| Literature DB >> 35433667 |
Shaolan Zou1,2,3, Yudie Jia1,2, Qing He2, Kun Zhang1,4, Rui Ban2, Jiefang Hong1,2,3, Minhua Zhang1,2,3.
Abstract
The unfolded protein response (UPR) is one of the most important protein quality control mechanisms in cells. At least, three factors are predicted to activate the UPR in yeast cells during fermentation. Using UPRE-lacZ as a reporter, we constructed two indicator strains, KZ and WZ, based on Angel-derived K-a and W303-1A strains, respectively, and investigated their UPR response to tunicamycin, ethanol, and acetic acid. Then, four strains carrying plasmids BG-cwp2 and BG were obtained to realize the displaying and secretion of β-glucosidase, respectively. The results of cellobiose utilization assays indicated interactions between the UPR and the metabolic burden between the strain source, anchoring moiety, oxygen supply, and cellobiose concentration. Meanwhile, as expected, growth (OD600), β-glucosidase, and β-galactosidase activities were shown to have a positive inter-relationship, in which the values of the KZ-derived strains were far lower than those of the WZ-derived strains. Additionally, extra metabolic burden by displaying over secreting was also much more serious in strain KZ than in strain WZ. The maximum ethanol titer of the four strains (KZ (BG-cwp2), KZ (BG), WZ (BG-cwp2), and WZ (BG)) in oxygen-limited 10% cellobiose fermentation was 3.173, 5.307, 5.495, and 5.486% (v/v), respectively, and the acetic acid titer ranged from 0.038 to 0.060% (v/v). The corresponding maximum values of the ratio of β-galactosidase activity to that of the control were 3.30, 5.29, 6.45, and 8.72, respectively. Under aerobic conditions with 2% cellobiose, those values were 3.79, 4.97, 6.99, and 7.67, respectively. A comparison of the results implied that β-glucosidase expression durably induced the UPR, and the effect of ethanol and acetic acid depended on the titer produced. Further study is necessary to identify ethanol- or acid-specific target gene expression. Taken together, our results indicated that the host strain W303-1A is a better secretory protein producer, and the first step to modify strain K-a for cellulosic ethanol fermentation would be to relieve the bottleneck of UPR capacity. The results of the present study will help to identify candidate host strains and optimize expression and fermentation by quantifying UPR induction.Entities:
Keywords: UPR response; UPRE-lacZ; cellobiose; displaying and secreting; ethanol and acid; metabolic burden; recombinant yeast; β-glucosidase
Year: 2022 PMID: 35433667 PMCID: PMC9008459 DOI: 10.3389/fbioe.2022.837720
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
Microbial strains, plasmids, and primers used in this study.
| Strains/plasmids/primers | Essential properties | Source or reference |
|---|---|---|
|
| F−
| In our lab |
|
|
| In our lab |
| W303-1A | ||
| WZ | W303-1A ( | In our lab |
| WZ (YEplac195) | Strain WZ containing plasmid YEplac195 | In our lab |
| K-a |
| In our lab |
| K-a (YCplac33-Cas9) | Strain K-a containing plasmid YCplac33-Cas9 | In our lab |
| WZ (BG) | Strain WZ containing plasmid YEplac195-P | In this study |
| WZ (BG-cwp2) | Strain WZ containing plasmid YEplac195-P | In this study |
| KZ | K-a ( | In this study |
| KZ (YEplac195) | Strain KZ containing plasmid YEplac195 | In this study |
| KZ (BG) | KZ containing plasmid YEplac195-P | In this study |
| KZ (BG-cwp2) | KZ containing plasmid YEplac195-P | In this study |
| YCplac33-Cas9 |
| In our lab |
| pRS42H-gRNA |
| In our lab |
| pRS42H-gLEU2 |
| In our lab |
| YEplac195 |
| In our lab |
| BG | YEplac195-P | In our lab |
| BG- | YEplac195-P | In our lab |
| Primer P1 | 5′ CACAATTTGCTAAAGGTACT 3′ | Donor DNA synthesis |
| Primer P2 | 5′ CTTGTGATTCTTTGCACTTC 3′ | |
| Primer P3 | 5′ TGACCAAGTTCGTAAATCTA 3′ | Transformant identifying |
| Primer P4 | 5′ CCATCTCCACAATAGGCATA 3′ | |
| HAC1-F | 5′CTTTGTCGCCCAAGAGTATGCG3′ | Product size 532/280 bp |
| HAC1-R | 5′GTGATGAAGAAATCATTCAATTCAAATG3′ | |
| ACT1-F | 5′CAAACCGCTGCTCAATCTTC3′ | Product size 150 bp |
| ACT1-R | 5′AGTTTGGTCAATACCGGCAG3′ | |
| IRE1-F | 5′AAGGCATCCGTTGTTTTGGC3′ | Product size 128 bp |
| IRE1-R | 5′AGTCAGAACCGGCGTCAAAT 3′ | |
| INO1-F | 5′AGAGATTGCTCCTTCCACGA 3′ | Product size 164 bp |
| INO1-R | 5′ACTTGGTTTGTCCCGACTTG 3′ | |
| ERO1-F | 5′TGAAGGAGGCAGGCAAATCG 3′ | Product size 150 bp |
| ERO1-R | 5′TACCGTTAGAGGGCCTTGGA 3′ | |
| HLJ1-F | 5′ATTTGGGCCTTCTGCTTCCA 3′ | Product size 127 bp |
| HLJ1-R | 5′TGCTTGTTGTTGCTGCTGTC 3′ | |
| LHS1-F | 5′GCTCGTCAGGAGTTGCGTAT 3′ | Product size 149 bp |
| LHS1-R | 5′AGTAAAAGCCAAACGGCTGC 3′ | |
| MPD1-F | 5′CCCCCAATGAGGGTCCTTTT 3′ | Product size 109 bp |
| MPD1-R | 5′TCGTCGTGCTTGTTTCCTGA 3′ | |
| KAR1-F | 5′ATTCCACCAGCACCAAGAGG 3′ | product size 85 bp |
| KAR1-R | 5′CTGTGGCAGACACCTTCAGA 3′ | |
FIGURE 1Schematic illustration of plasmids. (A) YCplac33-Cas9; (B) pRS42H-gLEU2.
FIGURE 2The growth and β-galactosidase activity of strains KZ and WZ in the YPD medium with different additives. (A) The growth curve; (B) the ratio of maximum OD600 value to that of controls KZ-1 or WZ-1; and (C) the ratio of β-galactosidase activity to that of controls KZ-1 or WZ-1. The original data was shown in Supplementary Material Table 1.
FIGURE 3The growth, β-glucosidase, and β-galactosidase activities of the recombinant strains aerobically in 2% cellobiose. (A) The growth curve; (B) total β-glucosidase activity (U/ml/OD600), not detected for control strains KZ (YEplac195) and WZ (YEplac195); (C) the percent of extracellular β-glucosidase activity (%); (D) the β-galactosidase activity (U/mg protein); and (E) the ratio of β-galactosidase activity value of four strains to that of control strain KZ (YEplac195) and WZ (YEplac195), 5.30 ± 0.83 and 21.0 ± 0.95 U/mg protein, respectively. The original data was shown in Supplementary Material Table 2.
FIGURE 4The growth, sugar consumption, β-glucosidase, ethanol and acid production, and β-galactosidase activity of the recombinant strains anaerobically in 10% cellobiose. (A) The growth curve; (B) total β-glucosidase activity (U/ml/OD600), not detected for control strains WZ (YEplac195) and KZ (YEplac195); (C) ethanol and acetic acid production; (D) the β-galactosidase activity (U/mg protein); (E) the ratio of β-galactosidase activity value of four strains to that of control strains KZ (YEplac195) and WZ (YEplac195), 6.60 ± 0.85 and 23.1 ± 0.93 U/mg protein, respectively; and (F) the cellobiose curve. The original data was shown in Supplementary Material Table 3.
FIGURE 5HAC1 mRNA splicing and relative expression of UPR target genes. HAC1 mRNA splicing (A) and the relative expression level of UPR target genes (C–F) of strains WZ in YPD medium with different additives; HAC1 mRNA splicing (B) and relative expression level of UPR target genes (G–H) of strains WZ (BG-cwp2) and WZ (BG) in 10% cellobiose. (A) lanes 1∼5, WZ-1∼WZ-5, 8 h; (B) lanes 1,8 and 9, 24, 36 and 48 h fermentation time of strain WZ (YEplac195); lanes 2∼4, 24, 36 and 48 h fermentation time of strain WZ (BG); lanes 5∼7, 24, 36 and 48 h fermentation time of strain WZ (BG-cwp2). Each data point was referred to the control strain samples, and the mRNA levels of the target genes were determined by qPCR after normalization with constitutive control ACT1 gene. The results represent the average and standard deviation of three independent biological replicates. The original data was shown in Supplementary Material Table 4.