| Literature DB >> 35407062 |
Urszula Zarzecka1, Arkadiusz Józef Zakrzewski1, Wioleta Chajęcka-Wierzchowska1, Anna Zadernowska1.
Abstract
Enterococci are important opportunistic pathogens with the capacity to acquire and spread antibiotic resistance. At present, linezolid-resistant enterococci (LRE) pose a great challenge. Linezolid is considered as a last resort antibiotic in the treatment of enterococcal infections, so it is important to monitor the occurrence of LRE in various environments. The aim of this study was to define the genetic mechanisms of linezolid resistance in enterococci (E. faecalis, E. faecium, E. hirae, E. casseliflavus) isolated from foods of animal origin (n = 104). Linezolid resistance (LR) was shown by 26.9% of isolates. All of them displayed linezolid MICs of 8-32 µg/mL, and 96.4% of them were multidrug multidrug-resistant. The most common acquired linezolid resistance gene in LR isolates was poxtA (64%), followed by optrA (28%) and cfr (12%). According to the authors' knowledge, this research is the first to indicate the presence of the cfr gene among isolates from food. In 28.6% of the isolates, the point mutation G2576T in the V domain of the 23S rRNA was responsible for linezolid resistance. All isolates harbored the wild-type rplC, rplD and rplV genes. The obtained results indicate that linezolid resistance among enterococci in animal-derived food may result from various genetic mechanisms. The most worrying is that this resistance is encoded on mobile genetic elements, so there is a risk of its rapid transmission, even despite the lack of selective pressure resulting from the use of antibiotics.Entities:
Keywords: antibiotic resistance; cfr; food; linezolid resistant enterococci; optrA; poxtA; resistance genes
Year: 2022 PMID: 35407062 PMCID: PMC8998034 DOI: 10.3390/foods11070975
Source DB: PubMed Journal: Foods ISSN: 2304-8158
Oligonucleotides used in the study.
| Gene | Primer Sequence 5′-3′ | Annealing Temperature | References |
|---|---|---|---|
| 23S rRNA | F: GTAACGATTTGGGCACTGTCG | 55 °C | [ |
| F: GCGCTTCATTCGTGAATTCAA | 50 °C | ||
| F: ACGATGCAATCGTAATGCAA | 51 °C | ||
| F: GGACATGCTGCTGACGATA | 50 °C | ||
|
| F: TGAAGTATAAAGCAGGTTGGGAGTCA | 50 °C | [ |
| F: TACTTGATGAACCTACTAACCA | 50 °C | [ | |
| F: AAAGCTACCCATAAAATATC | 50 °C | [ |
Characteristics of linezolid-resistant (LZDR) strains analyzed in this study.
| Species | Antibiotic Resistance Profile | LZD MIC Range [µg/mL] | LZDR
| Isolation Source |
|---|---|---|---|---|
|
| E, TE, LZD, RD | 8–32 | Sushi (3) | |
| NOR, E, TE, LZD, RD | 8 | Sushi (3) | ||
| AMP, CIP, NOR, E, FOT, LZD, F, RD | 16 | Raw milk (1) | ||
| TE, LZD, RD, S | 8 |
| Raw milk (1) | |
| CIP, TE, LZD, RD, DO, MH | 8 | ∆G2576T | Raw milk (1) | |
| CIP, NOR, VA, LZD, RD | 16 | Raw milk (1) | ||
| CIP, LZD, RD | 8–16 | Sushi (2) | ||
| VA, LZD, F, RD | 8 | Sushi (1) | ||
| CIP, NOR, VA, E, LZD, RD | 8 | Sushi (1) | ||
| CIP, VA, LZD, F, RD, C, S | 8 | Sushi (1) | ||
| LZD, RD | 8–16 | Raw milk (2) | ||
| CIP, VA, E, LZD, F, RD, C | 32 | ∆G2576T | Sushi (1) | |
| CIP, NOR, VA, E, TE, LZD, RD | 16 |
| Raw milk (1) | |
| CIP, NOR, LZD, RD, MH | 8 | ∆G2576T | Raw milk (1) | |
| CIP, VA, LZD, RD, C, MH | 8 | Sushi (2) | ||
| CIP, NOR, VA, LZD, RD | 8 | ∆G2576T | Sushi (1) | |
| CIP, NOR, VA, LZD, F, RD, C | 32 | ∆G2576T | Sushi (1) | |
| CIP, LZD, RD | 8 | ∆G2576T | Sushi (1) | |
|
| CIP, QD, LZD, RD | 32 |
| Raw milk (1) |
| AMP, CIP, NOR, VA, QD, LZD, RD | 16 | ∆G2576T | Raw milk (1) | |
|
| QD, LZD | 8 | ∆G2576T | Shrimp (1) |
Abbrevations: LZDR—linezolid resistance, E—erythromycin, TE—tetracycline, LZD—linezolid, RD—rifampin, NOR—norfloxacin, AMP—ampicillin, CIP—ciprofloxacin, FOT—fosfomycin, F—nitrofurantoin, S—streptomycin, DO—doxycycline, MH—minocycline, VA—vancomycin, C—chloramphenicol, QD—quinupristin/dalfopristin. ∆G2576T-mutation G2576T in the 23S rRNA
Figure 1The genetic background of linezolid-resistant (LZDR) Enterococcus strains analyzed in this study.