be more than twofold. Many of the differentially expressed genes were mapped to the perception, metabolism, and transportation of carbon sources, revealing that LplttR might perform important functions in carbon metabolism. Through bioinformatics analysis and molecular interactions, we further verified that LpLttR directly regulated the expression of LP_RS00230, LP_RS13240, LP_RS11700, LP_RS07440, LP_RS01255, and LP_RS12305 by binding to the promoter regions. The binding motif consisted of a highly conserved consensus sequence: 5′-(A/T)TAC-N7-(G/A)( T/A) a(T/A)-3′. Our previous study showed that LplttR responded to LA and activated the transcription of cla-dh and cla-dc, promoting the biotransformation of CLA [8]. However, the LplttR regulon identified in this study does not contain cla-dh and cla-dc. This may be due to the difference in the culture media and conditions. The medium used in this study did not contain LA, under which condition the transcription of cla-dh and cla-dc was suppressed. According to previous studies, LttRs are often induced or suppressed by environmental or metabolic co-inducers, thus activating or inhibiting the expression of target genes. For example, the metabolic intermediates of aromatic compounds generally act as inducers of LttR in the regulation aromatic compound metabolism-related genes. It has even been shown that BenM could bind to different co-inducers leading to an altered protein conformation [1]. Therefore, the cellular processes in which LpLttR participates and its regulon may vary under different culture conditions.

Conclusions

In summary, we investigated the function and regulation of LplttR in L. plantarum. The sequence of LpLttR was highly conserved with that of other transcriptional regulators in this family. However, the knockout of LpLttR showed no significant effect on the bacterial growth. Coinciding with the growth, only 11 genes exhibited a more than twofold transcriptional increase. LP_RS00230, LP_RS13240, LP_RS11700, LP_RS07440, LP_RS01255, and LP_RS12305 were directly regulated by LpLttR. LpLttR regulated the transcription of these genes by binding to the conserved LttR box (5′- (A/T)TAC-N7-(G/A)( T/A) a(T/A) -3′). In this study, we systematically investigated the regulation of LplttR in L. plantarum and revealed that LpLttR regulated different genes and performed different functions in different species. These findings deepened our understanding of the regulatory mechanisms of LttRs and provided a theoretical basis for the metabolism and regulation mechanisms of L. plantarum.

Methods

Strains

The strains and plasmids used in the present study were listed in Table 4. L. plantarum ATCC BAA-793 and the derivate strains were cultured in MRS medium at 37 °C under aerobic conditions. E. coli BL21(DE3) was used for the expression and purification of LpLttR. It was cultured in LB medium at 37 °C, 200 rpm. The process of protein expression and purification has been described in a previous study [8].
Table 4

Strains and plasmids used in this study

Strain or plasmidCharacteristicSource or reference
Strains
Lactiplantibacillus plantarum ATCC BAA-793Wild type[25]
Lactiplantibacillus plantarum ATCC BAA-793 ΔLplttRLplttR deletion mutant strain[8]
Lactiplantibacillus plantarum ATCC BAA-793/pIB184-LplttRlttR overexpression strain, carrying pIB184 -LplttR[8]
E.coli BL21(DE3)Expression strainNovagen
Plasmid
pET28a-LplttRpET28a derivate carrying LplttR[8]
pIB184 -LplttRpIB 184 carrying LplttR for gene overexpression[8]
pLCNICK- LplttRUsed for LplttR deletion[8]
Strains and plasmids used in this study

RNA extraction

The WT and ΔLplttR strains were collected during the exponential growth period with three biological replicates. The bacteria were sent to Majorbio Bio-Pharm Technology Co., Ltd (Shanghai, China) for subsequent transcriptome sequencing. TRIzol® Reagent (Invitrogen) was used to extract the total RNA according to the manufacturer’s instructions. Agilent 2000 was used for the RNA quality determination, and Nanodrop2000 (NanoDrop Technologies) was used for the quantification. The integrity of RNA was assessed by agarose gel electrophoresis. Only high-quality RNA samples (OD260/280 = 1.8 ~ 2.0, OD260/230 ≥ 2.0, RIN ≥ 6.5, 23S:16S ≥ 1.0, Concentration ≥ 100 ng/μl, and total amount of RNA ≥ 2 μg) were used for subsequent library construction.

Library construction and transcriptome sequencing

The TruSeq™ Stranded Total RNA Library Prep Kit from Illumina (San Diego, CA, USA) was used to construct the library for the experiment. After removing rRNA and adding fragmentation buffer, mRNA was randomly broken into small fragments of approximately 200 nt. Under the action of reverse transcriptase, one-strand cDNA was synthesized using random primers and mRNA as templates. For the second strand synthesis, dUTP was used instead of dTTP to form the base of the second strand of cDNA containing dTTP. Before PCR amplification, the second strand of cDNA was digested with the UNG enzyme so that only the first strand of cDNA was included in the library. Finally, Illumina Hiseq × 10 (2 × 150 bp read length) was used for sequencing. Processing of the original images to sequences, base-calling, and quality value calculations were performed using the Illumina GA Pipeline (version 1.6), in which 150 bp paired-end reads were obtained.

Bioinformatics analysis

The data generated from the Illumina platform were used for bioinformatics analysis. All the analyses were carried out using the I-Sanger cloud platform (www.i-sanger.com) from Majorbio Bio-Pharm Technology Co., Ltd (Shanghai, China). Sequencing reads were compared to those in the Rfm database. The accession number of the reference genome was GCF_000203855.3. The transcriptome sequencing raw data in fastq format raw reads were deposited in the National Center for Biotechnology Information Sequence Read Archive (NCBI SRA) database (accession number: PRJNA751435).

Protein-DNA interaction

The regulatory regions of the target genes were amplified by PCR using the primers listed in Table 5. To label the DNA with biotin, a second PCR reaction was performed using a universal biotinylated primer (5′-biotin-AGCCAGTGGCGATAAG-3′). The PCR products were purified using a PCR purification kit (Shanghai Generay Biotech). The quality and concentration of the biotin-labelled DNA probe was analyzed using 1% agarose gel electrophoresis and a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific), respectively.
Table 5

Primers used in protein-DNA interaction

PrimersSequence (5’-3’)
0057-SAGCCAGTGGCGATAAGTTGGCATTTGCTGGTTC
0057-AAGCCAGTGGCGATAAGGTTCATTCACGTCAACGC
P0202-SAGCCAGTGGCGATAAGCGTGTTGATGTAAAATAACTTG
P0202-AAGCCAGTGGCGATAAGTTTCTTTTGCCATTTGTTAT
P0203-SAGCCAGTGGCGATAAGCTTAGAACGCAAAATATGAT
P0203-AAGCCAGTGGCGATAAGTAAAATACCACCTACCAAAT
3533-SAGCCAGTGGCGATAAGTTTTAAAATACGCTCCTGAG
3533-AAGCCAGTGGCGATAAGGCAGGTTGGTTCATGAGA
3151-SAGCCAGTGGCGATAAGACTGCCAACAATCACATC
3151-AAGCCAGTGGCGATAAGTTTCATAAAATATTCCTCCA
2768-SAGCCAGTGGCGATAAGTACAAACTATCAACCATAATTCG
2768-AAGCCAGTGGCGATAAGATGGCGAGTTCCTTTCG
1745-SAGCCAGTGGCGATAAGAGCCGTTGTTGGAATGC
1745-AAGCCAGTGGCGATAAGGATTGCCTCTGTCATAGTCTG
0302-SAGCCAGTGGCGATAAGCGGCTAATTTTCATCATTAG
0302-AAGCCAGTGGCGATAAGGGTTTTTGATCTTCATAATAATT
2920-SAGCCAGTGGCGATAAGCCATGCCACTAGCAACG
2920-AAGCCAGTGGCGATAAGGTGTGTTTTAAATCCATAGGC
Primers used in protein-DNA interaction The specificity of binding and affinity constant of LpLttR to the promoter of target genes were determined using the Octet system (Octet, ForteBio, USA) based on bio-membrane interference technology, according to the previous study [24]. The samples were added to the 96-well plates in a total volume of 200 μL. The reactions were performed at 37 °C with shaking at 1000 rpm. After loading with the biotinylated DNA, the streptavidin biosensors were transferred to His-LplttR solutions to associate, and then moved to running buffer to dissociate. The obtained data were processed by Octet Data Analysis version 7.0 using a 1:1 binding model.

RNA preparation and RT-PCR

L. plantarum and the derivate strains in the exponential growth period were collected by centrifugation at 4 °C. The total RNA was prepared and analyzed by qPCR as previously described [8]. The primers used for RT-PCR were listed in Table 6. Each PCR condition was performed in triplicate on the LightCycler 96 qRT-PCR system (Roche Diagnostics, Switzerland). The PCR procedure was as follows: 95 °C for 5 s, followed by 40 cycles of denaturation at 95 °C for 5 s and annealing at 60 °C for 30 s. 16S rRNA was used as the internal control. The obtained data was analyzed using analytical LightCycler 96 system, and the 2−ΔΔct method was used to calculate the transcriptional fold changes.
Table 6

Primers used in qRT-PCR

PrimersSequence (5′–3′)
0057-qPCR-sACTTTGGTCCCAGAACG
0057-qPCR-aGACGAGCGATGATAGGC
P0202-qPCR-sTGTTTGCGATTTGATTG
P0202-qPCR-aGCCATACTTGCGTTCCT
P0203-qPCR-sGAGCGTTTAATAGTGTTC
P0203-qPCR-aTTAGCAAGCCCGTCATC
3533-qPCR-sACGGTACGATTTGCTTG
3533-qPCR-aCTGCGATGAACATTGAGA
3151-qPCR-sACAAGGGAAAGCTGATC
3151-qPCR-aAGCACTGTTAGCCGTAA
2768-qPCR-sCTTGCTTTGCCTTGTCC
2768-qPCR-aGTTGCCGTAAATAAGTTGAT
3153-qPCR-sGCCATTCAAGATTACGA
3153-qPCR-aTGATAGGTGCAGATAAGG
1745-qPCR-sCGCTGGTTGCAGGAATA
1745-qPCR-aGCACCGAACGGAGTAAG
0302-qPCR-sATTAAGCCAAATGCAATCAC
0302-qPCR-aAAACCATAGGCACCAGA
2920-qPCR-sCACTGCTTGTCGGGTTA
2920-qPCR-aATGGGAATGTTGCTTGAT
qPCR-16S-FCACATTGGGACTGAGACACGG
qPCR-16S-RCGATGCACTTCTTCGGTTGAG
Primers used in qRT-PCR
  25 in total

1.  Crystal structure of a full-length LysR-type transcriptional regulator, CbnR: unusual combination of two subunit forms and molecular bases for causing and changing DNA bend.

Authors:  Shin Muraoka; Rumi Okumura; Naoto Ogawa; Takamasa Nonaka; Kiyotaka Miyashita; Toshiya Senda
Journal:  J Mol Biol       Date:  2003-05-02       Impact factor: 5.469

2.  Nucleotide sequencing and characterization of Pseudomonas putida catR: a positive regulator of the catBC operon is a member of the LysR family.

Authors:  R K Rothmel; T L Aldrich; J E Houghton; W M Coco; L N Ornston; A M Chakrabarty
Journal:  J Bacteriol       Date:  1990-02       Impact factor: 3.490

Review 3.  Structure and function of the LysR-type transcriptional regulator (LTTR) family proteins.

Authors:  Sarah E Maddocks; Petra C F Oyston
Journal:  Microbiology       Date:  2008-12       Impact factor: 2.777

4.  Development of a RecE/T-Assisted CRISPR-Cas9 Toolbox for Lactobacillus.

Authors:  He Huang; Xin Song; Sheng Yang
Journal:  Biotechnol J       Date:  2019-05-20       Impact factor: 4.677

5.  Characterization of the Pseudomonas sp. strain P51 gene tcbR, a LysR-type transcriptional activator of the tcbCDEF chlorocatechol oxidative operon, and analysis of the regulatory region.

Authors:  J R van der Meer; A C Frijters; J H Leveau; R I Eggen; A J Zehnder; W M de Vos
Journal:  J Bacteriol       Date:  1991-06       Impact factor: 3.490

6.  Dynamics of multigene expression during catabolic adaptation of Ralstonia eutropha JMP134 (pJP4) to the herbicide 2, 4-dichlorophenoxyacetate.

Authors:  J H Leveau; F König; H Füchslin; C Werlen; J R Van Der Meer
Journal:  Mol Microbiol       Date:  1999-07       Impact factor: 3.501

7.  The LysR-type transcriptional regulator LeuO controls expression of several genes in Salmonella enterica serovar Typhi.

Authors:  I Hernández-Lucas; A L Gallego-Hernández; S Encarnación; M Fernández-Mora; A G Martínez-Batallar; H Salgado; R Oropeza; E Calva
Journal:  J Bacteriol       Date:  2007-12-21       Impact factor: 3.490

8.  Nucleotide sequence and initial functional characterization of the clcR gene encoding a LysR family activator of the clcABD chlorocatechol operon in Pseudomonas putida.

Authors:  W M Coco; R K Rothmel; S Henikoff; A M Chakrabarty
Journal:  J Bacteriol       Date:  1993-01       Impact factor: 3.490

9.  Expression of the nitroarene dioxygenase genes in Comamonas sp. strain JS765 and Acidovorax sp. strain JS42 is induced by multiple aromatic compounds.

Authors:  Daniel J Lessner; Rebecca E Parales; Shakti Narayan; David T Gibson
Journal:  J Bacteriol       Date:  2003-07       Impact factor: 3.490

10.  Transcriptome profiling defines a novel regulon modulated by the LysR-type transcriptional regulator MexT in Pseudomonas aeruginosa.

Authors:  Zhe-Xian Tian; Emilie Fargier; Micheál Mac Aogáin; Claire Adams; Yi-Ping Wang; Fergal O'Gara
Journal:  Nucleic Acids Res       Date:  2009-12       Impact factor: 16.971

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.