Tsubasa Mizokami1, Michiko Shimada2, Katsuhiko Suzuki3. 1. Graduate School of Sport Sciences, Waseda University, Tokorozawa, Japan. 2. Communitiy Medicine, Hirosaki University School of Medicine Graduate School of Medicine, Hirosaki, Japan. 3. Faculty of Sport Sciences, Waseda University, Tokorozawa, Japan.
Abstract
Exhaustive exercise is known to induce acute renal damage. However, the precise mechanisms remain unclear. We investigated the effects of macrophage depletion on exhaustive exercise-induced acute renal damage. Male C57BL/6 J mice were divided into four groups: sedentary with control liposome (n=8), sedentary with clodronate liposome (n=8), exhaustive exercise with control liposome (n=8), and exhaustive exercise with clodronate liposome (n=8). Mice were treated with clodronate liposomes or control liposomes intraperitoneally for 48 h before undergoing exhaustive exercise. Renal function and renal histology were tested at 24 h. The expression levels of kidney injury molecule (KIM)-1 and inflammatory cytokines in kidney tissues were measured by quantitative RT-PCR, and KIM-1 concentration was semi-quantified by immunostaining. As a result, exhaustive exercise increased macrophage infiltration into the kidney. However, clodronate reduced it. Although exhaustive exercise resulted in an increase in KIM-1 mRNA expression levels and concentration, injection of clodronate liposome reduced it. In addition, TUNEL positive apoptotic cells were increased after exercise, but significantly reduced by clodronate. Clodronate liposome treatment also decreased the mRNA expression levels of inflammatory cytokines (TNF-α, IL-1β, and IL-6) in the kidney after exhaustive exercise. These results suggest that macrophages play a critical role in increasing renal damage by regulating inflammation. The Author(s). This is an open access article published by Thieme under the terms of the Creative Commons Attribution-NonDerivative-NonCommercial-License, permitting copying and reproduction so long as the original work is given appropriate credit. Contents may not be used for commercial purposes, or adapted, remixed, transformed or built upon. (https://creativecommons.org/licenses/by-nc-nd/4.0/).
Exhaustive exercise is known to induce acute renal damage. However, the precise mechanisms remain unclear. We investigated the effects of macrophage depletion on exhaustive exercise-induced acute renal damage. Male C57BL/6 J mice were divided into four groups: sedentary with control liposome (n=8), sedentary with clodronate liposome (n=8), exhaustive exercise with control liposome (n=8), and exhaustive exercise with clodronate liposome (n=8). Mice were treated with clodronate liposomes or control liposomes intraperitoneally for 48 h before undergoing exhaustive exercise. Renal function and renal histology were tested at 24 h. The expression levels of kidney injury molecule (KIM)-1 and inflammatory cytokines in kidney tissues were measured by quantitative RT-PCR, and KIM-1 concentration was semi-quantified by immunostaining. As a result, exhaustive exercise increased macrophage infiltration into the kidney. However, clodronate reduced it. Although exhaustive exercise resulted in an increase in KIM-1 mRNA expression levels and concentration, injection of clodronate liposome reduced it. In addition, TUNEL positive apoptotic cells were increased after exercise, but significantly reduced by clodronate. Clodronate liposome treatment also decreased the mRNA expression levels of inflammatory cytokines (TNF-α, IL-1β, and IL-6) in the kidney after exhaustive exercise. These results suggest that macrophages play a critical role in increasing renal damage by regulating inflammation. The Author(s). This is an open access article published by Thieme under the terms of the Creative Commons Attribution-NonDerivative-NonCommercial-License, permitting copying and reproduction so long as the original work is given appropriate credit. Contents may not be used for commercial purposes, or adapted, remixed, transformed or built upon. (https://creativecommons.org/licenses/by-nc-nd/4.0/).
Moderate exercise is effective for maintaining or promoting health
1
, whereas intense prolonged exercise is related to
health problems such as muscle damage and acute renal damage
2
3
. It was shown that
gross hematuria and microscopic hematuria were observed in 20% of post-race
marathon runners
4
. In addition, we reported the
effects of a duathlon race in humans in whom acute renal damage was demonstrated by
increased serum creatinine levels and urinary protein, and tubular epithelial cells
were also detected in urinary sediments
5
.In order to elucidate the precise mechanisms of renal damage after intense exercise,
appropriate samples are required. However, there is limited availability in humans
owing to ethical considerations. In animal models, running on a treadmill or
swimming are employed in mice and rats. Lin et al. reported acute renal damage
occurred 24 hours after exhaustive exercise in rats. They showed that renal
dysfunction was demonstrated by elevated levels of blood urea nitrogen (BUN) and
creatinine in plasma, and histological damage was demonstrated by enlarged
glomeruli, collapsed tubular epithelial cells, loss of brush border membranes in
proximal epithelial cells, dilatation of tubules, and intratubular cast formation
6
. Wu et al. also reported acute renal damage
occurred after exhaustive swimming in rats. They showed increased apoptosis was
demonstrated by a terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick-end
labeling (TUNEL) staining; inflammatory responses were demonstrated by increased
tumor necrosis factor (TNF)-α and nuclear factor kappa B (NF-κB)
activation
7
.Thus, it is assumed that inflammatory
responses are responsible for the acute renal damage observed after intensive
exercise. Interestingly, several studies reported that substances with
anti-inflammatory properties were effective in suppressing acute renal damage
following exhaustive exercise
6
7
, suggesting that inflammation may be of central
importance in the induction of acute renal damage.During intensive exercise, it is known that blood flow in the muscle increases,
whereas that of the kidney or intestines decreases. Thus, intensive exercise might
induce acute renal damage that resembles a hypoxia/reperfusion-induced acute
kidney injury
6
. On the other hand, some systemic
changes should be considered including dehydration and systemic inflammation due to
muscle and intestinal damage; however, precise mechanisms of renal damage after
intense exercise have not been fully elucidated.Macrophages are recruited into the inflamed tissues and contribute to tissue damage
and inflammation via secretion of inflammatory cytokines
8
. When acute kidney injury is induced by the
hypoxia/reperfusion model, macrophages are recruited into the kidney and
inflammatory cytokines and chemokines are increased
9
. On the other hand, macrophage depletion by clodronate improved acute
kidney injury induced by hypoxia/reperfusion
10
11
. Jo et al. also reported that
macrophage depletion by clodronate improved acute kidney injury induced by
hypoxia/reperfusion accompanied with reduced apoptosis and production of
inflammatory cytokines and chemokines
12
. Therefore,
the exhaustive exercise-induced infiltration of macrophages might be an important
factor in the development of renal damage; however, it has not been demonstrated
whether macrophages can promote renal damage following exhaustive exercise. Here, we
hypothesized that macrophage depletion by peritoneal administration of clodronate
liposomes may also ameliorate acute renal damage after exhaustive exercise, and
assessed renal function, renal histology, inflammatory responses, and apoptosis
24 hours after exhaustive exercise.
Materials and Methods
Animals
Male C57BL/6 J mice were purchased from Kiwa Laboratory Animals
(Wakayama, Japan) at 10 weeks of age and were housed in groups of four mice per
cage in a controlled environment, under a light/dark cycle (lights on at
9:00 and off at 21:00). The experimental procedures complied with the Guiding
Principles for the Care and Use of Animals in Waseda University and were
approved by the Institutional Animal Care and Use Committee in the university
(2013-A110). The mice were randomly assigned to four groups: sedentary with
control liposome (n=8), sedentary with clodronate (n=8),
exhaustive exercise with control liposome (n=8), and exhaustive exercise
with clodronate (n=8). All the mice had free access to standard chow and
water.
Macrophage depletion
To deplete macrophages, 150 μL of Clophosome-A –
Clodronate Liposomes (Anionic) (Funakoshi, Tokyo, Japan) was administered
intraperitoneally under anesthesia with 2% isoflurane inhalation at
0.8 L/min (Abbott Japan, Tokyo, Japan) using a gas anesthesia
system for small laboratory animals (DS Pharma Biomedical, Osaka, Japan).
Control animals were administered 150 μL of plain control
liposomes for Clophosome-A (Funakoshi) in the same conditions.
Exercise protocol
Mice in the sedentary groups remained in resting conditions in the cage, whereas
mice in the exercise groups were subjected to exhaustive exercise 48 h
after the injection. One week before undergoing the exhaustive exercise, mice in
all groups were familiarized with running on a motorized treadmill (Natsume,
Tokyo, Japan). On the day of the experiment, the mice were forced via a shock
grid to run on a treadmill with a 7% gradient and the speed set to
10 m/min for 15 min, followed by
15 m/min for 15 min, and 20 m/min for
15 min each, and finally at 24 m/min until exhaustion.
Exhaustion was defined as the point when the mice refused to run despite being
given the shock grid five times.
Blood and kidney sampling
Animals were sacrificed at 24 h after exhaustive exercise in all groups.
Anesthesia was induced with 2% isoflurane inhalation at
0.8 L/min, and maintained with 1% at
0.8 L/min. Blood samples were obtained using heparin via the
abdominal aorta, centrifuged at 2600 g for 10 min and plasma was
stored at –80°C until analysis. The kidneys were removed and the
right kidneys were snap frozen by immersing the samples in liquid nitrogen and
stored at –80°C until analysis; the left kidneys were frozen in
Tissue-tek Crymold (Sakura, Torrance, CA, USA) filled with OCT compound (Sakura)
by immersing the samples in precooled isopentane at –80°C.
Assessment of renal function
The plasma concentrations of BUN and creatinine were analyzed by Oriental Yeast
Co., Ltd (Tokyo, Japan).
Histological analysis
Serial kidney sections 3 μm thick were used for staining and were
analyzed by microscope (Biozero BZ-8100; Keyence, Osaka, Japan).
Hematoxylin and eosin staining
The kidney specimens were fixed in 10% paraformaldehyde before being
embedded in paraffin. The specimens were sectioned at 3-μm,
deparaffinized, and stained with hematoxylin and eosin for light microscopic
analysis.
Immunohistochemistry
Immunohistochemistry was performed to examine the expression of F4/80,
monocyte chemoattractant protein-1 (MCP-1), and kidney injury molecule (KIM)-1.
The specimens were sectioned at 3 μm and deparaffinized and stained
using ImmunoCruz rabbit ABC Staining System (Santa Cruz Biotechnology, Dallas,
TX, USA). The primary anti-bodies used were rabbit anti-mouse F4/80
monoclonal antibody (M4150; Spring Bioscience, Pleasanton, CA, USA), rabbit
anti-MCP-1 antibody (ab25124; Abcam, London, UK), and rabbit anti-KIM-1 antibody
(ab47635; Abcam). F4/80 positive cells were counted on 4 random high
power (200×) fields/slide using BZ-2 software (Keyence).
TUNEL assay
A TUNEL assay for the detection of apoptotic cells was performed with apoptosis
in situ detection kit (Wako, Osaka, Japan) according to the
manufacturer’s protocol. The specimens were sectioned at 3 μm
and deparaffinized and stained; then the images were visualized by BZ-8100
(Keyence). Each of 4 randomly selected images were recorded at
200×magnification and analyzed by BZ-2 software (Keyence).
KIM-1 assay
The renal concentration of KIM-1 was measured using an enzyme-linked
immunosorbent assay (ELISA) kit (Abcam). The assay procedures were performed
according to the ELISA kit instructions.
Quantitative RT-PCR
Total RNA was extracted from the kidney using the RNeasy Mini Kit (Qiagen,
Valencia, CA, USA) according to the manufacturer’s instructions. The
purity of total RNA was assessed using the NanoDrop system (NanoDrop
Technologies, Wilmington, DE, USA). Total RNA was reverse-transcribed into cDNA
using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems,
Waltham, MA, USA). Quantitative RT-PCR was performed with the Fast 7500
real-time PCR system (Applied Biosystems) using Fast SYBR Green PCR Master Mix
(Applied Biosystems). The thermal profiles consisted of denaturation at
95°C for 10 min, followed by 40 cycles of 95°C for
3 sec, and annealing at 60°C for 15 sec. The
18 S ribosomal RNA was used as the housekeeping control, and all the
data were normalized by the expression of 18 S ribosomal RNA. The data
were expressed as the number of fold changes relative to the values of the
sedentary with the control liposome group. The specific PCR primer pairs for
each gene are shown in
Table 1
.
Table 1
Primer sequences for RT-PCR analysis.
Gene
Forward
Reverse
18 s ribosomal RNA
CGGCTACCACATCCAAGGA
AGCTGGAATTACCGCGGC
F4/80
CTTTGGCTATGGGCTTCCAGTC
GCAAGGAGGACAGAG-TTTATCGTG
MCP-1
CTTCTGGGCCTGCTGTTCA
CCAGCCTACTCATTGGGATCA
KIM-1
AAACCAGATTCCCACACG
GTCGTGGGTCTTCCTGTAGC
TNF-α
TCTTCTCATTCCTGCTTGTGG
GAGGCCATTTGGGAACTTCT
IL-6
AACGATGATGCACTTGCAGA
TGGTACTCCAGAAGACCAGAGG
IL-1β
GGGCCTCAAAGGAAAGAATC
TTGCTTGGGATCCACACTCT
MCP, monocyte chemoattractant protein; KIM, kidney injury molecule; TNF,
tumor necrosis factor; IL, interleukin.
Table 1
Primer sequences for RT-PCR analysis.MCP, monocyte chemoattractant protein; KIM, kidney injury molecule; TNF,
tumor necrosis factor; IL, interleukin.
Statistical analyses
All data are presented as mean±standard error of the mean (SEM). All
statistical analyses were performed using version 19.0 of the Statistical
Package for Social Sciences software (IBM Corp., Armonk, NY, USA). To evaluate
the statistical significance of the exhaustive exercise and macrophage
depletion, the data were determined using two-way ANOVA. If significant
interactions were observed, further comparisons were performed using the
Tukey’s HSD post hoc test. The level of significance was set at
P
<0.05.
Results
Running time
The mean running time until the mice became exhausted was
161.0±14.2 min in the control liposomes groups and
187.7±13.8 min in the clodronate groups, which were not
statistically different.
Macrophage Infiltration in the kidney
To identify the effect of clodronate treatment on exhaustive exercise-induced
macrophage infiltration, we examined immunochemistry staining and mRNA
expression of F4/80, which is a specific maker of macrophage, and MCP-1,
which recruits monocytes and macrophages to the sites of inflammation. The
number of F4/80 positive cells was significantly higher in exhaustive
exercise group compared to sedentary group. However, the F4/80 positive
cells were markedly decreased in the exhaustive exercise with clodronate
liposome group (
Fig. 1a, b
). Similarly, while
exhaustive exercise increased the F4/80 mRNA in the kidney, injection of
clodronate liposome reduced it (
Fig. 1b
).
Fig. 1
Effects of exhaustive running exercise and macrophage
depletion on macrophage infiltration in kidney of mice. (
a
)
Histochemistry analysis of F4/80 and MCP-1 (brown; F4/80 and MCP-1
positive cells, original magnification×200). A number of F4/80
positive cells are marked by arrows. G shows the renal glomeruli, RT
shows renal tubules. (
b
) F4/80 positive cells. (
c
) F4/80
and (
d
) MCP-1 mRNA expressions in the kidney. Values represent
means±SEM. Analyses were performed using 2-way ANOVA for
multiple comparisons. **
P
<0.01,
*
P
<0.05. MC
P
, monocyte chemoattractant
protein; Sed, sedentary; Ex, exercise.
Effects of exhaustive running exercise and macrophage
depletion on macrophage infiltration in kidney of mice. (
a
)
Histochemistry analysis of F4/80 and MCP-1 (brown; F4/80 and MCP-1
positive cells, original magnification×200). A number of F4/80
positive cells are marked by arrows. G shows the renal glomeruli, RT
shows renal tubules. (
b
) F4/80 positive cells. (
c
) F4/80
and (
d
) MCP-1 mRNA expressions in the kidney. Values represent
means±SEM. Analyses were performed using 2-way ANOVA for
multiple comparisons. **
P
<0.01,
*
P
<0.05. MC
P
, monocyte chemoattractant
protein; Sed, sedentary; Ex, exercise.In addition, MCP-1 immunohistochemical staining showed that the expression of
MCP-1 in the exercise with control liposomes group (
Fig. 1a
) was increased primarily in the tubular epithelial cells
compared with the sedentary with control liposomes group (
Fig. 1a
). The expression of MCP-1 was low in both
the exercise with clodronate group and sedentary with clodronate group (
Fig. 1a
). The main effect of exercise on MCP-1
mRNA expression was observed (
Fig. 1c
).
Renal function
The effects of exhaustive exercise and macrophage depletion on renal function
were assessed with the plasma levels of BUN and creatinine 24 h after
exercise. There was no significant difference in the levels of BUN and
creatinine in each group (
Table 2
).
Table 2
Effects of exhaustive exercise and macrophage depletion
on renal function.
Table 2
Effects of exhaustive exercise and macrophage depletion
on renal function.Values are mean±SE.; BUN, blood urea nitrogen; CRE, creatinine;
Sed, sedentary; Ex, exercise.
Renal histology
To evaluate renal damage, we performed H&E, KIM-1, and TUNEL staining. In
H&E staining, the pathological changes were obvious in the exhaustive
exercise group, manifested as congested and swollen glomeruli tubular
dilatation, and nuclei infiltration. Compared with those of the exhaustive
exercise group, the kidneys of the exhaustive exercise with macrophage depletion
group showed far fewer histological abnormalities: fewer congested and swollen
glomeruli, less tubular dilatation, and less nuclei infiltration were observed
(
Fig. 2a
).
Fig. 2
Effects of exhaustive running exercise and macrophage
depletion on kidney injury in mice. (
a
) H&E, KIM, and
TUNEL staining of kidney sections (original magnification×200),
black arrow shows location of glomerular congestion and swelling, white
arrow shows nuclear infiltration, and # shows tubular dilation. A number
of TUNEL positive cells are marked by arrowheads. G shows the renal
glomeruli, RT shows renal tubules. (
b
) (
c
) KIM-1 mRNA
expression and concentration of kidney, (
d
) the percentage of
TUNEL positive cells. Values represent means±SEM. Analyses were
performed using 2-way ANOVA for multiple comparisons.
**
P
<0.01,
*
P
<0.05. KIM, kidney injury molecule; TUNEL,
terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick-end
labeling; Sed, sedentary; Ex, exercise.
Effects of exhaustive running exercise and macrophage
depletion on kidney injury in mice. (
a
) H&E, KIM, and
TUNEL staining of kidney sections (original magnification×200),
black arrow shows location of glomerular congestion and swelling, white
arrow shows nuclear infiltration, and # shows tubular dilation. A number
of TUNEL positive cells are marked by arrowheads. G shows the renal
glomeruli, RT shows renal tubules. (
b
) (
c
) KIM-1 mRNA
expression and concentration of kidney, (
d
) the percentage of
TUNEL positive cells. Values represent means±SEM. Analyses were
performed using 2-way ANOVA for multiple comparisons.
**
P
<0.01,
*
P
<0.05. KIM, kidney injury molecule; TUNEL,
terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick-end
labeling; Sed, sedentary; Ex, exercise.KIM-1 is a marker of kidney injury. Immunohistochemical staining showed that
KIM-1 expression in the exercise with control liposomes group was increased
compared with the sedentary with control liposomes group (
Fig. 2a
). On the other hand, increased KIM-1
expression was suppressed in the exercise with clodronate group (
Fig. 2a
). Consistently, while KIM-1concentration
and mRNA level was significantly increased in the exercise with control
liposomes group compared with the sedentary with control liposomes group,
injection of clodronate liposome reduced it (
Fig. 2b,
c
).The TUNEL positive cells, a marker of cell apoptotic death, in the sedentary with
control liposome group were 1.3%, whereas the exhaustive exercise with
control liposome group showed 16.5% TUNEL positive cells. However, the
percentage of TUNEL positive cells in the exhaustive exercise with clodronate
liposome group was significantly lower than that observed in the exhaustive
exercise with control liposomes group (
Fig.
2d
).
Levels of inflammatory cytokines in the kidney
The effect of exhaustive exercise and macrophage depletion on the levels of
inflammatory cytokines in the kidney 24 h after exercise was assessed
with the expression levels of TNF-α (
Fig.
3a
), interleukin (IL)-6 (
Fig. 3b
),
and IL-1β (
Fig. 3c
) mRNA. While the
expression levels of TNF-α and IL-6 were increased by exercise, they
were ameliorated with clodronate (
Fig. 3a, b
).
The changes in the expression of IL-1β were similar, and there was no
significant difference (
Fig. 3c
).
Fig. 3
Effects of exhaustive exercise and macrophage depletion on
the expressions of inflammatory cytokines in the kidney. (
a
)
TNF-α, (
b
) IL-6, and (c) IL-1β mRNA expression in
the kidney. Values represent means±SEM. Analyses were performed
using 2-way ANOVA for multiple comparisons.
**
P
<0.01, *
P
<0.05.
Sed, sedentary; Ex, exercise; TNF, tumor necrosis factor; IL,
interleukin.
Effects of exhaustive exercise and macrophage depletion on
the expressions of inflammatory cytokines in the kidney. (
a
)
TNF-α, (
b
) IL-6, and (c) IL-1β mRNA expression in
the kidney. Values represent means±SEM. Analyses were performed
using 2-way ANOVA for multiple comparisons.
**
P
<0.01, *
P
<0.05.
Sed, sedentary; Ex, exercise; TNF, tumor necrosis factor; IL,
interleukin.
Discussion
Endurance exercise induces acute renal damage
6
, but
the precise mechanisms are not well known. Clodronate liposomes are widely used to
deplete macrophages
13
. In this study, clodronate
liposomes were administered intraperitoneally in order to elucidate the role of
macrophages in acute renal damage induced by endurance exercise in mice.Infiltration of inflammatory cells is commonly seen in acute kidney injury by various
causes
14
. In the ischemia/reperfusion
model, it was reported that macrophage infiltration was observed in 24 h
post-reperfusion
15
. On the other hand, after
exhaustive exercise, infiltration of immune cells may occur in H&E staining
16
; however there are no reports that actually
evaluate this. In this study, F4/80 positive cells determined by
immunostaining and F4/80 mRNA expression level were significantly increased
in the kidney 24 h after exhaustive exercise, and both were suppressed by
clodronate liposomes. Thus, we showed that macrophage infiltration was observed
after exhaustive exercise in our model and that we successfully achieved macrophage
depletion by clodronate liposomes.MCP-1 is a chemokine that belongs to the CC chemokine family. MCP-1 is expressed in
many types of cells and predominantly recruits monocytes and macrophages to the
sites of inflammation, and CC chemokine receptor type 2 (CCR2) is a receptor for
MCP-1 and expressed on macrophages. Furuichi et al. reported that in the mice model
of ischemia/reperfusion, macrophage infiltration was decreased in CCR2
knockout mice compared with the wild type
17
. It is
also reported that MCP-1 expression was decreased with clodronate pretreatment in
the ischemia/reperfusion model in the kidney
12
. Our immunohistologic study showed that the expression of MCP-1 in
the exercise with control liposomes group was increased primarily in the tubular
epithelial cells compared with the sedentary with control liposomes group after the
exhaustive exercise, and the increase was suppressed by clodronate liposomes.
However, there was no significant MCP-1 expression in glomeruli in our model. It is
suggested that the increased MCP-1 expression by exhaustive exercise contributes to
macrophage infiltration. In our model, the levels of mRNA expression of MCP-1 in the
kidney were not significantly altered with the exhaustive exercise. We used total
renal tissue for RNA extraction; therefore, it is possible that the changes only in
the tubules were not sufficient to detect the significant difference by quantitative
RT-PCR.In our study, we determined that acute renal damage was induced by exhaustive
exercise on the grounds that histological damage, KIM-1, and apoptosis were
increased, although in our data renal function assessed by the levels of BUN and
creatinine 24 h after the exercise was not significantly altered. In the
previous study, the levels of BUN and creatinine were increased in 6 h and
returned to normal in 24 h after exhaustive swimming
7
. We also found that BUN increased significantly
immediately after exercise in our exhaustive exercise model, but fell to baseline
after 24 hours (data not shown), suggesting that they might have increased
earlier. However, these elevations might not have been observed because we sampled
24 hours after exercise to assess macrophage infiltration and inflammation
in the kidney. We observed pathological changes as well as the elevated expression
of KIM-1 in the kidney, and the increase was ameliorated with clodronate. The
increased expression of KIM-1 recently emerged as a marker of acute kidney injury
18
. In addition, it was reported that KIM-1
expression was increased in the renal proximal epithelial cells in the post-ischemic
kidney
19
. Apoptosis in tubular epithelial cells is
also an important feature of acute kidney injury
20
.
In previous studies, apoptosis in tubular epithelial cells was induced by endurance
exercise
6
and exhaustive swimming
7
. In the present study, while increased TUNEL
positive cells were observed in kidney, which demonstrated that apoptosis was
induced by exhaustive exercise, it was ameliorated by macrophage depletion. It was
reported that KIM-1 reduced high glucose-induced apoptosis in renal tubular
epithelial cells, thus a direct relationship between KIM-1 and apoptosis has been
suggested. Therefore, our data strongly suggest that acute renal damage by
exhaustive exercise is attenuated when macrophage infiltration is blocked.Macrophages are recruited into the inflamed tissues and contribute to tissue damage
and inflammation via secretion of inflammatory cytokines
8
. In humans, the plasma concentrations of pro-inflammatory cytokines
appear elevated after prolonged exercise
2
21
. Moreover, protein expression of TNF-α was
elevated in the kidney after exhaustive exercise in rats
7
. Interestingly, several studies reported that substances with
anti-inflammatory properties were effective in suppressing acute renal damage
following exhaustive exercise
6
7
. Therefore, it is possible that acute renal damage
by exhaustive exercise is influenced by mediators released from activated
macrophages, including pro-inflammatory cytokines. In this study, we quantified mRNA
expression levels of TNF-α, IL-6, and IL-1β to assess the
inflammatory responses in the kidney. Their expression levels were increased in the
ischemia/reperfusion model in mice
15
, and
these changes were suppressed by macrophage depletion
12
. Similarly, the levels of inflammatory cytokines were increased by
exhaustive exercise but ameliorated by macrophage depletion in this study.
Therefore, macrophage infiltration is likely to be a primary cause of local
inflammation in the kidney following exhaustive exercise. This study also showed
that the alteration in pro-inflammatory cytokine mRNA levels in the kidney was
similar to the altered pattern of KIM-1 mRNA expression, protein concentration, and
TUNEL positive cells. Therefore, induction of inflammation by macrophage
infiltration may play a key role in renal damage following exhaustive exercise.Interestingly, it was reported that there are different types of macrophages
22
. M1 macrophages predominantly produce
pro-inflammatory cytokines such as TNF-α, whereas M2 macrophages produce
anti-inflammatory cytokines such as IL-10 and IL-1 receptor antagonist
23
. In acute kidney injury induced by
ischemia/reperfusion, M1 macrophages are recruited into the kidney in the
first 48 h, and M2 macrophages predominate at later time points and
contribute to tissue repair
24
. In the present
study, testing was carried out only at 24 h post-exercise. It is assumed
that M1 macrophage depletion ameliorated the acute kidney damage induced by
exhaustive exercise. Studies are needed to test different time points, and the roles
of different macrophage phenotypes are needed to elucidate further the pathogenesis
of acute renal damage induced by exhaustive exercise. Immune cells other than
macrophages have been reported to be involved in hypoxia/reperfusion-induced
acute kidney injury
8
. It is reported that
neutrophil depletion improved acute kidney injury induced by
hypoxia/reperfusion and decreased inflammatory cytokines
25
. Recently, lymphocytes have also been shown to
contribute to acute kidney injury
26
. How immune
cells other than macrophages affect exercise-induced acute renal damage also needs
further investigation.In summary, exhaustive exercise caused inflammatory responses, apoptosis, and acute
renal damage in mice, and these changes were attenuated with macrophage depletion by
clodronate liposomes. This study has demonstrated that macrophages play a
significant role in exhaustive exercise-induced acute renal damage.