| Literature DB >> 35419346 |
Wenfeng Zhu1, Rui Chen2, Weiheng Wang2, Yi Liu2, Changgui Shi2, Songjun Tang1, Guoke Tang3.
Abstract
Continuous efforts on pursuit of effective drug delivery systems for engineering hydrogel scaffolds is considered a promising strategy for the bone-related diseases. Here, we developed a kind of acetylsalicylic acid (aspirin, ASA)-based double-network (DN) hydrogel containing the positively charged natural chitosan (CS) and methacrylated gelatin (GelMA) polymers. Combination of physical chain-entanglement, electrostatic interactions, and a chemically cross-linked methacrylated gelatin (GelMA) network led to the formation of a DN hydrogel, which had a suitable porous structure and favorable mechanical properties. After in situ encapsulation of aspirin agents, the resulting hydrogels were investigated as culturing matrices for adipose tissue-derived stromal cells (ADSCs) to evaluate their excellent biocompatibility and biological capacities on modulation of cell proliferation and differentiation. We further found that the long-term sustained ASA in the DN hydrogels could contribute to the anti-inflammation and osteoinductive properties, demonstrating a new strategy for bone tissue regeneration.Entities:
Keywords: DN hydrogel; GelMA; aspirin; bone regeneration; drug delivery
Year: 2022 PMID: 35419346 PMCID: PMC8995466 DOI: 10.3389/fchem.2022.874985
Source DB: PubMed Journal: Front Chem ISSN: 2296-2646 Impact factor: 5.221
Sequences of quantitative polymerase chain reaction primers.
| Gene | Forward Primer (5′‐3′) | Reverse Primer (3′‐5′) |
|---|---|---|
|
| ATGCTTCATTCGCCTCACAAAC | CCAAAAGAAGTTTTGCTGACATGG |
|
| CCCAAAGGCTTCTTCTTG | CTGGTAGTTGTTGTGAGC |
|
| ACCACAGTCCATGCCATCAC | TCCACCACCCTGTTGCTGTA |
RUNX2, runt-related transcription factor 2; ALP, alkaline phosphatase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
FIGURE 1Schematic illustration of the fabricated ASA-encapsulated GelMA-CS DN hydrogels.
FIGURE 2(A) 1H NMR spectrum of GelMA. (B) SEM images of (a) GelMA-CS and (b) GelMA-CS@ASA hydrogels. (C) Rheological profile of the GelMA-CS@ASA hydrogel. (D) Compressive curves of GelMA-CS hydrogels with or without ASA loaded.
FIGURE 3Release behavior of aspirin from the GelMA-CS@ASA DN hydrogel.
FIGURE 4Cytotoxicity of GelMA-CS@ASA hydrogels in vitro. (A) Live/dead staining of ADSCs. Cells in green manifest living ADSCs, while cells in red manifest dead ones. (B) Cell viability and (C) proliferation was detected by using the Cell Counting Kit-8 after cultivation for various time periods.
FIGURE 5Effects of GelMA-CS@ASA DN hydrogels on the ADSC osteogenesis. (A) Osteogenic differentiation detection based on Alizarin Red. (B) Quantification of calcification depositions. (C) mRNA analysis of osteogenic markers of ALP and Runx2. Statistically significant differences in comparison with (a) control untreated cells, (b) GelMA-CS hydrogel, (c) GelMA-CS@ASA (ASA, 10 μg/ml) hydrogel, and (d) GelMA-CS@ASA (ASA, 100 μg/ml) hydrogel. ***p < 0.001, **p < 0.01, *p < 0.05.