Mila Daoud1,2,3, Pia Nora Broxtermann1,2,3, Fabian Schorn1,2,3, J Paul Werthenbach1,2,3, Jens Michael Seeger1,2,3, Lars M Schiffmann1,3,4, Kerstin Brinkmann5, Domagoj Vucic6, Thomas Tüting7, Cornelia Mauch8, Dagmar Kulms9,10, Paola Zigrino8, Hamid Kashkar1,2,3. 1. Faculty of Medicine and University Hospital of Cologne, Institute for Molecular Immunology, University of Cologne, Cologne, Germany. 2. Faculty of Medicine and University Hospital of Cologne, Center for Molecular Medicine Cologne (CMMC), University of Cologne, Cologne, Germany. 3. Cologne Excellence Cluster on Cellular Stress Responses in Aging-Associated Diseases (CECAD), University of Cologne, Cologne, Germany. 4. Faculty of Medicine and University Hospital of Cologne, Department of General, Visceral, Cancer and Transplant Surgery, University of Cologne, Cologne, Germany. 5. The Walter & Eliza Hall Institute of Medical Research (WEHI) and Department of Medical Biology, University of Melbourne, Melbourne, Vic., Australia. 6. Department of Early Discovery Biochemistry, Genentech, South San Francisco, CA, USA. 7. Laboratory of Experimental Dermatology, Department of Dermatology, University Hospital Magdeburg, Magdeburg, Germany. 8. Faculty of Medicine and University Hospital of Cologne, Department of Dermatology and Venereology, University of Cologne, Cologne, Germany. 9. Department of Dermatology, Experimental Dermatology, TU-Dresden, Dresden, Germany. 10. National Center for Tumor Diseases Dresden, TU-Dresden, Dresden, Germany.
Abstract
Elevated expression of the X-linked inhibitor of apoptosis protein (XIAP) has been frequently reported in malignant melanoma suggesting that XIAP renders apoptosis resistance and thereby supports melanoma progression. Independent of its anti-apoptotic function, XIAP mediates cellular inflammatory signalling and promotes immunity against bacterial infection. The pro-inflammatory function of XIAP has not yet been considered in cancer. By providing detailed in vitro analyses, utilising two independent mouse melanoma models and including human melanoma samples, we show here that XIAP is an important mediator of melanoma neutrophil infiltration. Neutrophils represent a major driver of melanoma progression and are increasingly considered as a valuable therapeutic target in solid cancer. Our data reveal that XIAP ubiquitylates RIPK2, involve TAB1/RIPK2 complex and induce the transcriptional up-regulation and secretion of chemokines such as IL8, that are responsible for intra-tumour neutrophil accumulation. Alteration of the XIAP-RIPK2-TAB1 inflammatory axis or the depletion of neutrophils in mice reduced melanoma growth. Our data shed new light on how XIAP contributes to tumour growth and provides important insights for novel XIAP targeting strategies in cancer.
Elevated expression of the X-linked inhibitor of apoptosis protein (XIAP) has been frequently reported in malignant melanoma suggesting that XIAP renders apoptosis resistance and thereby supports melanoma progression. Independent of its anti-apoptotic function, XIAP mediates cellular inflammatory signalling and promotes immunity against bacterial infection. The pro-inflammatory function of XIAP has not yet been considered in cancer. By providing detailed in vitro analyses, utilising two independent mouse melanoma models and including human melanoma samples, we show here that XIAP is an important mediator of melanoma neutrophil infiltration. Neutrophils represent a major driver of melanoma progression and are increasingly considered as a valuable therapeutic target in solid cancer. Our data reveal that XIAP ubiquitylates RIPK2, involve TAB1/RIPK2 complex and induce the transcriptional up-regulation and secretion of chemokines such as IL8, that are responsible for intra-tumour neutrophil accumulation. Alteration of the XIAP-RIPK2-TAB1 inflammatory axis or the depletion of neutrophils in mice reduced melanoma growth. Our data shed new light on how XIAP contributes to tumour growth and provides important insights for novel XIAP targeting strategies in cancer.
Cutaneous melanoma is a devastatingly aggressive malignancy arising through the transformation of melanocytes. If detected early, surgical excision with appropriate margins yields a favourable prognosis. Undetected tumour lesions however can grow and progress to invasive disease with a much less favourable course. Genetic, functional and biochemical studies suggested apoptosis resistance as one of the major drivers of melanoma progression (Soengas & Lowe, 2003). Elevated expression of the X‐linked inhibitor of apoptosis protein (XIAP) has been frequently associated with melanoma progression in patients (Emanuel et al, 2008; Hiscutt et al, 2010; Ayachi et al, 2019) and several previous studies indicated that XIAP targeting can promote susceptibility to apoptosis in melanoma cells (Lecis et al, 2010; Seeger et al, 2010b; Hornle et al, 2011). Together, these studies highlighted the therapeutic value of XIAP targeting strategies in melanoma treatments.X‐linked inhibitor of apoptosis protein consists of three Baculovirus IAP Repeat (BIR 1–3) motifs promoting protein–protein interaction and a Really Interesting New Gene (RING) domain (Liston et al, 1996; Uren et al, 1996; Farahani et al, 1997) which confers ubiquitin ligase (E3) activity (Yang et al, 2000; Nakatani et al, 2013). Initial studies identified BIR2, BIR3 and the linker element between BIR1 and BIR2 domains as the responsible caspase binding/inhibitory elements of XIAP rendering apoptosis resistance (Eckelman et al, 2006). Independently, XIAP has been long known to induce NFκB activation and MAP kinase signalling by involving TGFβ‐activated kinase 1 (TAK1) (Yamaguchi et al, 1999) upon direct interaction with the TAK1 binding protein (TAB1) via its BIR1 domain (Lu et al, 2007). Further studies showed that XIAP interacts via its BIR2 domain with the kinase domain of the receptor‐interacting protein kinase 2 (RIPK2), an adaptor of the NOD inflammatory signalling machinery (NFκB activation; Krieg et al, 2009; Heim et al, 2020). XIAP‐mediated NFκB activation was shown to involve its RING‐mediated ubiquitin ligase activity, characterising XIAP as an E3 ligase involved in cellular inflammatory signalling (Damgaard et al, 2012; Takeda et al, 2014). Conventional (Harlin et al, 2001) and conditional (Andree et al, 2014) ablation of Xiap in mice, however, did not cause phenotypic alteration indicating that the physiological role of XIAP as an anti‐apoptotic protein may be redundant or limited in scope (Kashkar, 2010; Seeger et al, 2010a; Silke & Vucic, 2014). XIAP‐deficient mice, however, were shown to be susceptible to bacterial infection identifying XIAP as a central mediator of innate immunity (Bauler et al, 2008; Prakash et al, 2010; Andree et al, 2014).Previous studies addressing the role of XIAP in melanoma mainly considered XIAP as an anti‐apoptotic factor enabling cancer cells to resist cytotoxic anti‐cancer therapy (Kashkar, 2010; Fulda & Vucic, 2012). These studies mainly involved tumour cell culture or xenograft mouse models and were therefore unable to explore the role of XIAP‐mediated inflammatory signalling in cancer and its effect on tumour cell crosstalk with the tissue environment or immune system. Here, we show that XIAP is an important component of tumour‐associated inflammation and melanoma growth by performing detailed in vitro studies and by utilising two independent in vivo mouse melanoma models. Our data indicate that the specific interactions with TAB1 and RIPK2 are decisive for XIAP in order to induce chemokine secretion in tumour cells. In particular, the secretion of interleukin‐8 (IL8) by melanoma cells and the subsequent neutrophil infiltration of melanomas are shown to be dependent on XIAP expression.
Results and Discussion
Lack of XIAP in B16 mouse melanoma reduces tumour growth without enhancing tumour cell apoptosis
In order to examine the role of XIAP in melanoma progression, we employed a syngeneic melanoma mouse model involving immune‐competent mice bearing B16 cutaneous melanomas (Coutelle et al, 2014; Witt et al, 2015; Schiffmann et al, 2020). Two XIAP knock‐out (XIAPKO) B16 melanoma cell lines were generated using CRISPR/Cas9 with two independent single guide RNAs (sgRNAs) targeting the Xiap gene at different sites (Fig 1A). Upon subcutaneous injection, both wild‐type and XIAPKO B16 cells formed palpable tumours in mice while tumour volumes were significantly reduced in XIAPKO tumour xenografts (Fig 1B). We did not detect any increase in apoptotic cell death in XIAPKO B16 tumours (staining of active caspase‐3; Fig 1C). Apoptotic propensity of XIAPKO B16 cells was also not altered in culture when cells were exposed to TNF or TRAIL (Fig EV1A and B). Furthermore, no alteration of cellular proliferation was observed in XIAPKO B16 melanoma cells (Fig EV1C). These observations suggested that the reduced tumour size in XIAPKO B16 melanoma cells was not caused by alterations in tumour cell proliferation/death.
Figure 1
XIAP promotes tumour growth without interfering with tumour cell apoptosis
Western blot analysis of B16F1 WT and two independent XIAPKO cell lines. Actin was used as a loading control.
Subcutaneous melanoma tumour growth in BL/6 WT mice (n = 5) using B16F1 WT and XIAPKO (clone1 and 2). Data are mean ± s.e.m. Two‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis.
Representative H&E (scale bar 50 µm) and fluorescent images of cl‐Caspase 3 staining in B16 WT and XIAPKO tumours. Nuclei were stained with DAPI (blue). Scale bar 100 µm. Quantification thereof (right panel). The average of cl‐Caspase 3 positive cells from 5 randomly selected areas of the tumour (5 mice per genotype) was represented. Dots represent individual mice (n = 5). Data are presented as mean ± s.e.m. Mann–Whitney, two‐tailed test analysis.
qRT–PCR analysis (PrimePCR™ Assay) of different cyto‐/chemokines in B16F1 WT cells plotted vs B16F1‐XIAPKO cells (clone1 and 2). Samples that are at least 2‐fold up‐regulated are shown in red, samples that are at least 2‐fold down‐regulated are shown in green.
IL8 measurement in the supernatant of the indicated cell lines after 48 h transfection with siScr (control) or siXIAP and Western blot analysis of the corresponding cell lysates (bottom). One‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis.
IL8 measurement in the supernatant of the indicated cell lines after 24 h of seeding the cells. Unpaired t‐test, two‐tailed analysis.
qRT–PCR analysis (PrimePCRTM Assay) of different cyto‐/chemokines in HEK293T cells overexpressing myc‐XIAP plotted vs HEK293T cells overexpressing myc‐XIAPΔRING. Samples that are at least 2‐fold up‐regulated are shown in red, samples that are at least 2‐fold down‐regulated are shown in green.
Human cytokines array analysis of HEK293T cells transfected with myc‐XIAP or myc‐XIAPΔRING. Medium was changed after 16 h and the supernatant was collected after 48 h. Pre‐spotted nitrocellulose membranes were incubated with the supernatants overnight at 4°C.
Data information: In E and F, data are presented as mean ± SD. Dots represent individual biological replicates. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001 and ns, not significant.
Source data are available online for this figure.
Figure EV1
XIAP promotes tumour growth without interfering with tumour cell apoptosis
Representative Incucyte images and cell death measurements using Sytox Green in B16F1 WT and XIAPKO (clone 1 and 2) cells after 24 h treatment with 100 ng/ml TNF. DMSO was used as a negative control. Scale bar 200 µm. 2 mM H2O2 was used as a positive control. Scale bar 400 µm.
Incucyte cell death measurements using Sytox Green in B16F1 WT and XIAPKO (clone 1 and 2) cells after 24 h treatment with 50 ng/ml TRAIL. DMSO was used as a negative control. 2 mM H2O2 was used as a positive control.
Cell proliferation analysis using CSFE intensity (FACS analysis) (left) or using Incucyte Live‐Cell‐Analysis assay (right) examining the proliferation of B16F1 WT and XIAPKO CRISPR–Cas9 clones.
qRT–PCR analysis of Cxcl1 (KC) and Cxcl10 in B16F1 WT and XIAPKO (clone 1 and 2) cells.
Western blot analysis of cell lysates of BLM WT, XIAPKO, SK‐Mel28 WT, SK‐Mel28‐XIAPKO, Colo38 WT, Colo38‐XIAPKO, HCT116 WT and HCT116‐XIAPKO after CRISPR–Cas9 gene editing.
IL8 measurement in the supernatant of SK‐Mel28 and M5 after 48 h siRNA transfection (F) or after 24 h of seeding BLM, BLM‐XIAPKO, SK‐Mel28, and SK‐Mel28‐XIAPKO cells (G). Cells were treated with 20 ng/ml TNF for 8 h.
Data information: In A, B and C (right panel) data are mean ± s.e.m; two‐way analysis of variance (ANOVA) followed by Tukey’s post‐analysis. Data derived from three individual biological replicates. In C (left), D, F and G, data are presented as mean ± SD. One‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis. Dots represent individual biological replicates. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001 and ns, not significant.
Source data are available online for this figure.
XIAP promotes tumour growth without interfering with tumour cell apoptosis
Western blot analysis of B16F1 WT and two independent XIAPKO cell lines. Actin was used as a loading control.Subcutaneous melanoma tumour growth in BL/6 WT mice (n = 5) using B16F1 WT and XIAPKO (clone1 and 2). Data are mean ± s.e.m. Two‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis.Representative H&E (scale bar 50 µm) and fluorescent images of cl‐Caspase 3 staining in B16 WT and XIAPKO tumours. Nuclei were stained with DAPI (blue). Scale bar 100 µm. Quantification thereof (right panel). The average of cl‐Caspase 3 positive cells from 5 randomly selected areas of the tumour (5 mice per genotype) was represented. Dots represent individual mice (n = 5). Data are presented as mean ± s.e.m. Mann–Whitney, two‐tailed test analysis.qRT–PCR analysis (PrimePCR™ Assay) of different cyto‐/chemokines in B16F1 WT cells plotted vs B16F1‐XIAPKO cells (clone1 and 2). Samples that are at least 2‐fold up‐regulated are shown in red, samples that are at least 2‐fold down‐regulated are shown in green.IL8 measurement in the supernatant of the indicated cell lines after 48 h transfection with siScr (control) or siXIAP and Western blot analysis of the corresponding cell lysates (bottom). One‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis.IL8 measurement in the supernatant of the indicated cell lines after 24 h of seeding the cells. Unpaired t‐test, two‐tailed analysis.qRT–PCR analysis (PrimePCRTM Assay) of different cyto‐/chemokines in HEK293T cells overexpressing myc‐XIAP plotted vs HEK293T cells overexpressing myc‐XIAPΔRING. Samples that are at least 2‐fold up‐regulated are shown in red, samples that are at least 2‐fold down‐regulated are shown in green.Human cytokines array analysis of HEK293T cells transfected with myc‐XIAP or myc‐XIAPΔRING. Medium was changed after 16 h and the supernatant was collected after 48 h. Pre‐spotted nitrocellulose membranes were incubated with the supernatants overnight at 4°C.Data information: In E and F, data are presented as mean ± SD. Dots represent individual biological replicates. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001 and ns, not significant.Source data are available online for this figure.Representative Incucyte images and cell death measurements using Sytox Green in B16F1 WT and XIAPKO (clone 1 and 2) cells after 24 h treatment with 100 ng/ml TNF. DMSO was used as a negative control. Scale bar 200 µm. 2 mM H2O2 was used as a positive control. Scale bar 400 µm.Incucyte cell death measurements using Sytox Green in B16F1 WT and XIAPKO (clone 1 and 2) cells after 24 h treatment with 50 ng/ml TRAIL. DMSO was used as a negative control. 2 mM H2O2 was used as a positive control.Cell proliferation analysis using CSFE intensity (FACS analysis) (left) or using Incucyte Live‐Cell‐Analysis assay (right) examining the proliferation of B16F1 WT and XIAPKO CRISPR–Cas9 clones.qRT–PCR analysis of Cxcl1 (KC) and Cxcl10 in B16F1 WT and XIAPKO (clone 1 and 2) cells.Western blot analysis of cell lysates of BLM WT, XIAPKO, SK‐Mel28 WT, SK‐Mel28‐XIAPKO, Colo38 WT, Colo38‐XIAPKO, HCT116 WT and HCT116‐XIAPKO after CRISPR–Cas9 gene editing.IL8 measurement in the supernatant of SK‐Mel28 and M5 after 48 h siRNA transfection (F) or after 24 h of seeding BLM, BLM‐XIAPKO, SK‐Mel28, and SK‐Mel28‐XIAPKO cells (G). Cells were treated with 20 ng/ml TNF for 8 h.Data information: In A, B and C (right panel) data are mean ± s.e.m; two‐way analysis of variance (ANOVA) followed by Tukey’s post‐analysis. Data derived from three individual biological replicates. In C (left), D, F and G, data are presented as mean ± SD. One‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis. Dots represent individual biological replicates. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001 and ns, not significant.Source data are available online for this figure.
XIAP mediates IL8 secretion in melanoma by involving TAB1 and RIPK2
Independent of its anti‐apoptotic function, XIAP promotes inflammatory signalling and cytokine secretion, which can potentially support tumour growth (Coussens & Werb, 2002). Cytokine/chemokine transcripts were investigated in two independent XIAPKO cell lines versus wild type B16 (Appendix Table S1 and S2). This analysis revealed that transcripts of C‐X‐C motif chemokine ligand (CXCL) family including CXCL1 (also called melanoma growth stimulating activity α (MGSA‐α), neutrophil‐activating protein 3 (NAP‐3) or keratinocytes‐derived chemokine (KC) in mice) and CXCL10 were reduced in XIAPKO B16 melanoma cells (Figs 1D and EV1D).CXCL family members such as CXCL1 and IL8 have been frequently described in human melanoma progression and their expression has been tightly associated with tumour growth and Breslow thickness (Cesati et al, 2020). In line, knock‐down of XIAP using specific siRNAs (Seeger et al, 2010a, 2010b) or XIAP knock‐out by CRISPR/Cas9 technology in human melanoma cells consistently reduced IL8 secretion in all tested human tumour cells under steady‐state conditions (Figs 1E and F and EV1E). IL8 secretion can also be induced under inflammatory condition such as exposure to tumour necrosis factor (TNF; Abreu‐Martin et al, 1995). XIAP knock‐down or knock‐out could also reduce TNF‐induced IL8 secretion in the majority of tested cells; however, it failed to completely diminish IL8 secretion in response to TNF (Fig EV1F and G). These observations suggest that TNF promotes IL8 secretion not exclusively by involving XIAP. Independently, overexpression of myc‐tagged XIAP (myc‐XIAP), but not myc‐XIAPΔRING lacking the Ub‐ligase activity, required for XIAP‐mediated inflammatory signalling (Silke & Vucic, 2014), prominently induced transcriptional up‐regulation and secretion of IL8 in HEK293T cells (Fig 1G and H, and Appendix Table S3). In line with previous studies (Hofer‐Warbinek et al, 2000; Goncharov et al, 2018), these data indicated that the elevated XIAP expression which is frequently seen in melanoma (Emanuel et al, 2008) can alone promote IL8 secretion. These results, however, do not exclude possible involvement of further extrinsic cues within the melanoma environment which could additionally boost IL8 production.In addition to the RING domain, the deletion of BIR1 and BIR2, but not BIR3, efficiently diminished IL8 production in HEK293 cells ectopically expressing myc‐XIAP (Fig EV2A). BIR1 and BIR2 interaction with TAB1 and RIPK2, respectively, have previously been shown to induce NFκB activation (Yamaguchi et al, 1999; Lu et al, 2007). Our data showed that ectopically expressed myc‐XIAP in HCT116 (Fig EV2B) or endogenously expressed XIAP in BLM melanoma cells (Fig 2A) interacts with RIPK2 and TAB1. Further analysis showed that GFP‐XIAP co‐localises with TAB1 and RIPK2 (Fig 2B). The co‐localisation of GFP‐XIAP with TAB1 was dependent on BIR1 domain. BIR2 domain was required for the co‐localisation of GFP‐XIAP with RIPK2 (Fig EV2C). Upon binding, XIAP was previously shown to ubiquitylate RIPK2 (Damgaard et al, 2012). In a cell‐free ubiquitylation assay (Albert et al, 2020) using recombinant XIAP and RIPK2 proteins, our data also showed that XIAP efficiently ubiquitylated RIPK2 (Fig 2C). RIPK2 ubiquitylation was markedly reduced in human and mouse melanoma cells lacking XIAP, together indicating that XIAP in melanoma ubiquitylates RIPK2 (Fig 2D).
Figure EV2
XIAP mediates IL8 secretion in melanoma by involving TAB1 and RIPK2
IL8 measurement in the supernatant of transfected HEK293T cells after 24 h. Western blot analysis of cell lysates of HEK293T cells transfected with the indicated plasmids (bottom).
Western blot analysis of cell lysates (input) and myc‐IP of HCT116 cells transfected with pcDNA as a negative control or myc‐XIAP for 24 h.
Confocal microscopic analysis of HeLa cells transfected with the indicated plasmids for 16 h and stained for TAB1 or RIPK2 (red). Nuclei were stained with DAPI (blue). Scale bar 20 µm.
IL8 measurement in the supernatant of transfected HCT116 WT, XIAPKO, RIPK2KO and TAB1KO cells after 24 h. One‐way analysis of variance (ANOVA) followed by Sidak’s post‐analysis. Western blot analysis of cell lysates of the respective cell lines transfected with the indicated plasmids (bottom).
IL8 measurement in the supernatant of transfected HCT‐RIPK2KO (E) or HCT‐TAB1KO (F) cells after 24 h. Western blot analysis of cell lysates of HCT‐RIPK2KO and HCT‐TAB1KO cells transfected with the indicated plasmids.
IL8 measurement in the supernatant of BLM and SK‐Mel28 after siRNA transfection (48 h).
IL8 measurement in the supernatant of HCT116 cells transfected with the indicated siRNA for 48 h and treated with DMSO (control) or MDP for 24 h.
Data information: In A, D, E, F, G, and H, data are presented as mean ± SD. In A, E, F, G and H one‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis. In A, D, E, F, G, and H, dots represent individual biological replicates. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001 and ns, not significant.
Source data are available online for this figure.
Figure 2
XIAP mediates IL8 secretion in melanoma by involving TAB1 and RIPK2
Western blot analysis of cell lysates of BLM and BLM‐XIAPKO cells (input) and XIAP‐IP. Data are representative of two experiments.
Confocal microscopic analysis of transfected HCT116 cells with GFP‐XIAP for 16 h and stained for TAB1 or RIPK2 (red). Nuclei were stained with DAPI (blue). Scale bar 20 µm.
Cell‐free ubiquitylation assay of recombinant GST‐RIPK2 by Flag‐XIAP after addition of respective E1/E2 and recombinant ubiquitin. Poly‐ubiquitylated RIPK2 and XIAP were detected by Western blotting.
Western blot analysis of cell lysates of BLM, BLM‐XIAPKO, SK‐Mel28, SK‐Mel28‐XIAPKO, B16, and B16‐XIAPKO cells (input) and RIPK2‐IP. Poly‐ubiquitin is detected using anti‐ubiquitin antibody.
IL8 measurement in the supernatant of transfected BLM (left panel) or SK‐Mel28 (right panel) cells with siScr (control), siXIAP, siTAB1 or siRIPK2 after 48 h. Western blot analysis of the respective cell lysates of BLM cells (left bottom) or SK‐Mel28 cells (right bottom) transfected with the indicated siRNA.
IL8 measurement in the supernatant of BLM or SK‐Mel28 treated with 2 µM d89 (BIR2 antagonist) or DMSO as a negative control for 24 h.
IL8 measurement in the supernatant of BLM or SK‐Mel28 treated with 20 µM birinapant (Bir), 2 µM BV6 (both BIR3 antagonist) or DMSO as a negative control for 24 h.
Data information: In E, F and G, dots represent individual biological replicates. Data are presented as mean ± SD. Unpaired t‐test, two‐tailed test analysis (F) or One‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis (E and G). *P < 0.05; **P < 0.01; ***P < 0.001 and ****P < 0.0001.
Source data are available online for this figure.
XIAP mediates IL8 secretion in melanoma by involving TAB1 and RIPK2
IL8 measurement in the supernatant of transfected HEK293T cells after 24 h. Western blot analysis of cell lysates of HEK293T cells transfected with the indicated plasmids (bottom).Western blot analysis of cell lysates (input) and myc‐IP of HCT116 cells transfected with pcDNA as a negative control or myc‐XIAP for 24 h.Confocal microscopic analysis of HeLa cells transfected with the indicated plasmids for 16 h and stained for TAB1 or RIPK2 (red). Nuclei were stained with DAPI (blue). Scale bar 20 µm.IL8 measurement in the supernatant of transfected HCT116 WT, XIAPKO, RIPK2KO and TAB1KO cells after 24 h. One‐way analysis of variance (ANOVA) followed by Sidak’s post‐analysis. Western blot analysis of cell lysates of the respective cell lines transfected with the indicated plasmids (bottom).IL8 measurement in the supernatant of transfected HCT‐RIPK2KO (E) or HCT‐TAB1KO (F) cells after 24 h. Western blot analysis of cell lysates of HCT‐RIPK2KO and HCT‐TAB1KO cells transfected with the indicated plasmids.IL8 measurement in the supernatant of BLM and SK‐Mel28 after siRNA transfection (48 h).IL8 measurement in the supernatant of HCT116 cells transfected with the indicated siRNA for 48 h and treated with DMSO (control) or MDP for 24 h.Data information: In A, D, E, F, G, and H, data are presented as mean ± SD. In A, E, F, G and H one‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis. In A, D, E, F, G, and H, dots represent individual biological replicates. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001 and ns, not significant.Source data are available online for this figure.Western blot analysis of cell lysates of BLM and BLM‐XIAPKO cells (input) and XIAP‐IP. Data are representative of two experiments.Confocal microscopic analysis of transfected HCT116 cells with GFP‐XIAP for 16 h and stained for TAB1 or RIPK2 (red). Nuclei were stained with DAPI (blue). Scale bar 20 µm.Cell‐free ubiquitylation assay of recombinant GST‐RIPK2 by Flag‐XIAP after addition of respective E1/E2 and recombinant ubiquitin. Poly‐ubiquitylated RIPK2 and XIAP were detected by Western blotting.Western blot analysis of cell lysates of BLM, BLM‐XIAPKO, SK‐Mel28, SK‐Mel28‐XIAPKO, B16, and B16‐XIAPKO cells (input) and RIPK2‐IP. Poly‐ubiquitin is detected using anti‐ubiquitin antibody.IL8 measurement in the supernatant of transfected BLM (left panel) or SK‐Mel28 (right panel) cells with siScr (control), siXIAP, siTAB1 or siRIPK2 after 48 h. Western blot analysis of the respective cell lysates of BLM cells (left bottom) or SK‐Mel28 cells (right bottom) transfected with the indicated siRNA.IL8 measurement in the supernatant of BLM or SK‐Mel28 treated with 2 µM d89 (BIR2 antagonist) or DMSO as a negative control for 24 h.IL8 measurement in the supernatant of BLM or SK‐Mel28 treated with 20 µM birinapant (Bir), 2 µM BV6 (both BIR3 antagonist) or DMSO as a negative control for 24 h.Data information: In E, F and G, dots represent individual biological replicates. Data are presented as mean ± SD. Unpaired t‐test, two‐tailed test analysis (F) or One‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis (E and G). *P < 0.05; **P < 0.01; ***P < 0.001 and ****P < 0.0001.Source data are available online for this figure.Ubiquitylated RIPK2 serves as binding platform for TAK1/TAB1 complex which initiates inflammatory signalling ultimately leading to IL8 secretion (Hofer‐Warbinek et al, 2000; Hasegawa et al, 2008; Heim et al, 2020). In order to examine the role of TAB1 and RIPK2 in XIAP‐mediated IL8 secretion, we generated HCT116 cell lines lacking either TAB1 or RIPK2 by using CRISPR/Cas9 gene editing. Our data showed that TAB1 or RIPK2 knock‐out efficiently reduced IL8 secretion in HCT116 cells ectopically expressing myc‐XIAP (Fig EV2D–F). In addition to the results obtained in the model cell line HCT116, specific knock‐down of TAB1 or RIPK2 in melanoma cells BLM or SK‐Mel28 efficiently reduced IL8 secretion (Fig 2E). In contrast, the knock‐down of upstream signalling component NOD1 or XIAP binding partners, caspase‐3 and caspase‐7, did not interfere with IL8 secretion in melanoma cells (Fig EV2G). These data indicate that XIAP in melanoma cells utilises its BIR1 and BIR2 domains, involves TAB1 and RIPK2 and induces inflammatory signalling ultimately yielding IL8 secretion. Accordingly, a recently developed XIAP antagonist XB2d89, which specifically targets the BIR2 domain of XIAP (Goncharov et al, 2018) could efficiently block IL8 secretion in melanoma cells (Fig 2F). In contrast, previously reported IAP antagonists such as birinapant and BV6, which target BIR3 domain of XIAP, could not abolish, and even increased IL8 secretion in BLM melanoma cells (Fig 2G) presumably, by targeting cIAP1 and cIAP2 and activation of the non‐canonical NFκB (Varfolomeev & Vucic, 2008; Goncharov et al, 2018).Previous data identified XIAP as a critical component of the intracellular pathogen receptor nucleotide‐binding and oligomerisation domains (NOD)1/2 signalling which was engaged upon intracellular bacterial infection and causing IL8 secretion (Krieg et al, 2009; Andree et al, 2014). In line with these results, our data showed that the exposure of cells to the bacterial peptidoglycan muramyl dipeptide (MDP) induced IL8 secretion which was dependent on the expression of XIAP, TAB1 and RIPK2 (Fig EV2H).
XIAP induces neutrophil infiltration and supports melanoma growth by involving TAB1 and RIPK2
In order to study the involvement of XIAP‐BIR1 and XIAP‐BIR2 domains in melanoma tumour growth, we generated B16 melanoma cell lines lacking XIAP‐BIR1 (XIAPΔBIR1) or ‐BIR2 (XIAPΔBIR2) domain using CRISPR/Cas9 gene editing (Fig EV3A). Similar to XIAPKO, genetic ablation of XIAP‐BIR1 or XIAP‐BIR2 domain markedly reduced B16 melanoma tumour growth in mice (Fig 3A). Importantly, the deletion of BIR1 domain resulted in reduced expression levels/detection of XIAPΔBIR1 protein in cell lysates. The analysis of mRNA level of XIAP however did not reveal any marked reduction in the expression level of XIAPΔBIR1 (Fig EV3B). The observed discrepancy may be caused by altered epitope accessibility for the used anti‐XIAP antibodies or increased XIAP protein turnover/degradation upon ablation of BIR1 domain. In order to further evaluate our observations using XIAPΔBIR1/2 cells, we generated B16 melanoma cell lines lacking TAB1 (TAB1KO) or RIPK2 (RIPK2KO) (Fig EV3C). Similar to XIAPΔBIR1/2 cells, ablation of TAB1 or RIPK2 reduced B16 melanoma tumour growth in mice (Fig 3B). We were not able to detect any increase in active caspase‐3 staining in these tumours (Fig EV3D). Cell death/proliferation was also not altered in cultured tumour cells (Incucyte analysis) (Fig EV3E and F). Similar to the data obtained from cultured melanoma cells (Fig 1), lower levels of Cxcl1 (KC) and Cxcl10 were consistently detected in mouse melanoma tumours lacking XIAP, TAB1 or RIPK2 (Fig 3C). These data collectively indicate that XIAP supports melanoma growth by activating down‐stream inflammatory signalling cascades involving TAB1 and RIPK2.
Figure EV3
XIAP BIR1‐ and ‐BIR2 support melanoma growth via TAB1‐ and RIPK2‐dependent signalling
Western blot analysis of cell lysates of B16F1 WT, B16F1‐XIAPKO (clone 1 and 2), B16F1‐XIAP∆BIR1 (clone 1 and 2), and B16F1‐XIAP∆BIR2 (clone 1 and 2) after CRISPR–Cas9 gene editing.
mRNA expression level of Xiap in B16 melanoma cells. Dots represent individual biological replicates. Data are presented as mean ± SD.
Western blot analysis of cell lysates of B16F1 WT, B16F1‐XIAPKO (clone 1 and 2), B16F1‐TAB1KO and B16F1‐RIPK2KO (clone 1 and 2) after CRISPR–Cas9 gene editing.
Representative fluorescent images of cl‐Caspase 3+ cells in B16F1 WT, XIAPKO, TAB1KO or RIPK2KO melanoma tumours. Nuclei were stained with DAPI (blue). Scale bar 100 µm. Quantification thereof (lower panel). The average of cl‐Caspase 3 positive cells from 5 randomly selected areas of the tumour (5 mice per genotype) was represented. Dots represent individual mice (n = 5). Data are presented as mean ± s.e.m.
Cell death measurement of B16F1 WT, TAB1KO and RIPK2KO (clone 1 and 2) cells using Incucyte analysis after 24 h treatment with DMSO as a negative control or 100 ng/ml TNF. H2O2 treatment serves as a positive control. Scale bar 200 µm.
Proliferation assay using Incucyte Live‐Cell‐Analysis assay.
Data information: In B, and D one‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis. In E and F, data are presented as mean ± s.e.m; two‐way analysis of variance (ANOVA) followed by Tukey’s post‐analysis. Data derived from three individual biological replicates. ****P < 0.0001 and ns, not significant.
Source data are available online for this figure.
Figure 3
XIAP BIR1‐ and ‐BIR2 support melanoma growth via TAB1‐ and RIPK2‐dependent signalling
B16F1 WT, B16F1‐XIAP∆BIR1 and B16F1‐XIAP∆BIR2 subcutaneous melanoma tumour growth in BL/6 WT mice (n = 3 each genotype).
B16F1 WT, B16F1‐XIAPKO (clone 1 and 2), B16F1‐TAB1KO and B16F1‐RIPK2KO (clone 1 and 2) subcutaneous melanoma tumour growth in BL/6 WT mice (n = 5 each genotype).
qRT–PCR analysis of different cytokines/chemokines in the indicated melanoma tumours in mice. Dots represent individual mice (n = 3). Data are presented as mean ± SD. One‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis.
Data information: In A and B data are mean ± s.e.m; two‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001 and ns, not significant.
XIAP BIR1‐ and ‐BIR2 support melanoma growth via TAB1‐ and RIPK2‐dependent signalling
Western blot analysis of cell lysates of B16F1 WT, B16F1‐XIAPKO (clone 1 and 2), B16F1‐XIAP∆BIR1 (clone 1 and 2), and B16F1‐XIAP∆BIR2 (clone 1 and 2) after CRISPR–Cas9 gene editing.mRNA expression level of Xiap in B16 melanoma cells. Dots represent individual biological replicates. Data are presented as mean ± SD.Western blot analysis of cell lysates of B16F1 WT, B16F1‐XIAPKO (clone 1 and 2), B16F1‐TAB1KO and B16F1‐RIPK2KO (clone 1 and 2) after CRISPR–Cas9 gene editing.Representative fluorescent images of cl‐Caspase 3+ cells in B16F1 WT, XIAPKO, TAB1KO or RIPK2KO melanoma tumours. Nuclei were stained with DAPI (blue). Scale bar 100 µm. Quantification thereof (lower panel). The average of cl‐Caspase 3 positive cells from 5 randomly selected areas of the tumour (5 mice per genotype) was represented. Dots represent individual mice (n = 5). Data are presented as mean ± s.e.m.Cell death measurement of B16F1 WT, TAB1KO and RIPK2KO (clone 1 and 2) cells using Incucyte analysis after 24 h treatment with DMSO as a negative control or 100 ng/ml TNF. H2O2 treatment serves as a positive control. Scale bar 200 µm.Proliferation assay using Incucyte Live‐Cell‐Analysis assay.Data information: In B, and D one‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis. In E and F, data are presented as mean ± s.e.m; two‐way analysis of variance (ANOVA) followed by Tukey’s post‐analysis. Data derived from three individual biological replicates. ****P < 0.0001 and ns, not significant.Source data are available online for this figure.B16F1 WT, B16F1‐XIAP∆BIR1 and B16F1‐XIAP∆BIR2 subcutaneous melanoma tumour growth in BL/6 WT mice (n = 3 each genotype).B16F1 WT, B16F1‐XIAPKO (clone 1 and 2), B16F1‐TAB1KO and B16F1‐RIPK2KO (clone 1 and 2) subcutaneous melanoma tumour growth in BL/6 WT mice (n = 5 each genotype).qRT–PCR analysis of different cytokines/chemokines in the indicated melanoma tumours in mice. Dots represent individual mice (n = 3). Data are presented as mean ± SD. One‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis.Data information: In A and B data are mean ± s.e.m; two‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001 and ns, not significant.Members of the CXCL chemokine family, including CXCL1 and CXCL8 (IL8), represent mediators of neutrophil chemotaxis and promote melanoma growth and progression (Payne & Cornelius, 2002; Jensen et al, 2012). Melanoma infiltration by neutrophils is associated with poor prognosis (Bodey et al, 1996; Damgaard et al, 2012) and hence the neutrophil count serves as an important tumour biomarker (Masucci et al, 2019). Analysis of neutrophil infiltration (CD177 expression) in tumour samples derived from melanoma patients showed that increased XIAP expression in tumour cells is tightly associated with intra‐tumour neutrophil infiltration (Fig 4A, Appendix Table S4).
Figure 4
XIAP‐RIPK2‐TAB1 axis supports neutrophil infiltration and melanoma growth in B16 mouse melanoma
Intensities of CD177 and XIAP immunostainings in tumour sections from 55 patients were visually scored. The numbers of melanomas with different intensities were plotted into the table as a percentage of the total. Specific staining intensity for XIAP and CD177, corresponding to relative amounts of infiltrated neutrophils, was arbitrarily set as the following: −, not expressed; +, low; ++, moderate; and +++, strong expression. Representative IHC pictures (right panel). Scale bar 100 µm.
Representative IF (neutrophils staining) in B16F1 WT, XIAPKO, TAB1KO or RIPK2KO tumours (Scale bar 50 µm) and quantification of Ly6G+ cells. The sum of Ly6G‐positive cells from 5 randomly selected areas of the tumour (5 mice per genotype) was represented. Dots represent individual mice (n = 5).
B16F1 WT, XIAPKO (clone 2) subcutaneous melanoma tumour growth in BL/6 WT mice (n = 5). Mice were intra‐peritoneal injected with IgG antibody as a negative control or Ly6G antibody 1 day prior to the subcutaneous injection of the B16F1 WT or XIAPKO cells. Data are mean ± s.e.m. Two‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis.
Representative IF (neutrophils) scale bar 50 µm and quantification of Ly6G+ cells in tumours from C. The sum of Ly6G‐positive cells from 5 randomly selected areas of the tumour (4 mice per genotype) was represented. Dots represent individual mice (n = 4).
Data information: In B and D, data are presented as mean ± s.e.m. One‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis. **P < 0.01; ***P < 0.001; ****P < 0.0001 and ns, not significant.
XIAP‐RIPK2‐TAB1 axis supports neutrophil infiltration and melanoma growth in B16 mouse melanoma
Intensities of CD177 and XIAP immunostainings in tumour sections from 55 patients were visually scored. The numbers of melanomas with different intensities were plotted into the table as a percentage of the total. Specific staining intensity for XIAP and CD177, corresponding to relative amounts of infiltrated neutrophils, was arbitrarily set as the following: −, not expressed; +, low; ++, moderate; and +++, strong expression. Representative IHC pictures (right panel). Scale bar 100 µm.Representative IF (neutrophils staining) in B16F1 WT, XIAPKO, TAB1KO or RIPK2KO tumours (Scale bar 50 µm) and quantification of Ly6G+ cells. The sum of Ly6G‐positive cells from 5 randomly selected areas of the tumour (5 mice per genotype) was represented. Dots represent individual mice (n = 5).B16F1 WT, XIAPKO (clone 2) subcutaneous melanoma tumour growth in BL/6 WT mice (n = 5). Mice were intra‐peritoneal injected with IgG antibody as a negative control or Ly6G antibody 1 day prior to the subcutaneous injection of the B16F1 WT or XIAPKO cells. Data are mean ± s.e.m. Two‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis.Representative IF (neutrophils) scale bar 50 µm and quantification of Ly6G+ cells in tumours from C. The sum of Ly6G‐positive cells from 5 randomly selected areas of the tumour (4 mice per genotype) was represented. Dots represent individual mice (n = 4).Data information: In B and D, data are presented as mean ± s.e.m. One‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis. **P < 0.01; ***P < 0.001; ****P < 0.0001 and ns, not significant.To examine whether XIAP expression in tumour cells can induce chemotaxis of neutrophils, we first performed a granulocyte migration assay using XIAP‐deficient or ‐proficient HCT116, BLM and SK‐Mel28 cells. Our data showed that XIAP knock‐out significantly reduced granulocyte migration in all tested cell lines (Fig EV4A). Furthermore, granulocyte migration was efficiently blocked when IL8 was neutralised in the supernatants of XIAP‐proficient cells (Fig EV4B). Exogenously added IL8, in turn, could efficiently restore granulocyte migration in assays using XIAP‐deficient cells (Fig EV4C). These data demonstrated that XIAP‐induced IL8 secretion can promote neutrophil chemotaxis.
Figure EV4
XIAP‐ RIPK2‐TAB1 axis supports neutrophil infiltration and melanoma growth in B16 mouse melanoma
FACS analysis of granulocytes migration induced by HCT116 WT, HCT116‐XIAPKO, BLM WT, BLM‐XIAPKO, SK‐Mel28 WT or SK‐Mel28‐XIAPKO cells using semipermeable membrane (5 µm) and 1x10^6 granulocytes after 1 h incubation.
FACS analysis of granulocytes migration induced by HCT116 WT, HCT116‐XIAPKO, BLM WT and BLM‐XIAPKO cells using semipermeable membrane (5 µm) and 1 Mio granulocytes after 1 h incubation with either αIL8 antibody (0.2/0.4 µg/ml) (B) or rh‐IL8 (2/4 ng/ml) recombinant protein (C). In A and B, two‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis. In C, two‐way analysis of variance (ANOVA) followed by Sidak’s post analysis.
Representative IHC staining of neutrophils in B16 tumours. Scale bar 50 µm
Representative IHC staining of neutrophils in B16 tumours derived from mice treated either with control IgG or Lys6G antibody. Scale bar 100 µm (upper panel) and 10 µm (lower panel).
Data information: In A, B and C, dots represent individual biological replicates. Data are presented as mean ± SD. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001 and ns, not significant.
XIAP‐ RIPK2‐TAB1 axis supports neutrophil infiltration and melanoma growth in B16 mouse melanoma
FACS analysis of granulocytes migration induced by HCT116 WT, HCT116‐XIAPKO, BLM WT, BLM‐XIAPKO, SK‐Mel28 WT or SK‐Mel28‐XIAPKO cells using semipermeable membrane (5 µm) and 1x10^6 granulocytes after 1 h incubation.FACS analysis of granulocytes migration induced by HCT116 WT, HCT116‐XIAPKO, BLM WT and BLM‐XIAPKO cells using semipermeable membrane (5 µm) and 1 Mio granulocytes after 1 h incubation with either αIL8 antibody (0.2/0.4 µg/ml) (B) or rh‐IL8 (2/4 ng/ml) recombinant protein (C). In A and B, two‐way analysis of variance (ANOVA) followed by Dunnett’s post‐analysis. In C, two‐way analysis of variance (ANOVA) followed by Sidak’s post analysis.Representative IHC staining of neutrophils in B16 tumours. Scale bar 50 µmRepresentative IHC staining of neutrophils in B16 tumours derived from mice treated either with control IgG or Lys6G antibody. Scale bar 100 µm (upper panel) and 10 µm (lower panel).Data information: In A, B and C, dots represent individual biological replicates. Data are presented as mean ± SD. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001 and ns, not significant.We next examined whether the expression of XIAP, TAB1 or RIPK2 is important for the intra‐tumoural neutrophil infiltration in murine B16 melanomas. Lack of XIAP, RIPK2 or TAB1 significantly reduced neutrophil infiltration (Figs 4B and EV4D), but not other tested immune cells (Appendix Fig S1), in B16 tumours. Notably, in contrast to cultured melanoma cells, cytokine expression analysis of mouse tumour bulks showed that the ablation of XIAP, TAB1 or RIPK2 led to the reduction of Il6 and Il1b in addition to the Cxcl1 and Cxcl10 (Fig 3C). As XIAPKO, TAB1KO or RIPK2KO tumours are barely infiltrated with myeloid cells, the observed reduction in the total amount of Il6 or Il1b in these tumours may due to the reduced appearance of intra‐tumoural immune cells.Whether the reduced neutrophil infiltration entailed the reduced tumour growth in XIAPKO B16 melanoma tumours was studied by inducing experimental neutrophil depletion in mice using Ly6G specific antibodies. Neutrophil depletion using Ly6G specific antibodies in mice efficiently reduced neutrophil infiltration and B16 tumour growth (Figs 4C and D, and EV4E). In contrast to wild‐type B16 melanoma, exposure to Ly6G neutralising antibodies did not alter the growth of XIAPKO B16 melanoma further indicating that XIAP is required for neutrophil tumour infiltration and melanoma growth.Our studies involving model cell lines, melanoma cells, human melanoma tissue samples and B16 cutaneous melanoma mouse model conclusively showed that XIAP supports melanoma growth by inducing tumour cell inflammatory signalling and chemokine secretion that promotes neutrophil infiltration and tumour growth. In order to further substantiate our results, we used the Hgf‐Cdk4 melanoma mouse model, which more faithfully imitates the genetic and biologic evolution of human melanoma (Tormo et al, 2006; Giebeler et al, 2017). XIAP‐deficient mice (Xiap) (Andree et al, 2014) were crossed with Hgf‐Cdk4 mice and spontaneous melanoma development was investigated. Both Hgf‐Cdk4 and Hgf‐Cdk4 mice developed back skin melanomas starting at the age of 26 weeks. We were not able to detect a marked alteration in tumour initiation (tumour number) (Fig EV5A) but the sum tumour size was significantly reduced in Hgf‐Cdk4 mice (Fig 5A). Furthermore, the lack of XIAP slightly improved median survival in melanoma‐prone Hgf‐Cdk4 compared to Hgf‐Cdk4 mice (Fig EV5B), together indicating that XIAP is not required for melanoma tumour initiation but supports melanoma growth and progression in Hgf‐Cdk4 melanoma mouse model.
Figure EV5
XIAP supports tumour growth by promoting neutrophil infiltration in Hgf‐Cdk4 mouse melanoma
Number of tumours in Hgf‐Cdk4 and Hgf‐Cdk4 mice from 26 until 42 weeks of age (n = 6). Data are mean ± s.e.m. Two‐way analysis of variance (ANOVA). ns, not significant.
Kaplan–Meier survival curves of Hgf‐Cdk4 (n = 6) and Hgf‐Cdk4 (n = 7) mice.
Representative IF (neutrophils) staining and quantification of intra‐tumoural neutrophils in small (early time points) (C) and large (late time points) (D) tumours. Scale bar 100 µm. In C, the average of Ly6G‐positive cells from 5 randomly selected areas of the tumour (3 mice per genotype) was represented. In D, the sum of Ly6G‐positive cells from 5 randomly selected areas of the tumour (3 mice per genotype) was represented.
Representative IF staining (Scale bar 100 µm) and quantification of cl‐Caspase 3+ cells within the melanoma tumours in DMBA‐treated mice (n = 3). The average of cl‐Caspase 3 positive cells from 5 randomly selected areas of the tumour (3 mice per genotype) was represented.
Data information: In C, D and E, dots represent individual tumour (3 mice per genotype) and data are presented as mean ± SD; Mann–Whitney, two‐tailed test analysis. *P < 0.05; ****P < 0.0001 and ns, not significant.
Figure 5
XIAP supports tumour growth by promoting neutrophil infiltration in Hgf‐Cdk4 mouse melanoma
Sum tumour size in Hgf‐Cdk4 and Hgf‐Cdk4 mice at 38 weeks of age. Dots represent sum of all tumours size in an individual mouse. Data are presented as mean ± s.e.m. Unpaired t‐test, two‐tailed test analysis.
Representative images of back skin of the DMBA‐treated Hgf‐Cdk4 and Hgf‐Cdk4 mice at 8 weeks of age. Arrows indicate individual tumour. Scale bar 5 mm.
Number of tumours in the DMBA‐treated mice at 8 weeks of age (n = 3). Dots represent tumours having a range size of 0–10, 10–40 or > 40 mm2 in an individual mouse. Data are presented as mean ± s.e.m. Two‐way analysis of variance (ANOVA) followed by Sidak’s post‐analysis.
Tumour size in the DMBA‐treated Hgf‐Cdk4 and Hgf‐Cdk4 mice at 8 weeks of age (n = 3). Dots represent an individual tumour. Data are presented as mean ± SD. Mann–Whitney, two‐tailed test analysis.
qRT–PCR analysis (PrimePCR™ Assay) of different cyto‐/chemokines in Hgf‐Cdk4 mice plotted vs 3 independent Hgf‐Cdk4 mice. Samples that are at least 2‐fold up‐regulated are shown in red, samples that are at least 2‐fold down‐regulated are shown in green.
Representative IHC staining of neutrophils in small (early time points) (F) and large (late time points) (G) tumours. Scale bar 100 µm (upper panel) and 10 µm (lower panel). Arrows show neutrophils.
Data Information: *P < 0.05; **P < 0.01 and ns, not significant.
XIAP supports tumour growth by promoting neutrophil infiltration in Hgf‐Cdk4 mouse melanoma
Number of tumours in Hgf‐Cdk4 and Hgf‐Cdk4 mice from 26 until 42 weeks of age (n = 6). Data are mean ± s.e.m. Two‐way analysis of variance (ANOVA). ns, not significant.Kaplan–Meier survival curves of Hgf‐Cdk4 (n = 6) and Hgf‐Cdk4 (n = 7) mice.Representative IF (neutrophils) staining and quantification of intra‐tumoural neutrophils in small (early time points) (C) and large (late time points) (D) tumours. Scale bar 100 µm. In C, the average of Ly6G‐positive cells from 5 randomly selected areas of the tumour (3 mice per genotype) was represented. In D, the sum of Ly6G‐positive cells from 5 randomly selected areas of the tumour (3 mice per genotype) was represented.Representative IF staining (Scale bar 100 µm) and quantification of cl‐Caspase 3+ cells within the melanoma tumours in DMBA‐treated mice (n = 3). The average of cl‐Caspase 3 positive cells from 5 randomly selected areas of the tumour (3 mice per genotype) was represented.Data information: In C, D and E, dots represent individual tumour (3 mice per genotype) and data are presented as mean ± SD; Mann–Whitney, two‐tailed test analysis. *P < 0.05; ****P < 0.0001 and ns, not significant.
XIAP supports tumour growth by promoting neutrophil infiltration in Hgf‐Cdk4 mouse melanoma
Sum tumour size in Hgf‐Cdk4 and Hgf‐Cdk4 mice at 38 weeks of age. Dots represent sum of all tumours size in an individual mouse. Data are presented as mean ± s.e.m. Unpaired t‐test, two‐tailed test analysis.Representative images of back skin of the DMBA‐treated Hgf‐Cdk4 and Hgf‐Cdk4 mice at 8 weeks of age. Arrows indicate individual tumour. Scale bar 5 mm.Number of tumours in the DMBA‐treated mice at 8 weeks of age (n = 3). Dots represent tumours having a range size of 0–10, 10–40 or > 40 mm2 in an individual mouse. Data are presented as mean ± s.e.m. Two‐way analysis of variance (ANOVA) followed by Sidak’s post‐analysis.Tumour size in the DMBA‐treated Hgf‐Cdk4 and Hgf‐Cdk4 mice at 8 weeks of age (n = 3). Dots represent an individual tumour. Data are presented as mean ± SD. Mann–Whitney, two‐tailed test analysis.qRT–PCR analysis (PrimePCR™ Assay) of different cyto‐/chemokines in Hgf‐Cdk4 mice plotted vs 3 independent Hgf‐Cdk4 mice. Samples that are at least 2‐fold up‐regulated are shown in red, samples that are at least 2‐fold down‐regulated are shown in green.Representative IHC staining of neutrophils in small (early time points) (F) and large (late time points) (G) tumours. Scale bar 100 µm (upper panel) and 10 µm (lower panel). Arrows show neutrophils.Data Information: *P < 0.05; **P < 0.01 and ns, not significant.With the purpose of further enhancing melanomagenesis and to establish a more synchronised tumour initiation/progression in mice, we used neonatal carcinogen (7,12‐dimethylbenz[a]anthracene (DMBA)) treatment, which is characterised by inducing many primary melanomas in the skin growing rapidly within the first 3 months of life in Hgf‐Cdk4 melanoma mouse model (Tormo et al, 2006). The data obtained revealed that Xiap ablation reduced the number and the size of melanoma tumours after carcinogen treatment (Fig 5B–D). We could not detect any alteration in melanoma initiation and detected almost similar numbers of tumours below 10 mm2 of size (Fig 5C). The appearance of tumours with a size beyond 10 mm2 was however markedly reduced in Hgf‐Cdk4 mice. Analysis of cytokine/chemokine expression in melanomas derived from Hgf‐Cdk4 versus Hgf‐Cdk4 mice (Appendix Table S5, Appendix Table S6 and Appendix Table S7) revealed reduced expression of CXCL family members upon XIAP ablation (Fig 5E). Neutrophil infiltration in mouse melanomas was significantly reduced in Hgf‐Cdk4 mice already in early small melanomas but also in tumours at later stages (Figs 5F and G and EV5C and D). Similar to the data obtained in B16 melanoma (Fig 1), loss of XIAP in Hgf‐Cdk4 melanomas did not increase tumour cell apoptosis (caspase‐3 activation) (Fig EV5E). These data indicated that XIAP is not required for the process of malignant transformation in Hgf‐Cdk4 mouse melanoma but importantly supports tumour growth by promoting neutrophil infiltration.Tumour immune‐cell infiltrating is a hallmark of cancer (Hanahan & Weinberg, 2011). Neutrophils represent 50–70% of the myeloid‐derived white circulating cells in human blood and are mainly involved in the human innate immunity against invading pathogens (Borregaard, 2010). They also represent the most of inflammatory cells in solid tumours with a high intra‐tumour density that are increasingly identified as key drivers of tumour progression (Mantovani et al, 2009) and valuable therapeutic targets in cancer (Gregory & Houghton, 2011). Accordingly, strategies aiming at targeting non‐cancer‐cell component of the tumours, in particular, by pharmacologically blocking chemokine signalling (e.g. blocking IL8 and CXCL1) or neutrophil‐derived substances have been viewed as valuable therapeutic options for cancer (Gregory & Houghton, 2011; Masucci et al, 2019). By discovering one of the central signalling machineries in tumour cells which drives tumour neutrophil infiltration, our study proposes XIAP‐RIPK2‐TAB1 signalling complex as a novel and valuable therapeutic target for cancer therapy. In particular, the recent discovery and the development of small molecules that efficiently and specifically interfere with XIAP‐RIPK2 interaction and disrupt cellular inflammatory signalling (Nachbur et al, 2015; Goncharov et al, 2018; Hrdinka et al, 2018) will provide valuable tools to diminish neutrophil‐mediated tumour growth.
Material and Methods
Generation of stable knock‐out cell lines
Gene knock‐out in cell lines was carried out by using CRISPR/Cas9 gene editing (Fritsch et al, 2019). Cells were transfected with the designed oligonucleotide sgRNAs (purchased from Eurofins Genomics or designed and purchased from Sigma‐Aldrich as indicated in Appendix Table S8), cloned into the pSpCas9(BB)‐2A‐GFP (PX458) vector (a gift from F. Zhang; Addgene plasmid 48138). Transfected cells, expressing GFP, were sorted according to their expression with a BD Influx™ cell sorter (BD Biosciences). GFP‐positive cells were cultured for 4 days, followed by diluting cells to a single cell suspension plated on a 96‐well plate. Next, the plated cells were grown in an appropriate colony size and analysed via Western blot and sequencing.
Subcutaneous injection of B16F1 cell lines
BL/6 mice were received from the CECAD animal facility. At age of 8–12 weeks, mice were subcutaneously injected into the flank region with 100 µl of 1 × 107 cells/ml of B16F1 WT cells or in vitro generated B16F1 KO cells. Tumour growth was measured in 2 dimensions every second day. When reaching a tumour size of 15 mm in diameter, the mice were sacrificed. Tumour volume was calculated as length × width2 × π/6 (Witt et al, 2015; Schiffmann et al, 2020). For in vivo experiments, the majority of analyses included at least 3 mice per group in a simple experiment. Mouse experiments were repeated in independent experimental replicates. Sample size estimate was based on our previous studies and the approval by the German Regulations for Welfare of Laboratory Animals.
Intra‐peritoneal injection (IP) of antibodies
Intra‐peritoneal injection of IgG2a (InVivo plus, clone C1.18.4) or Ly6G (InVivo plus, clone 1A8) was performed 1 day prior to the injection of tumour cells until the end of the experiment in a dose of 100 µg antibody in 100 µl PBS per mouse per day (Coffelt et al, 2015; Schiffmann et al, 2019; Szczerba et al, 2019).
Hgf‐Cdk4 mice
Xiap and Hgf‐Cdk4 mice were described previously (Andree et al, 2014). For carcinogen‐induced tumour growth, neonates were treated with 160 nmol DMBA in acetone 4 days after birth. Development of melanocytic neoplasms and other skin tumours in both, untreated and DMBA‐treated animals, was monitored weekly. Nevi and melanomas were counted and tumour size was measured in two dimensions using a calliper (tumour size is given in mm2). When a single tumour reached a size of approx. 1.5 cm, or the sum of tumours was exceeding 3.0 cm in diameter, the animals were sacrificed. Animals were housed in the animal care facility of the University of Cologne under standard pathogen‐free conditions with a 12 h light/dark schedule and provided with food and water ad libitum. Animal experiments were performed following German Regulations for Welfare of Laboratory Animals and with approval by LANUV NRW (NRW authorisation for generation of the line 84‐02.04.2015.A471 and 84‐02.04.2016.A012 to analyse tumour development).
Immunofluorescence staining of isolated mice tumours
Tumours were embedded in O.C.T. compound, Tissue‐Tek, and stored at −80°C. To analyse neutrophils infiltration, cryosections (10 µm) were fixed in acetone, washed with PBS, blocked with 10% normal goat serum in addition to 5% BSA and stained with a monoclonal rat anti‐mouse Ly‐6G (1:200, #551459, BD Pharmingen). Secondary Alexa Fluor 488 goat anti‐rat antibody (1:1,000, #A11006, life technologies) was used. To analyse active caspase 3, cryosections (10 µm) were fixed in 10% PFA, washed with PBS, blocked with 10% normal goat serum and stained with a polyclonal rabbit anti‐cleaved caspase‐3 (Asp 175) (1:200, #9661, Cell Signaling). Secondary Alexa Fluor 594 (#A11012) or 647 (#A21244) goat anti‐rabbit antibody (1:1,000, life technologies) were used (Gunther et al, 2020). Immune cell phenotyping was performed using IHC Antibody Sampler Kit (#37495, Cell Signaling). All antibodies were used in a 1:200 dilution. Secondary Alexa Fluor 488 goat anti‐rabbit antibody (1:1,000, #A11008, life technologies) was used. Tumour cells nuclei were stained with 4,6‐diamidin‐2‐phenylindol (DAPI). Imaging was conducted on a motorised inverted Olympus IX81 microscope (CellR Imaging Software) or Fluoview FV1000 confocal microscope (Olympus GmbH) was used (objective: Olympus PlanApo, 60×/1.40 oil, ∞/0.17). Cl‐Caspase‐3+ areas were calculated using ImageJ software (http://imagej.nih.gov/ij). Number of Ly‐6G+ infiltrates were counted manually (Schiffmann et al, 2019) or Ly‐6G+ areas were calculated using ImageJ software.
H&E staining of isolated mice tumours
Cryosections from B16 tumours were incubated for 10 min in tap water, 3.5 min in Haematoxylin, shortly washed with tap water followed by 15 min incubation with tap water and then 1 min in demineralised water. Next, sections were incubated for 1 min in Eosin followed by dehydration in a serial of ethanol dilutions and Xylol. Sections were fixed with Entellan. Stained tumours were scanned using a Hamamatsu Slide scanner (S360) and analysed using the imaging software NDP.view 2.
Immunohistochemistry staining of isolated mice tumours
Parraffin sections were deparafinised in alcohol series, washed with demineralised water followed by bleaching which was done as following: 20 min incubation with 30% H2O2 and 0.5% KOH at 37°C, 20‐s incubation with 1% acetic acid and washed with demineralised water. Antigen unmasking was done using Citrate buffer (pH: 6) with 0.05% Tween 20, heated 4× in the microwave and cooled down at RT for 20 min. Next, blocking was done using 10% BSA in TBS for 30 min. After that, sections were stained with a monoclonal rat anti‐mouse Ly‐6G primary antibody (1:500, #551459, BD Pharmingen) diluted in 1% BSA and TBS at 4°C overnight. Chromogen staining was done as following: incubation with goat anti‐rat biotin‐conjugated secondary antibody (1:500, #112‐065‐003, JacksonImmunoResearch) for 45 min at RT, 3x washing with TBS for 5 min, 15 min incubation with Alkaline phosphatase (Fa.DCS #AD000RP) followed by 3× washing with TBS. Sections were incubated with Chromogen (Fast Red Substrate Pack, Fa. BioGenex #HK182‐5KE) for 5 min. Nuclear staining was done by incubating the sections with haematoxylin for 1 min, followed by 3x washing in warm tap water and finally washed with demineralised water.
Immunohistochemistry in human samples
Paraffin‐embedded sections (7 µm) of human melanoma specimens from patients diagnosed at the University Hospital of Cologne were obtained using a Thermo Shandon Finesse Microtome, collected on microscope slides (Gerhard Menzel GmbH) and dried overnight at 37°C. Sections were deparaffinised by incubation of the slides in xylene (20 min) followed by a graded alcohol series (1 min each): isopropyl alcohol, 96% EtOH, 75% EtOH, aqua bidest.Antigen retrieval was performed using Target Retrieval System pH 6.0 (TRS, Dako) in a preheated water bath at 95°C for 20 min. Slides were cooled at RT before immersing in wash buffer for the next step. Sections were washed three times in TBS blocked for 1 h with 10% BSA in TBS. Primary antibodies diluted in TBS, 1% BSA were added to the sections and incubated overnight at 4°C in a humidified chamber. The following antibodies were used: rabbit‐anti‐CD177 (1:400, #PA5‐83575, Invitrogen) and rabbit‐anti‐XIAP (1:100, #ab21278, Abcam). After 2x5 min washes in TBS, bound antibodies were detected using the DAKO REAL kit (K5005) and fast red (#HK182‐5KE, Fa. BioGenex) as a substrate. Nuclei were counterstained with haematoxylin solution for 1min (Shandon). Stained sections were viewed and recorded using Leica DM 4000B microscope (Leica) equipped with Diskus program version 4.50.1638 – #393. Expression of XIAP and amount of CD177‐positive cells were qualitatively estimated according to the intensity of specific staining and were arbitrarily set as the following: −, not expressed; +, low; ++, moderate; +++, strong.
Ethics approval
Human materials were obtained according to the study protocol conformed to the ethical guidelines of the 1975 Declaration of Helsinki and were approved by the Ethics Committee of the Medical Faculty of the University of Cologne (Approval No. 21‐1006). Informed consent has been obtained.
Granulocytes migration
Granulocytes were isolated from human peripheral blood using the isolation of mononuclear cells from human peripheral blood by density gradient centrifugation protocol (Miltenyi Biotec) according to the manufacturer´s instruction. HCT116 WT, HCT116‐XIAPKO, BLM WT, BLM‐XIAPKO, SK‐Mel28 WT or SK‐Mel28‐XIAPKO were seeded on a 24 well plate (150000 cells per well in 600 µl medium) (Millicell‐24 Merck). After 48 h, 1 × 106 granulocytes were plated onto the semipermeable membrane (5 µm) and migrated cells were measured after 1 h using flow cytometry analysis. αIL8 antibody (0.2, 0.4 µg/ml, R&D systems) were added to the WT medium and rh‐IL8 (2, 4 ng/ml, R&D systems) were added to the KO medium after 47 h of seeding the cells. 1 h later, 1 × 106 granulocytes were plated onto the semipermeable membrane (5 µm), and migrated cells were measured after 1 h using flow cytometry analysis.
Western blot
Whole cell lysates were prepared using either CHAPS lysis buffer (10 mM HEPES pH 7.4, 150 mM NaCl, 1% (w/v) CHAPS, protease inhibitor; complete Mini, Roche), or RIPA lysis buffer (1% Triton X‐100, 150 mM NaCl, 50 mM Tris pH 7.4, 0.1% SDS, 0.5% Na‐deoxycholat, protease inhibitor; complete Mini, Roche). Collected cell pellets were resuspended in 1 pellet volume lysis buffer, incubated for 20 min on ice, followed by centrifugation at 20,000 g for 20 min at 4°C. Protein concentrations of cell lysates were measured using a Pierce BCA Protein Assay (Thermo Fisher Scientific) according to the manufacturer’s instructions. Proteins were separated by SDS–PAGE and transferred to a nitrocellulose membrane (Amersham Protean, GE). Proteins were stained with antibodies against XIAP (#610763, BD Biosciences or # M044‐3, MBL), TAB1 (#3226, Cell Signaling), TAB1 (#3387, ProSci), RIPK2 (#4142, Cell Signaling), β‐Actin (#A5441, Sigma), cIAP1 (#ALX‐803‐335, Enzo), RIPK1 (#51‐6559GR, BD Biosciences), Capase‐9 (#ab2014, Abcam), Caspase‐3 (#9665, Cell Signaling), Caspase 7 (#9494, Cell Signaling), p‐RIPK2 (#4364, Cell Signaling), c‐Myc HRP (#ab62928, Abcam), Ubiquitin (#3936, Cell Signaling) and Caspase‐8 mouse‐specific (#4927, Cell Signaling). Secondary antibodies included goat anti‐rabbit IgG conjugated to horseradish peroxidase (HRP) (#7074, Cell Signaling), goat anti‐mouse IgG HRP (#A4416, Sigma), goat anti‐mouse IgG light chain HRP (#115‐035‐174, Jackson Immuno Research) and goat anti‐rat IgG (H + L) HRP (#031470, Invitrogen). Membranes were developed using a ChemiDoc MP Imaging System (BioRad).
Immunoprecipitation
HCT116 cells were transfected with respective constructs for 24 h. Cells were collected and lysed using IP‐lysis buffer from μMACS c‐myc Isolation Kit (Miltenyi Biotec), incubated 20 min on ice and centrifuged at 20,000 g for 20 min at 4°C. Lysates were magnetically labelled with μMACS c‐myc MicroBeads. Immunoprecipitation was performed according to the manufacturer’s instructions and analysed by Western blot (Albert et al, 2020).
Endogenous IP
Immunoprecipitation of endogenous proteins analysis was done as described previously (Albert et al, 2020). In brief, cells were washed with chilled PBS and centrifuged at 700 g for 3 min. The cell pellet was resuspended in lysis buffer (Miltenyi Biotec) in addition to N‐ethylmaleimide (NEM) (Sigma‐Aldrich) and 1× complete protease inhibitor cocktail (Roche) followed by 30 min incubation on ice and centrifugation for 20 min at 20,000 g at 4°C. Supernatant was collected and incubated first 1 h with a respective antibody against XIAP (#14334, Cell Signaling) at 4°C on a rotating wheel followed by overnight incubation with Protein A/G Plus agarose beads (sc‐2003, Santa Cruz). Beads were washed 3× with PBST (PBS + 0.1% Tween 20).Immunoprecipitation of endogenous ubiquitylated RIPK2 was carried out as described above. The cell pellet was resuspended in RIPA buffer (1% Triton, 150 mM NaCl, 50 mM Tris, 1% SDS, 0.5% deoxycholate) in addition to N‐ethylmaleimide (NEM) (Sigma‐Aldrich) and 1× complete protease inhibitor cocktail (Roche) followed by 30‐min incubation on ice and centrifugation for 20 min at 20,000 g at 4°C. SDS concentration was diluted to 0.1% SDS prior to antibody incubation. Lysates were incubated first 1 h with a respective antibody against RIPK2 (#4142, Cell Signaling) at 4°C on a rotating wheel followed by overnight incubation with Protein A/G Plus agarose beads (sc‐2003, Santa Cruz). Beads were washed 3× with PBST (PBS + 0.1% Tween 20).
In vitro cell‐free ubiquitylation assay
The following recombinant proteins were used: UBE1, His‐UbcH7, ubiquitin (Boston Biochem), flag‐XIAP (BPS Bioscience) and GST‐RIPK2 (technical novusbio). Ubiquitin assay was performed in 10× E3 ubiquitin ligase buffer (Enzo) and 10× activation buffer (Enzo) for 2 h at 37°C followed by 5 min on ice. The reaction was done using 2 µg ubiquitin, 1 µg E2 (UbcH7), 0.4 µg E1 (UBE1), 0.5 µg substrate (RIPK2) and 0.78 µg E3 (XIAP) in a total amount of 25 µl reaction.
Cell proliferation assays
Cell proliferation assay of generated CRISPR/Cas9 cell lines was assessed in vitro either by using CellTrace™ CFSE Cell Proliferation Kit for flow cytometry (Thermo Fisher Scientific) or by Incucyte Live‐Cell‐Analsis according to the manufacturer’s instructions. Cell proliferation was measured after 24 h and 72 h.
Immunofluorescence
Immunofluorescence analysis was performed as described previously (Albert et al, 2020). In brief, HCT116 or HeLa cells were seeded on coverslips in 12‐well plate and transfected with GFP‐XIAP for 16 h. Cells were washed with PBS and subsequently fixed with 3% paraformaldehyde in PBS for 20 min. Cells were blocked and permeabilised with blocking buffer (0.1% saponin (Carl Roth), 3% BSA (Carl Roth) in PBS) for 30 min and later incubated with primary antibodies for TAB1 (1:100, Cell Signaling) or RIPK2 (1:100, Cell Signaling) in a humid chamber overnight at 4°C. After incubation, coverslips were washed with washing buffer (0.1% saponin in PBS) three times and incubated with secondary antibody goat anti‐rabbit Alexa Fluor 568 (1:500, Thermo Fisher Scientific) for 1 h at room temperature. Subsequently, cells were stained with 300 nM DAPI (Molecular Probes) for 10 min and washed three times and embedded with mowiol overnight. For imaging, Fluoview FV1000 confocal microscope (Olympus GmbH) was used (objective: Olympus PlanApo, 60×/1.40 oil, ∞/0.17).
RNA isolation
RNA was isolated using either RNeasy Kit (Qiagen) according to the manufacturer’s instructions or standard phenol‐chloroform‐method (Chomczynski & Sacchi, 1987). Cells were resuspended in TRIzol® (Ambion, Life Technologies) and afterwards homogenised using QIAshredder columns (Qiagen). Chloroform was added to the homogenate of cells, incubated on ice and centrifuged to separate the homogenate into a lower organic layer containing DNA and proteins, an interphase and an upper aqueous layer containing the RNA. Aqueous layer was collected; RNA was precipitated by adding isopropanol, washed with 70% ethanol and resolved in nuclease‐free water. RNA was quantified by measuring at wavelength 260 nm with a spectral photometer (NanoDrop®) and stored at −80°C. To purify RNA from single‐ and double‐stranded DNA, RNA was digested with DNaseI (Thermo Scientific) according to the manufacturer´s instructions. Level of purity was checked by agarose gel electrophoresis.
Reverse transcription and quantitative PCR (qRT–PCR)
RevertAid™ Premium First Strand cDNA Synthesis Kit (Thermo Fisher) was used to synthesis the cDNA from the RNA with oligo dT‐primers according to the manufacturer´s instructions. qRT–PCR was performed with specific primers (Appendix Table S9). LightCycler® SYBR‐Green I Mix (Roche Applied Sciences) was used with a 96‐well‐plate Multicolor Real‐Time PCR Detection System (iQTM5, BIO‐RAD). Data were further evaluated as previously described (Ramakers et al, 2003), and target gene expression was normalised to the reference gene Actin.
PrimePCR™ assay
To determine the transcription level of different cyto‐ and chemokines, Bio‐Rad PrimePCR™ Assay Plate Cytochemokines Tier 1 H96 or M96 was used. The assay was performed according to the manufacturer´s instructions. Data analysis was carried out with Bio‐Rad PrimePCR analysis software.
Enzyme‐linked immunosorbent assay (ELISA)
Human melanoma cells were seeded on 12‐well plate and transfected with siRNA alone for 48 h or additionally treated with TNF 20 ng/ml (Biomol) for 8 h. HEK293T, HCT116‐TAB1KO and HCT116‐RIPK2KO cells were seeded on 12‐well plate and transfected with indicated plasmids for 16 h. Medium was changed and collected after 24 h. HCT116 cells were treated with L18‐MDP 1 µg/ml (InvivoGen) for 24 h. Medium was collected and frozen at −20°C. Human melanoma cells were treated with Birinapant 20 µM (Biozol), BV6 2 µM (Universal Biologicals) or XB2d89 (d89) 2 µM (Genentech, USA). Analysis of secreted IL8 was performed using human CXCL8/IL8 DuoSet ELISA (R&D Systems) according to the manufacturer´s instructions.
Cell death assay
20,000 cells were seeded on 96‐well plate and treated with either 100 ng/ml TNF (R&D), 50 ng/ml TRAIL (Enzo), DMSO (Roth) or 2 mM H2O2 (Roth) for 24 h. Treatments were done in the presence of 5 μM Sytox Green (Invitrogen). Analysis of cell death was performed using an IncuCyte system (SARTORIUS). Scanning was done every 1 or 2 h over 24 h with 20× magnification. Cell death was determined as Sytox positive cells and quantified with the software supplied by the manufacturer.
Cultivation and transfection of cells
HeLa, HEK293T, HCT116, B16 cells were purchased from ATCC. HCT‐XIAPKO cell line was described previously (Cummins et al, 2004). M5, BLM, Colo38 and SK‐Mel28 cell lines were described previously (Brinkmann et al, 2013). HeLa, HEK293T and B16F1 cells were cultured in DMEM (Merck) supplemented with 10% FCS (Biowest), 100 µg/ml streptomycin and 100 unit/ml penicillin (Merck). HCT116 cells (human colon cancer cell line) were cultured in McCoy’s 5A (Merck) supplemented with 10% FCS (Biowest). M5, BLM, Colo38 and SK‐Mel28 melanoma cells were cultured in RPMI (Merck) supplemented with 10% FCS (Biowest), 100 µg/ml streptomycin, 100 unit/ml penicillin (Biochrom) and non‐essential amino acids (Biochrom). Cells were routinely tested for mycoplasma contaminations by PCR. Cells were transfected with respective constructs for 16 h using Lipofectamine® 2000 (Invitrogen) or Polyethylenimin (PEI) (Polysciences Europe GmbH) according to the manufacturer’s instructions. For siRNA transfection, cells were transfected with the respective siRNA for 48 h using Lipofectamine® RNAi MAX™ (Invitrogen) according to the manufacturer’s instructions. The following siRNA were used: siTAB1 (5’‐GGAUGAGCUCUUCCGUCUUUU‐ 3’), siRIPK2 (5’‐GUAUGAUCUCUCUAAUAGA‐ 3’), siXIAP (5’‐GGAAUAAAUUGUUCCAUGCTT‐ 3’) siCaspase3 (5’‐GGAAUAUCCCUGGACAACATT‐3’), siCaspase7 (5’‐UACCGUCCCUCUUCAGUAATT‐ 3’), siNOD1 (5’‐CCCUGAGUCUUGCGUCCAA‐ 3’) and siScr (5’‐GGA UUA CUU GAU AAC GCU AUU‐ 3’; Gunther et al, 2020). siRNAs were designed and purchased from Eurofins Genomics.
Statistical analysis
Data are presented as mean ± SD or ± s.e.m. In vitro experiments were repeated at least two times. The respective tests or analyses are listed in the figure’s legend. Significances were indicated as *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; ns, not significant. GraphPad Prism 7.0 and Excel were used to analyse the data in this study.
Author contributions
Mila Daoud: Data curation; Software; Formal analysis; Validation; Investigation; Visualization; Methodology; Writing—original draft; Writing—review and editing. Pia Nora Broxtermann: Data curation; Software; Formal analysis; Validation; Investigation; Visualization; Methodology. Fabian Schorn: Investigation; Methodology. J Paul Werthenbach: Investigation; Methodology. Jens Michael Seeger: Methodology. Lars M Schiffmann: Methodology. Kerstin Brinkmann: Methodology. Domagoj Vucic: Resources. Thomas Tüting: Resources. Cornelia Mauch: Resources; Investigation. Dagmar Kulms: Resources. Paola Zigrino: Resources; Supervision; Validation; Investigation; Visualization; Methodology. Hamid Kashkar: Conceptualization; Supervision; Funding acquisition; Writing—original draft; Writing—review and editing.In addition to the CRediT author contributions listed above, the contributions in detail are:MD and PNB performed most experiments and data analysis. FS established Hgf‐Cdk4 and Hgf‐Cdk4 mouse melanomas. JPW generated B16∆BIR1 and B16∆BIR2 B16 cell lines and performed respective tumour analysis. JMS and LMS helped with mice injections and mouse tumour studies. KB was involved in initial studies characterising XIAP in human melanoma cells. DV and DK provided essential reagents and cell lines. TT provided Hgf‐Cdk4 melanoma mouse model. CM and PZ provided analyses of tumours derived from melanoma patients. HK designed the study.
Disclosure and competing interests statement
The authors declare that they have no conflict of interest.AppendixClick here for additional data file.Expanded View Figures PDFClick here for additional data file.Source Data for Expanded ViewClick here for additional data file.Source Data for Figure 1Click here for additional data file.Source Data for Figure 2Click here for additional data file.
Authors: Melanie Fritsch; Saskia D Günther; Robin Schwarzer; Marie-Christine Albert; Fabian Schorn; J Paul Werthenbach; Lars M Schiffmann; Neil Stair; Hannah Stocks; Jens M Seeger; Mohamed Lamkanfi; Martin Krönke; Manolis Pasparakis; Hamid Kashkar Journal: Nature Date: 2019-11-20 Impact factor: 49.962
Authors: Matous Hrdinka; Lisa Schlicher; Bing Dai; Daniel M Pinkas; Joshua C Bufton; Sarah Picaud; Jennifer A Ward; Catherine Rogers; Chalada Suebsuwong; Sameer Nikhar; Gregory D Cuny; Kilian Vm Huber; Panagis Filippakopoulos; Alex N Bullock; Alexei Degterev; Mads Gyrd-Hansen Journal: EMBO J Date: 2018-07-19 Impact factor: 11.598