A rapid, specific, extraction-less, and cost-effective RT-LAMP test for the detection of SARS-CoV-2 in clinical specimens.

In 2019 a newly identified coronavirus, designated as severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has spread rapidly from the epicenter in Wuhan (China) to more than 150 countries around the world, causing the Coronavirus disease 2019 (COVID-19) pandemic. In this study, we describe an extraction-less method based on reverse transcriptase loop-mediated isothermal amplification (RT-LAMP) intended for the rapid qualitative detection of nucleic acid from SARS-CoV-2 in upper respiratory specimens, including oropharyngeal and nasopharyngeal swabs, anterior nasal and mid-turbinate nasal swabs, nasopharyngeal washes/aspirates or nasal aspirates as well as bronchoalveolar lavage (BAL) from individuals suspected of COVID-19 by their healthcare provider. The assay's performance was evaluated and compared to an RT quantitative PCR-based assay (FDA-approved). With high sensitivity, specificity, and bypassing the need for RNA extraction, the RT-LAMP Rapid Detection assay is a valuable and fast test for an accurate and rapid RNA detection of the SARS-CoV-2 virus and potentially other pathogens. Additionally, the versatility of this test allows its application in virtually every laboratory setting and remote location where access to expensive laboratory equipment is a limiting factor for testing during pandemic crises.

Introduction

In December 2019, an outbreak in Wuhan of a severe respiratory illness was caused by a previously unrecognized coronavirus, which has since been named severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) [1-6]. After the virus spread in more than 150 countries worldwide, the COVID-19 was declared a worldwide pandemic. The SARS-CoV-2 related pandemic has posed challenges for the global market, economy, and scientific research and underlined significant inequality and inaccessibility to testing for many countries worldwide [7,8]. Point-of-care serial screening can provide rapid results, and it is critical to identify asymptomatic individuals carrying the virus. Classic methods of screening, and virus RNA detection like RT-PCR, are labor expensive, require additional reagents for RNA extraction, and highly trained technicians in molecular biology techniques are needed. RT-LAMP (loop-mediated isothermal amplification) methods based on a colorimetric read-out have been evaluated as a suitable alternative to the regular PCR methods [9]. However, samples require refrigeration and must be analyzed within a short time frame. Additionally, RT-LAMP combined with a colorimetric read-out poses challenges for data interpretation due to high ambiguity and pH fluctuations can easily alter the readout [10].

Additionally, the current pandemic has introduced an unprecedented challenging situation in obtaining plastic consumables and RNA extraction kits. Manufacturers worldwide still have issues satisfying the demand for highly requested reagents for SARS-CoV-2 serial screening and biomedical research in general. The crisis has also accentuated significant disparities, and laboratories in remote locations and with limited budgets can hardly afford expensive quantitative PCR equipment and reagents. Rapid tests for SARS-CoV-2 were implemented as fast assays to control transmission and provide results in less than one hour. However, increasing evidence suggests significant risks associated with the false positivity and negativity rate of these tests, especially if the screening strategy is based on lateral flow antigen tests (rapid tests) [11,12]. Thus, alternative testing methods based on fast and reliable approaches without compromising the rigor of the testing pipeline are critically needed.

The current study shows an extraction-less method that can go from patient sample collection to testing and data interpretation in less than one hour (Prime CovidDetect™ Rapid Detection kit). This method is based on isothermal amplification and can be performed virtually on every equipment able to maintain a temperature of 65 degrees Celsius for 50 minutes and can be paired with any plate reader and does not necessarily need quantitative PCR equipment for data interpretation and visualization. The assay utilizes the well-established LAMP (loop-mediated isothermal amplification) method [6,13-15] combined with the innovative iSWAB™ Extraction-less buffer (Mawi DNA Technologies) that was designed to eliminate the RNA extraction step in the COVID-19 Molecular testing workflow, allowing researchers to perform direct RT-PCR or RT-LAMP on individual and pooled samples. The iSWAB- Extraction-less buffer is a non-toxic stabilizing technology that enables the inactivation of bacteria, fungi, spores, and viruses, allows ambient collection and transport of various bio-samples, and preserve the nucleic acid material at the time of collection. The buffer stabilizes nasal swabs, and these samples can be used directly in the RT-LAMP reactions without any prior major (RNA extraction) or minor (heating or/and Proteinase K treatment) sample processing and successfully detect SARS-CoV-2 without any observed PCR inhibition. After assessing the Limit of Detection (LoD) and comparing the detection rate, sensitivity, specificity, of the Prime CovidDetect™ Rapid Detection kit to a standard comparator assay (FDA approved) for the detection of SARS-CoV-2, we showed that the assay is a robust alternative to PCR based assays and can be virtually adopted in any laboratory settings for the rapid identification of the SARS-CoV-2 RNA.

Material and methods

LAMP reagents and reaction set-up

The Prime CovidDetect™ Rapid Detection kit used eighteen primers to identify SARS-CoV-2 (ORF1 a/b, E, and N genes) and six primers to identify the 18S Ribosomal RNA gene (18S RNA) used as control. The primers’ sequences are illustrated in Table 1. Primers were mixed to obtain the following final concentrations per reaction (FIP 0.8 μM, BIP 0.8 μM, F3 0.1 μM, B3 0.1 μM, LB 0.2 μM, LF 0.2 μM). LAMP enzyme and Dye were purchased from New England Biolabs (cat# E1700L). The reaction set-up was prepared as follows: 4 μl of Enzyme Mix, 0.5 μl of SARS-CoV-2 Primers Mix (from 20X Stock) or 0.5 μl of 18S RNA Primers Mix (from 20X Stock), 0.25 μl of LAMP Dye, 3 μl of Input RNA (from the iSWAB™ Extraction-less buffer), 2.25 of Nuclease-Free Water (final reaction volume was 10 μl).

Table 1

LAMP primers.

Primer Name	Sequence (5’-3’)
N Gene
N2-F3	ACCAGGAACTAATCAGACAAG
N2-B3	GACTTGATCTTTGAAATTTGGATCT
N2-FIP	TTCCGAAGAACGCTGAAGCGGAACTGATTACAAACATTGGCC
N2-BIP	CGCATTGGCATGGAAGTCACAATTTGATGGCACCTGTGTA
N2-LF	GGGGGCAAATTGTGCAATTTG
N2-LB	CTTCGGGAACGTGGTTGACC
E Gene
E1-F3	TGAGTACGAACTTATGTACTCAT
E1-B3	TTCAGATTTTTAACACGAGAGT
E1-FIP	ACCACGAAAGCAAGAAAAAGAAGTTCGTTTCGGAAGAGACAG
E1-BIP	TTGCTAGTTACACTAGCCATCCTTAGGTTTTACAAGACTCACGT
E1-LF	CGCTATTAACTATTAACG
E1-LB	GCGCTTCGATTGTGTGCGT
ORF1 gene
ORF1-F3	CGGTGGACAAATTGTCAC
ORF1-B3	CTTCTCTGGATTTAACACACTT
ORF1-FIP	TCAGCACACAAAGCCAAAAATTTATTTTTCTGTGCAAAGGAAATTAAGGAG
ORF1-BIP	TATTGGTGGAGCTAAACTTAAAGCCTTTTCTGTACAATCCCTTTGAGTG
ORF1-LF	TTACAAGCTTAAAGAATGTCTGAACACT
ORF1-LB	TTGAATTTAGGTGAAACATTTGTCACG
18S RNA
18S RNA-F3	GTTCAAAGCAGGCCCGAG
18S RNA-B3	CCTCCGACTTTCGTTCTTGA
18S RNA-FIP	TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG
18S RNA-BIP	GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG
18S RNA-LF	AGAACCGCGGTCCTATTCCATTATT
18S RNA-LB	ATTCCTTGGACCGGCGCAAG

For each sample, four reactions were prepared: two replicates were prepared to detect SARS-CoV-2 and two for the detection of 18S RNA. Samples were loaded into a 384-well plate (cat#4309849 Thermo Fisher Scientific), sealed with optical adhesive film (cat# 4311971 Fisher Scientific), and centrifuged at 1000 rpm for 1 minute. The QuantStudio™ 5 was used to set up the reaction as follows: 100 cycles (each cycle of 30 seconds incubated at 65 degrees Celsius) were selected as PCR steps (on the FAM channel), and data collection was set to ON (for data collection). Cut-off values were applied as illustrated in Table 2. See the S1 File for a step-by-step instrument set-up and alternative instruments that could be used with the assay.

Table 2

Cut-off values.

Control Type	RT LAMP
	ORF1, E, N (FAM channel)	18S RNA (FAM channel)
Negative	Non-detected or detection ≥ 80 cycles	Non-detected or detection ≥ 80 cycles
Positive	Detection ≤ 80 cycles	Detection ≤ 80 cycles

Analytical sensitivity

Quantified heat-inactivated SARS-CoV-2 virus (cat#VR-1986 ATCC Lot# 70042082–3.9 x 105 genome copies/ml) was spiked into a real clinical matrix (nasopharyngeal swabs from 10 negative samples collected in iSWAB™ Extraction-less buffer) and used for serial dilutions. The LoD concentration was determined by testing 24 individual replicates for different dilutions (as recommended by the FDA). LoD was defined as the lowest concentration at which more than 95% of replicates were positive. Replicates were called negative if no amplification was detected before cycle 80 (threshold value established based on nonspecific amplification observed for detection at cycles ≥ 80) of the RT-LAMP according to the assay selecting criteria to call a sample positive or negative. Homology analysis was conducted for the ORF1, E, and N, primer sets against all SARS-CoV-2 sequences deposited at GISAID [16-18] on March 16, 2022. A total of 9,308,692 sequences were considered, of which 3,535,497 were discarded for being incomplete (≤ 29kb) or having poor coverage (≥ 1% undefined bases). The remaining 5,773,195 sequences comprise a superset of those sequences considered by GISAID to be both complete and high-coverage (GISAID evaluates genomes >29,000bp as complete and further assigns labels of high coverage <1% Ns—undefined bases- and low coverage >5% Ns. The exact locations of the primer regions in each sequence were identified from the multiple sequence alignment file provided by GISAID. Subsequently, for each of the three primer sets, the number of mismatches per sequence was calculated using the Levenshtein distance metric [19] Table 3.

Table 3

In silico inclusivity analysis.

	N-gene	E-gene	ORF1 region
Total Primer Length (nt)	169	168	187
Total # of Strains Evaluated	5773195	5773195	5773195
100% Match	5341972	4612424	5473635
1 Mismatch	409281	1147905	276374
2 Mismatches	17108	7490	17235
3 Mismatches	919	128	637
>3 Mismatches	3915	5248	5314

Analytical specificity

In silico cross-reactivity analysis was performed by aligning the SARS-CoV-2 primer sequences against sequences of common viruses as well as those coronaviruses most closely related to SARS-CoV-2. See Table 4 for the organisms assessed in silico for potential cross-reactivity. The analytical specificity was also assessed by wet testing. Briefly, samples were prepared by spiking intact viral particles or cultured RNA or bacterial cells into real clinical matrix as described before using panels/organisms from Zeptometrix, BEI Resources, and ATCC Table 5. Because no quantification information was available for the individual wet tested organisms, 50 μL of each stock was spiked into a negative clinical matrix and tested in replicates of three.

Table 4

In Silico cross-reactivity/exclusivity.

GenBank	Designation	N-gene	E-gene	Orf1 region
MN908947.3	Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome	100.00%	100.00%	100.00%
NC_002645.1	Human coronavirus 229E, complete genome	56.80%	54.80%	47.60%
NC_006213.1	Human coronavirus OC43 strain ATCC VR-759, complete genome	49.70%	48.80%	44.40%
NC_006577.2	Human coronavirus HKU1, complete genome	46.20%	50.00%	48.70%
NC_005831.2	Human Coronavirus NL63, complete genome	57.40%	55.40%	48.10%
NC_004718.3	SARS coronavirus Tor2, complete genome	82.20%	96.40%	44.40%
NC_019843.3	Middle East respiratory syndrome-related coronavirus isolate HCoV-EMC/2012, complete genome	48.50%	54.20%	47.60%
X67709.1	Adenovirus type 1 hexon gene	13.60%	13.70%	31.00%
NC_039199.1	Human metapneumovirus isolate 00–1, complete genome	43.80%	54.80%	47.10%
AF457102.1	HPIV-1 strain Washington/1964, complete genome	53.80%	50.60%	48.10%
AF533012.1	Human parainfluenza virus 2 strain GREER, complete genome	45.00%	50.00%	49.20%
KF530234.1	Human parainfluenza virus 3 strain HPIV3/MEX/1526/2005, complete genome	48.50%	50.60%	46.50%
NC_021928.1	Human parainfluenza virus 4a viral cRNA, complete genome, strain: M-25	46.70%	54.80%	45.50%
FJ966079.1	Influenza A virus (A/California/04/2009(H1N1)) segment 1 polymerase PB2 (PB2) gene, complete cds	44.40%	34.50%	34.20%
KT002533.1	Influenza A virus (A/canine/Illinois/12191/2015(H3N2)) segment 1 polymerase PB2 (PB2) gene, complete cds	37.30%	32.70%	23.50%
MN230203.1	Influenza B virus (B/California/24/2019) segment 1 polymerase PB1 (PB1) gene, complete cds	29.00%	23.80%	29.40%
MK715533.1	Influenza B virus (B/California/40/2018) segment 1 polymerase PB1 (PB1) gene, complete cds	35.50%	41.70%	37.40%
KP745766.1	Enterovirus D68 isolate NY328, complete genome	45.00%	41.70%	42.80%
U39661.1	Respiratory syncytial virus, complete genome	49.70%	50.00%	50.30%
NC_001490.1	Rhinovirus B14, complete sequence	45.60%	44.60%	44.40%

Table 5

Cross-reactivity/exclusivity wet testing of the Prime CovidDetect™ rapid detection kit.

Organism	Strain	Provider	Catalog number	ORF1/N/E-gene Detected Replicates
Adenovirus 11	Slobitski	ATCC	VR-12	0/3
Adenovirus 5	Adenoid 75	ATCC	VR-5	0/3
Bordetella pertussis	18323 [NCTC 10739]	ATCC	9797	0/3
Candida albicans	NIH 3172	ATCC	14053	0/3
Chlamydophila pneumoniae	TWAR strain 2023	ATCC	VR-1356	0/3
Enterovirus 70	J670/71	ATCC	VR-836	0/3
Haemophilus influenzae	NCTC 8143	ATCC	33391	0/3
Human parainfluenza virus 4b	CH 19503	ATCC	VR-1377	0/3
Human respiratory syncytial virus	A2	ATCC	VR-1540P	0/3
Human rhinovirus 61	6669-CV39 [V-152-002-021]	ATCC	VR-1171	0/3
Mycobacterium tuberculosis	H37Ra	ATCC	25177	0/3
Mycoplasma pneumoniae	Somerson et al. FH strain of Eaton Agent [NCTC 10119]	ATCC	15531	0/3
Pseudomonas aeruginosa	(Schroeter) Migula (ATCC® 10145™)—[CCEB 481, MDB strain BU 277, NCIB 8295, NCPPB 1965, NCTC 10332, NRRL B-771, R. Hugh 815]	ATCC	10145	0/3
Staphylococcus epidermidis	AmMS 205	ATCC	49134	0/3
Streptococcus pneumoniae	Mu50 [NRS1]	ATCC	700699	0/3
Streptococcus pyogenes	Rosenbach (ATCC® 49399™–QC A62)	ATCC	49399	0/3
Streptococcus salivarius	B2	ATCC	9759	0/3
Human coronavirus		BEI	NL63	0/3
Human coronavirus		BEI	229E	0/3
Human coronavirus, Middle East Respiratory Syndrome Coronavirus (MERS-CoV),	EMC/2012	BEI	NR-50549	0/3
SARS Coronavirus		BEI	NR-3882	0/3
SARS-Related Coronavirus 2		BEI	NR-52286	0/3
A. baumannii	307–0294	ZeptoMetrix	NATPPQ-BIO	0/3
Adenovirus Type 3		ZeptoMetrix	NATRVP-1	0/3
Adenovirus Type 3		ZeptoMetrix	NATPPA-BIO	0/3
Adenovirus Type 31		ZeptoMetrix	NATPPA-BIO	0/3
C. pneumoniae	CWL-029	ZeptoMetrix	NATPPA-BIO	0/3
Coronavirus	229E	ZeptoMetrix	NATRVP-1	0/3
Coronavirus	NL63	ZeptoMetrix	NATPPA-BIO	0/3
Coronavirus	OC43	ZeptoMetrix	NATRVP-1	0/3
Coronavirus	SARS	ZeptoMetrix	NATRVP-1	0/3
E. cloacae	Z101	ZeptoMetrix	NATPPQ-BIO	0/3
E. coli	Z297	ZeptoMetrix	NATPPQ-BIO	0/3
Enterovirus		ZeptoMetrix	NATRVP-1	0/3
H. influenzae	MinnA	ZeptoMetrix	NATPPQ-BIO	0/3
Human Metapneumovirus		ZeptoMetrix	NATRVP-1	0/3
Influenza A	H1	ZeptoMetrix	NATRVP-1	0/3
Influenza A	H1N1 (2009)	ZeptoMetrix	NATRVP-1	0/3
Influenza A	H3	ZeptoMetrix	NATRVP-1	0/3
Influenza A	H3 A/Brisbane/10/07	ZeptoMetrix	NATPPA-BIO	0/3
Influenza B		ZeptoMetrix	NATRVP-1	0/3
Influenza B	B/Florida/02/06	ZeptoMetrix	NATPPA-BIO	0/3
K. aerogenes	Z052	ZeptoMetrix	NATPPQ-BIO	0/3
K. oxytoca	Z115	ZeptoMetrix	NATPPQ-BIO	0/3
K. pneumoniae	KPC2	ZeptoMetrix	NATPPQ-BIO	0/3
K. pneumoniae	Z138; OXA-48	ZeptoMetrix	NATPPQ-BIO	0/3
K. pneumoniae	Z460; NDM-1	ZeptoMetrix	NATPPQ-BIO	0/3
L. pneumophila	Philadelphia	ZeptoMetrix	NATPPA-BIO	0/3
M. catarrhalis	Ne 11	ZeptoMetrix	NATPPQ-BIO	0/3
M. pneumoniae	M129	ZeptoMetrix	NATPPA-BIO	0/3
Metapneumovirus	8 Peru6-2003	ZeptoMetrix	NATPPA-BIO	0/3
P. aeruginosa	Z139, VIM-1	ZeptoMetrix	NATPPQ-BIO	0/3
P. mirabilis	Z050	ZeptoMetrix	NATPPQ-BIO	0/3
Parainfluenza virus Type 1		ZeptoMetrix	NATPPA-BIO	0/3
Parainfluenza virus Type 1		ZeptoMetrix	NATRVP-1	0/3
Parainfluenza virus Type 2		ZeptoMetrix	NATRVP-1	0/3
Parainfluenza virus Type 3		ZeptoMetrix	NATRVP-1	0/3
Respiratory Syncytial Virus A		ZeptoMetrix	NATRVP-1	0/3
Respiratory Syncytial Virus B		ZeptoMetrix	NATRVP-1	0/3
Rhinovirus 1A		ZeptoMetrix	NATRVP-1	0/3
Rhinovirus 1A		ZeptoMetrix	NATPPA-BIO	0/3
RSV A2		ZeptoMetrix	NATPPA-BIO	0/3
S. agalactiae	Z019	ZeptoMetrix	NATPPQ-BIO	0/3
S. aureus	MRSA;COL	ZeptoMetrix	NATPPQ-BIO	0/3
S. marcescens	Z053	ZeptoMetrix	NATPPQ-BIO	0/3
S. pneumoniae	Z022	ZeptoMetrix	NATPPQ-BIO	0/3
S. pyogenes	Z018	ZeptoMetrix	NATPPQ-BIO	0/3

Clinical samples

Positive (n = 30) and negative (n = 34) nasopharyngeal swabs were purchased from LEE BioSolutions and placed in the MAWI iSWAB™ Extraction-less buffer. The manufacturer confirmed samples’ negative or positive status using the TaqPath COVID-19 combo kit (cat# A47814 Thermo Fisher Scientific). The samples’ status (negative or positive) was re-confirmed by using the FDA-approved Quick-SARS-CoV-2 rRT-PCR kit (cat# R3011 Zymo Research) following the manufacturer’s instructions. According to the manufacturer’s provided information, the symptomatic status of the patients was unknown at the time of collection. Thus, an additional set of samples with known patients’ symptomatic status, positive symptomatic (n = 32), positive asymptomatic (n = 36), and negative (n = 49) were obtained from a diagnostic lab (Hook Diagnostics) and re-confirmed using the Quick-SARS-CoV-2 rRT-PCR kit (cat# R3011 Zymo Research). These samples were collected from 7 testing sites across the United States.

RNA extraction

For samples to be analyzed with the comparator assay (Quick-SARS-CoV-2 rRT-PCR kit), 140 μL of input material (nasopharyngeal swab in iSWAB™ extraction-less MAWI buffer) was used for RNA extraction performed with the QIAamp Viral RNA kit (cat# 52906 Qiagen) according to the manufacturer’s instructions except for the final elution step (performed in 20 μL of AVE buffer instead of 60 μL).

Results

Sensitivity and specificity of the assay

To assess the sensitivity of the assay we firstly investigated the limit of detection (LoD) to define the lowest limit at which the assay can detect the presence of intact virus with consistency and reproducibility. The LoD determination of the Prime CovidDetect™ Rapid Detection kit was 80 copies/μL, Table 6. The amplification plots of the 24 replicate wells for SARS-CoV-2 are shown in Fig 1; specifically, Orf1, E1, N2 genes (Fig 1A), and the 18S RNA control gene (Fig 1B). The positive control (Fig 1C and 1D) was SARS-CoV-2 (heat-inactivated and spiked as previously described) at the dilution at 10,000 copies/μL (six replicates) and the No Template Control (Fig 1E and 1F) was Nuclease-Free water (6 replicates).

Table 6

Limit of detection (LoD) of the Prime CovidDetect™ rapid detection kit.

Concentration	ORF1/E/N
Copies/μl	(Replicates detected)
1000	24/24 (100%)
100	24/24 (100%)
80	24/24 (100%)
70	22/24 (91.7%)
50	19/24 (79.1%)
10	11/24 (41.7%)

Fig 1

Amplification plots for SARS-CoV-2 and 18S RNA.

We then proceeded with a bioinformatic analysis to identify if the primers used within the assay were specific for SARS-CoV-2. Each primer set matched at 100% similarity against the SARS-CoV-2 Ref Seq reference genome (Wuhan-Hu-1; NC_045512.1) Table 3. In addition, an in-silico inclusivity analysis determined that the N primer set differed by one or fewer mutations for approximately 99.6% of GISAID sequences, the E primer set for 99.8%, and the ORF1 primer set for 99.8%. In total, it was determined that only 470 GISAID sequences differed by more than one nucleotide for two out of three SARS-CoV-2 primer sets, and only 41 sequences differed by more than one nucleotide for all three. Indeed, the potential for poor primer hybridization to co-occur across all three primer sets is exceedingly rare, at approximately 1 in 140,810. Our analysis revealed that the primers used to detect the genes Orf1, E, and N of the SARS-CoV-2 virus are highly specific (SARS-CoV-2 Gene Bank Reference MN908947.3) and show minimal cross-reactivity with other coronaviruses, adenoviruses, or influenza viruses Table 4. Additionally, as shown in Table 5, when the assay was used in wet testing for pathogens similar or related to SARS, no replicates were detected. Thus, both in silico and wet testing analysis showed a high specificity of the Prime CovidDetect™ Rapid Detection assay.

Clinical evaluation

To determine the detection rate of both positive and negative confirmed nasopharyngeal swabs we assessed the performance evaluation of the Prime CovidDetect™ Rapid Detection kit on clinical samples. Samples from two sources, and from symptomatic or asymptomatic patients were used. Additionally, samples were obtained from several testing sites across the United States to consider patients’ variability and potential differences in collection methods. When compared to a comparator test, approved by the FDA, the Prime CovidDetect™ Rapid Detection test showed a 100% detection rate Table 7. Positive Samples included a total of 24 out of 98 samples with a Ct value > 30 (clinically challenging samples) as quantified by the comparator assay (S2 File).

Table 7

Evaluation of clinical samples and comparison to the Zymo FDA-Approved comparator assay.

	Prime CovidDetect™		FDA Approved Comparator Assay		% Agreement
	Positive	Negative	Positive	Negative
Positive Unknown Status	30		30		100%
Positive Symptomatic	32		32		100%
Positive Asymptomatic	36		36		100%
Negative		83		83	100%
Positive Percent Agreement		100% (98/98)
Negative Percent Agreement		100% (83/83)

Discussion

According to the Center for Disease and Prevention (CDC) guidelines, upper respiratory specimens, including oropharyngeal and nasopharyngeal swabs, anterior nasal and mid-turbinate nasal swabs, nasopharyngeal washes/aspirates, or nasal aspirates as well as bronchoalveolar lavage (BAL), can be used for the detection of COVID-19 in healthcare settings. Commercial SARS CoV-2 diagnostic RT-PCR kits usually detect two or more genes related to the SARS-CoV-2 virus and require the classical experimental workflow where the sample is received in the laboratory, inventoried, RNA is extracted followed by RNA a quality control step, reverse transcription is performed, and PCR is performed. The entire process is not only labor-intensive (it can take up to more than 2 hours) but relies on expensive equipment (e.g., a quantitative PCR platform) and very often requires at least two optical filters to be able to read probes conjugated to two or more fluorophores. Additionally, the process relies on RNA extraction kits, plastic consumables, and trained laboratory scientists. Although ideal in a research laboratory setting, the entire pipeline has been revealed to be unrealistic in the context of the COVID-19 pandemic. Interestingly, a shortage of consumables and the lack of a trained workforce able to process laboratory specimens quickly and efficiently have afflicted laboratories worldwide, delaying testing. From a socioeconomic perspective, inequalities and disparities across countries have posed a challenge to COVID-19 testing. Many laboratories in challenging locations cannot afford expensive PCR equipment and highly trained staff. Rapid tests for COVID-19 based on antigen detection have been initially acclaimed as fast assays able to provide results in less than one hour, and in some cases, in less than 30 minutes. However, many concerns have been raised in the field due to collected data showing a continuous increase in false positivity rate and inaccuracies of these tests in some challenging circumstances [11,12]. Consequently, the FDA has issued an alert to healthcare providers regarding the potential for false-positive antigen results and steps to mitigate this risk (https://www.fda.gov/medical-devices/letters-health-care-providers/potential-false-positiveresults-antigen-tests-rapid-detection-sars-cov-2-letter-clinical-laboratory). Interestingly, concerns have also been raised related to false-negative results as a significant limitation of these tests. The local experience and reports to the FDA have found that antigen tests in symptomatic people are less sensitive than initially reported. In addition, these tests have much lower sensitivity when testing asymptomatic subjects. Rapid antigen tests can help quickly identify patients early in the course of SARS-CoV-2 infection when viral load is highest and who pose the greatest risk of SARS- CoV-2 transmission to others. They perform best when there is a high pre-test probability of infection (e.g., symptoms consistent with COVID-19, recent exposure to a known cause, and living/working in a setting where a high proportion of persons are infected). Thus, alternative testing methods are critically needed based on fast and reliable approaches. However, it is imperative to ensure that new candidate tests can guarantee low false positive and negative rates and ensure good specificity and sensitivity. Our study describes an RT-LAMP-based process that can quickly identify the SARS-CoV-2 RNA in clinical specimens in less than 1 hour. Because the method is based on an isothermal step, it does not require expensive PCR equipment. It could be quickly executed on a regular thermal cycler combined with a plate reader or water bath combined with a plate reader. The assay uses a fluorescent dye, and the end-point visualization can be achieved using any instrument with the following wavelength capacity: excitation 470 ±10 nm, emission 520 ±10 nm. Because the assay does not use probes but is primers based only, the manufacturing process is faster and extremely versatile as oligonucleotides can be obtained from several suppliers promptly. Perhaps, the most significant advantage of the assay described within the study is that no RNA extraction is needed. When samples are collected in the iSWAB™ (Mawi DNA Technologies) extraction-less buffer, the viral RNA is released into the collection tube and immediately available for assessment. Samples stored in the iSWAB™ do not require refrigeration and are stable at room temperature for up to twenty-one days. Both reverse transcription and LAMP reactions occur at 65 degrees Celsius, and thus, no preincubation and enzyme activation steps are required. Additionally, the assay uses a set of primers targeting three genes of the SARS-CoV-2 virus (Orf1, E1, N2) and an endogenous (18S RNA) gene. Combining three target genes (SARS-CoV-2) into the same reaction tube ensures maximum coverage and a broad detection compared to assessments based on one gene only (e.g., N1, N2). The RT-LAMP product can be monitored in a real-time fashion by the intercalating dye emission of fluorescence, or the emission signal can be detected by fluorescence readers or plate readers as an end-point assay. The specificity and sensitivity of the assay showed a high level of agreement with a standard RT-PCR FDA-approved comparator assay. Another essential advantage of the assay is that samples are analyzed in single-plex. Therefore, the probes’ signal interference, the relative expression levels of targets (including endogenous controls), and the dynamic range of their expression (issues often observed in RT-PCR approaches) do not represent a concern. The Prime CovidDetect™ Rapid Detection kit based on LAMP (like PCR-based approaches) offers advantages compared to antigen tests. Negative results from a rapid antigen test are often required to be confirmed by a molecular test, and antigen tests are more likely to miss an active SARS-CoV-2 infection than molecular tests Fig 2.

Fig 2

Comparison of RT-LAMP/PCR versus antigen tests for the detection of SARS-CoV-2.

Taken together, our data propose an entire pipeline (from sample collection to data visualization) that can efficiently be executed in less than 1 hour and presents a high level of versatility and adaptability not only to laboratory settings but also to impromptu testing sites Fig 3. Compared to a standard RT-PCR pipeline, the RT-LAMP assay provides a faster turnaround for data generation, is highly versatile, scalable on-demand, requires less workforce and presents advantages compared to rapid antigen tests Fig 4. Thus, making the assay a suitable candidate for SARS-CoV-2 detection in the context of the current COVID-19 pandemic. Additionally, data collected in our laboratory has shown that the same assay can be used for the detection of other pathogens like treponema pallidum, Influenza Viruses, Hepatitis virus, and more. Although the assay represents a valuable tool for the SARS-CoV-2 detection in clinical samples, significant limitations must be considered. The detection of 18S RNA indicates that human nucleic acid is present and implies that human biological material was collected, successfully extracted, and amplified. It does not necessarily suggest that the specimen is appropriate for detecting SARS-CoV-2.—Negative results do not preclude SARS-CoV-2 infection and should not be used as the sole basis for treatment. Optimum specimen types and timing for peak viral levels during infections caused by SARS-CoV-2 are not fully determined and might impact the assay. A false-negative result may occur if a specimen is improperly collected, transported, or handled.—If the virus mutates in the LAMP target regions, SARS-CoV-2 may not be detected.—Inhibitors and other types of interference may produce false-negative results—Detection of viral RNA may not translate to causation for clinical symptoms and severity of the symptoms.—The effect of vaccines, antiviral therapeutics, antibiotics, chemotherapeutic or immunosuppressant drugs has not been evaluated.

Fig 3

RT-LAMP rapid test workflow.

Fig 4

RT-PCR versus extraction-less RT-LAMP workflow.

Programming instructions, reaction set-up, and test interpretation.

(DOCX)

Click here for additional data file.

Ct values of positive and negative samples.

(XLSX)

Click here for additional data file.

15 Mar 2022

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Ruslan Kalendar

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for stating the following financial disclosure:

"The author(s) received no specific funding for this work. The work has been funded with private funding at Prime Discoveries. "

At this time, please address the following queries:

a) Please clarify the sources of funding (financial or material support) for your study. List the grants or organizations that supported your study, including funding received from your institution.

b) State what role the funders took in the study. If the funders had no role in your study, please state: “The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.”

c) If any authors received a salary from any of your funders, please state which authors and which funders.

d) If you did not receive any funding for this study, please state: “The authors received no specific funding for this work.”

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

3. Thank you for stating the following in the Competing Interests section:

"Francesco Elia Marino, Eugene Joseph, and Arun Manoharan are full time employee at Prime Discoveries. "

We note that one or more of the authors are employed by a commercial company: Prime Discoveries

a. Please provide an amended Funding Statement declaring this commercial affiliation, as well as a statement regarding the Role of Funders in your study. If the funding organization did not play a role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript and only provided financial support in the form of authors' salaries and/or research materials, please review your statements relating to the author contributions, and ensure you have specifically and accurately indicated the role(s) that these authors had in your study. You can update author roles in the Author Contributions section of the online submission form.

Please also include the following statement within your amended Funding Statement.

“The funder provided support in the form of salaries for authors [insert relevant initials], but did not have any additional role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. The specific roles of these authors are articulated in the ‘author contributions’ section.”

If your commercial affiliation did play a role in your study, please state and explain this role within your updated Funding Statement.

b. Please also provide an updated Competing Interests Statement declaring this commercial affiliation along with any other relevant declarations relating to employment, consultancy, patents, products in development, or marketed products, etc.

Within your Competing Interests Statement, please confirm that this commercial affiliation does not alter your adherence to all PLOS ONE policies on sharing data and materials by including the following statement: "This does not alter our adherence to  PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests) . If this adherence statement is not accurate and  there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.

Please include both an updated Funding Statement and Competing Interests Statement in your cover letter. We will change the online submission form on your behalf.

4. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

5. Please include a copy of Table 6 which you refer to in your text on page 16.

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

Reviewer #3: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

Reviewer #2: N/A

Reviewer #3: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Review Comments to the Author

Reviewer #1:

The manuscript reports developed a RT-LAMP test for SARS-CoV-2. They used iSWAB extraction-less buffer to skip the extraction step and perform RT-LAMP test. Three targets ORF1 a/b, E, and N genes are used and 18S as internal control.

For clinical evaluations, 30 positive and 34 negatives by real time rt-PCR were used. The ct values of these 30 positives are missed in the manuscript and is a required to evaluate how sensitive of RT-LAMP. A table is needed to present the Ct of those positive samples and with RT-LAMP result. If these pos samples had lower ct values, weak positive samples should be included for evaluations.

Tables 3 to 5 can be moved to supplemental parts.

Reviewer #2:

The manuscripts evaluates an RT LAMP approach for SARS-CoV-2 detection. The technology is getting a lot of attention and these studies are welcome. overall the study is straightforward. However, the conclusions are based on a small number of clinical samples not well characterized and stratified. unless this is provided the study is deceptive by showing 100% sensitivity and 100% ppv/npv with a calculated LoD of 80 cp/uL, which is above the theshold of most RT PCR kits. a minimal requirement would be to include genomes/uL or Ct values of the tested samples. a much better study would require a portion of 25% of positive samples Ct>30 (low viral load).

below some specific comments:

define cost-effective, the technology uses as read-out the real-time thermocycler so the cost is quite high - is it necessary? could it be colorimetric?

line 47 = causing the COVID-19 pandemic.

line 75 … identify people with COVID-19 who do not have symptoms and slow the spread of SARS-CoV-2 = Identify asymptomatic individuals carrying the virus.

line 78-88 quite unspecific, need to focus on published papers showing advantage of RT LAMP, use of colorimetric readout, use of a heat-block instead of thermocycler et etc (i.e. https://doi.org/10.1016/j.eclinm.2021.101101)

line 128 temperature not indicated, 65 °C??

line 173, threshold is arbitrary, why 80 cycles? clarify

line 177 update on current variants

line 244 and 253 ethics of human samples, some purchased some collected, clarify

LoD at 80 cp/ul is higher than RT PCR so I expect low viral loads not to be detected

stats not indicated, not necessary for these values at 100% but in case of adding more specimens then a contingency table with stats would be required.

Reviewer #3:

The submission by FE Marino et al is clear and easily readable. It is worthy of publication subject to some modifications or clarifications:

line 93: temperatures and reaction times are key elements in molecular biology techniques. However, not all laboratories are equally accurate in obtaining temperatures. Have the authors tested a temperature variation around 65 degrees and a time variation around 50 minutes?

line 96: It is interesting that the authors used iSWAB Extraction-less buffer swabs. However, during the pandemic we experienced many stock-outs (the authors mention it lines 385 to 387) and swabs were not spared. It would be interesting if the authors could test other types of swabs or even home-made swabs.

line 271: no need to repeat the LoD definition

line 289: table 6 not table 5

line 372: remove the S from DISCUSSIONS

line 409: the authors claim a result in one hour. This should be balanced as there is a long pre-analytical phase of sample deposition on the QS5 plate which should not be forgotten

line 456: is the detection of 18S ribosomal RNA not sufficient to validate the absence of inhibitors?

Table 4: It would be interesting if the viruses were mentioned next to the GenBank identification

Table 5: group pathogens by taxonomy; what is the enterovirus proposed by ZpetoMetrix, ditto for influenza B virus; have you tested a parainfluenza 4, what is the meaning of COL

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: Yes: Dr Jean-Michel MANSUY (MD)

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

19 Mar 2022

Rebuttal Letter to Editor and Reviewers.

Response to Editor

We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

-We have removed “data not shown” in the updated version of the manuscript and only referred to data available provided within the manuscript.

Please include a copy of Table 6 which you refer to in your text on page 16

-As correctly stated by Reviewer #3, this was a typo. All the tables were in the manuscript, but one portion of the text referred to the wrong table. We have amended the text and corrected the mistake.

Response to Reviewer 1

The manuscript reports developed a RT-LAMP test for SARS-CoV-2. They used iSWAB extraction-less buffer to skip the extraction step and perform RT-LAMP test. Three targets ORF1 a/b, E, and N genes are used and 18S as internal control.

For clinical evaluations, 30 positive and 34 negatives by real time rt-PCR were used. The ct values of these 30 positives are missed in the manuscript and is a required to evaluate how sensitive of RT-LAMP. A table is needed to present the Ct of those positive samples and with RT-LAMP result. If these pos samples had lower ct values, weak positive samples should be included for evaluations.

Tables 3 to 5 can be moved to supplemental parts.

--Dear reviewer, we had a total of 98 positive samples (combined) and 83 negative samples (combined) included within this study. All positive and all negative samples were analyzed by RT-PCR and Ct values are available for all the samples. Please see our updated supplemental material where we have reported the Ct values for all the positive and negative samples.

Clinically challenging samples with a Ct value > 30 represented 24.49% of positive samples (24 out of 98 positive samples).

Thanks for your time and your comments.

Response to Reviewer 2

The manuscript evaluates an RT-LAMP approach for SARS-CoV-2 detection. The technology is getting a lot of attention and these studies are welcome. overall the study is straightforward. However, the conclusions are based on a small number of clinical samples not well characterized and stratified. unless this is provided the study is deceptive by showing 100% sensitivity and 100% ppv/npv with a calculated LoD of 80 cp/uL, which is above the threshold of most RT PCR kits. a minimal requirement would be to include genomes/uL or Ct values of the tested samples. a much better study would require a portion of 25% of positive samples Ct>30 (low viral load).

--Dear reviewer, we have provided the Ct values in the supplemental material of the resubmitted manuscript. Our cohort of samples included 24.49% of positive samples with Ct values > 30 (24 positive samples out of 98 positive samples).

--Also, we want to specify some important points

--Our combined cohort of the positive samples was 96 positive samples and 83 negative samples.

--When we started our study, we have observed an important and perhaps, expected effect: samples decay and a significant drop in viral load over time. Many groups around the world have performed comparisons using Ct values provided by the vendor or testing laboratories (at the moment of testing) and then compared the performance to their proposed assay (very often performed many days later if not weeks later). This is not a fair comparison because Ct values collected days before comparison, for example, are not really informative (samples will inevitably degrade over time and the drop in sensitivity at that point is unclear if due to the assay itself or other external factors like viral decay, storage conditions, etc.).For our comparison, we decided to re-test every positive and negative sample in our laboratory the same day (or the day before) when the LAMP assay was executed using the FDA-approved comparator assay (Zymo). Doing so we had a fair comparison between technologies and viral decay did not affect the performance. This could explain our very high sensitivity rate. If a sample failed to be detected the day of testing in our laboratory using the RT-PCR FDA approved test (independently from what was previously reported by the vendor or testing lab) such sample was not used for the comparison because “not viable” at the moment of testing, in other words not viable at the moment of plate loading. Additionally, we use three targets for SARS-CoV-2 in our LAMP Assay (Orf1, E1, N2) vs. many other assays focused on N1/N2 genes only or N1 only. We will increase our pool of samples in the future and determine how sensitivity changes with a very large group of samples. However, we believe that our assay is robust in terms of sensitivity according to the data we have collected.

--We also would like to bring to your attention that we have asked for an external evaluation assessment on a total of 141 samples (55 positive samples and 83 negative samples) collected by healthcare providers from patients seeking SARS-CoV-2 testing and previously tested at New York University in Abu Dhabi using an implementation of the CDC 2019-nCoV Real-Time PCR Test. The NYU Abu Dhabi samples were tested in an automated high throughput setup using the Chemagic 360 automated RNA extraction and pipetting was tested with Agilent Bravo automated liquid handlers. All results generated in NYU Abu Dhabi using our LAMP assay were concordant with the RT-qPCR results obtained in the same testing lab in NYU Abu Dhabi. Our decision to remove this additional cohort of samples (external validation in Abu Dhabi) from the current manuscript was because I did not perform quantitative PCR and comparison in our laboratory and, those samples were not analyzed with the same comparator assay (Zymo Research) I used in our laboratory. Nevertheless, the NYU Abu Dhabi laboratory reported the following data to us:

Nasopharyngeal Swabs Comparator - EUA Authorized Assays

Positive Negative Total

Prime COVID-19 High Throughput Assay Result Positive 53 0 53

Negative 0 88 88

Total 53 88 141

Positive Percent Agreement 100% (53/53); 97.14% - 100.00%*

Negative Percent Agreement 100.0% (88/88); 97.74% - 100.00%*

* 95% confidence interval. Jovanovic B. D., & Levy, P. S. (1997). A Look at the Rule of Three.

---Thus, we think that this proposed assay and pipeline performs particularly well in clinical specimens.

below some specific comments:

define cost-effective, the technology uses as read-out the real-time thermocycler so the cost is quite high - is it necessary? could it be colorimetric?

-- Cost-effective is specifically referred to as the cost per reaction for the RT-LAMP (oligonucleotides, dye, and enzyme only) compared to a quantitative PCR approach based on oligonucleotides, probes, and enzyme. The dye’s cost itself is 1/3 lower than fluorescent probes.

-- Additionally, cost-effectiveness refers to the elimination of RNA extraction kits (viral RNA extraction kits are much more expensive than the iSWAB extraction-less buffer).

-- As per our discussion, our assay does not necessarily require a RT-thermocycler. We have provided instructions within the supplemental materials to perform the assay with a PCR cycler (or heat block) combined with a plate reader (the only requirement is the ability of such plate reader to detect the FAM/SYBR green fluorescence – virtually every plate reader on the market should have this reading capability).

-- We have initially considered and tested in our laboratory the colorimetric approach but after extensive research and development assessments, we have concluded that the colorimetric approach is significantly limited in terms of ambiguity when it comes to data interpretation. Our initial validation data were discussed with New England Biolabs (pioneer company in LAMP development) and we came to the conclusion that the colorimetric approach requires extra steps of control and is easily affected by changes in pH. For example, we have tested the colorimetric approach on saliva, and we have observed significant effects on pH, therefore, affecting the colorimetric performance and reliability. We, therefore, focused our resources on the RT-LAMP approach combined with a more objective and measurable optical readout. However, we understand that in challenging locations around the world the colorimetric approach is still a valid option.

line 47 = causing the COVID-19 pandemic.

--we have amended the text.

line 75 … identify people with COVID-19 who do not have symptoms and slow the spread of SARS-CoV-2 = Identify asymptomatic individuals carrying the virus.

--we have amended the text.

line 78-88 quite unspecific, need to focus on published papers showing advantage of RT LAMP, use of colorimetric readout, use of a heat-block instead of thermocycler et etc (i.e. https://doi.org/10.1016/j.eclinm.2021.101101)

-- We have amended the text and discussed why we did focus on a non-colorimetric approach.

-- Additionally, we would like to draw your attention to the fact that our pipeline, and its proposed novelty, is not only based on the RT-LAMP approach itself (which is not novel) but on the possibility to bypass the RNA extraction step (a significant limiting factor in testing for laboratories and impromptu testing sites). E.g., at the beginning of the pandemic obtaining a Qiagen Viral RNA extraction kit was extremely difficult. Bypassing the RNA extraction step, without significantly compromising the limit of detection has represented the most difficult technical challenge in the field. We believe that the FDA-approved MAWI extraction-less buffer when combined with an RT-LAMP approach like the one described in our study is an extremely valuable tool for testing and screening and it is much better than classic and laborious methods like heat inactivation or samples pre-treatment with proteinase K. Additionally, we draw your attention to the implication of storage and samples’ refrigeration requirements. For example, the study you cited by Baba et al. 2021, is primarily based on samples collected in VTM (viral transport media). Extraction-less protocols in VTM or UTM are virtually impossible to achieve without compromising performance. In that case, samples need to be analyzed within 48 hours and refrigeration is required. One of the main advantages of the iSWAB extraction-less buffer is that this buffer stabilizes the sample at room temperature for up to twenty-one days and therefore, not only the RNA extraction step can be skipped but also the need for refrigeration can be bypassed (MAWI DNA technologies). https://mawidna.com/the-iswab-advantage/. During research and development, we have tested several viral transport media but the iSWAB extraction-less buffer is without a doubt the best companion for our RT-LAMP assay when it comes to performance and LoD.

line 128 temperature not indicated, 65 °C??

--We indicated the temperature settings at line 93 but not on line 128. We have amended the text to reflect the temperature settings with the revised version of the manuscript.

line 173, threshold is arbitrary, why 80 cycles? Clarify

--The threshold was established based on false-positive amplification (a known RT-LAMP artifact described since its original development) observed for both SARS-CoV-2 and 18S RNA detection. Such artifacts occur at amplification cycles higher than 80 (for our specific protocol where each cycle is of 30 seconds). We have added this info within the text of the revised manuscript.

line 177, update on current variants

--We have updated the bioinformatic analysis as you suggested according to the deposited data (March 16, 2022) as stated within the manuscript.

line 244 and 253 ethics of human samples, some purchased some collected, clarify

--We have initially purchased the first set of samples (30 positives and 34 negatives) from the vendor LEE BioSolutions (this was at the very beginning of the pandemic when accessing clinical specimens was extremely difficult – the year 2020). However, no symptomatic status was provided by the vendor because the information was simply not collected at that time. To expand the cohort of samples and include symptomatic status, we later added a second set of samples obtained from a diagnostic lab with available symptomatic status (the year 2022).

LoD at 80 cp/ul is higher than RT PCR so I expect low viral loads not to be detected stats not indicated, not necessary for these values at 100% but in case of adding more specimens then a contingency table with stats would be required.

-- As shown within our data the assay was able to detect samples with a Ct value higher than 30. We would expect issues with the detection of samples with very low viral load (e.g. Ct values >36-37. To assess samples with a very low viral load we would have needed to include samples with Ct values higher than 35-37. However, most RT-PCR kits have a cut-off at 35-37 Ct, and samples with borderline Ct values are usually considered inconclusive or recommended for re-testing (therefore not usually reported). Originally, we reached out to vendors like LEE BioSolutions to seek such highly challenging samples (Ct >36) but samples with such Ct values were not available for the above-mentioned reasons. Additionally, we agree with the reviewer that the RT-LAMP assay itself cannot have the same sensitivity as a quantitative RT-PCR assay due to the different nature and chemistry between the two methodologies. However, as we have shown in our study, together with data reported from other groups, RT-LAMP combined with a reliable method of RNA extraction (like our iSWAB extraction-less buffer) can have significant advantages in the field for testing clinical samples which supposedly have a viral load much higher than 80 copies/ul (e.g., active infection, transmissibility potential, etc.)

-- We did not increase the number of positive or negative samples compared to our original submission and therefore, we did not need to perform statical analysis as you have already suggested.

--Thank you for your time and insights.

Reviewer #3:

The submission by FE Marino et al is clear and easily readable. It is worthy of publication subject to some modifications or clarifications:

line 93: temperatures and reaction times are key elements in molecular biology techniques. However, not all laboratories are equally accurate in obtaining temperatures. Have the authors tested a temperature variation around 65 degrees and a time variation around 50 minutes?

--We have tested our LoD data on different types of equipment (see below). We have not observed effects on the results. However, our validation studies for the current manuscript were all conducted on the QuantStudio version 5 for consistency and reproducibility (as stated in our Material and Methods section). The in-silico primers design predicts primers’ performance in the range of 60-65 degrees Celsius and therefore, small fluctuations around 65 degrees should not impact the results. However, our recommended protocol remains at 65 degrees.

- QuantStudio version 3

- QuantStudio version 5

- QuantStudio version 6

- QuantStudio version 7 pro

- QuantStudio version 6 pro

- Veriti Thermal Cyclers and Plate Reader (Tecan 200 Pro)

line 96: It is interesting that the authors used iSWAB Extraction-less buffer swabs. However, during the pandemic we experienced many stock-outs (the authors mention it lines 385 to 387) and swabs were not spared. It would be interesting if the authors could test other types of swabs or even home-made swabs.

--We agree and this is a very valid point. This is the exact reason why MAWI DNA technologies started the production of their own swabs engineered to capture more biological material and to be able to support the demand of swabs + iSWAB Extraction-less buffer. Additionally, the MAWI DNA swab is engineered differently compared to classic nasal swabs (I am providing a picture for your reference); the swab is a 100% plastic injection molded swab and outperforms flocked swabs in many applications. Due to the 100% plastic molded construction, supply chain issues are close to nonexistent according to the manufacturer (https://mawidna.com/coming-soon-nextswab-next-generation-swab-from-mawi-dna-technologies/). To the best of our knowledge, MAWI DNA technologies does not forecast a shortage of their swabs at the current moment or experienced shortages at any time since the beginning of the current pandemic. (https://mawidna.com/uncategorized/mawi-maintains-robust-stock-of-covid-testing-supplies-with-usa-based-uninterrupted-supply-chain/

line 271: no need to repeat the LoD definition

--We amended the text.

line 289: table 6 not table 5

--Thank you, that was a typo. We corrected it.

line 372: remove the S from DISCUSSIONS

--We amended the text.

line 409: the authors claim a result in one hour. This should be balanced as there is a long pre-analytical phase of sample deposition on the QS5 plate which should not be forgotten

--For comparison purposes, we have excluded the loading component-time as this step would equally increase the RT-LAMP time and the PCR time. Thus, it would not affect the overall advantage in terms of time-saving. Additionally, the plate loading step is highly variable and can be fully automatable. Therefore, it could take from 5 to 20 minutes based on the laboratory budget, staff, and equipment (e.g., automated pipettors, pre-loaded reagents in analytical plates, robotic automation, etc.). Once the experimental pipeline is defined the plate mapping and instrument initialization could take as low as 5 minutes if everything is prepared beforehand (of course this would require a certain level of organization).

line 456: is the detection of 18S ribosomal RNA not sufficient to validate the absence of inhibitors?

--Theoretically, yes. However, we prefer to be cautious and state this potential limitation in the discussion.

Table 4: It would be interesting if the viruses were mentioned next to the GenBank identification

--Thank you for the suggestion. We have included designations.

Table 5: group pathogens by taxonomy; what is the enterovirus proposed by ZpetoMetrix, ditto for influenza B virus; have you tested a parainfluenza 4, what is the meaning of COL

--The specific strains for the Enterovirus and the Influenza B Virus are not specified by the vendor for this panel https://www.zeptometrix.com/media/documents/PINATRVP-1.pdf

--We did not test parainfluenza 4 (wet testing) because not originally provided with the Zeptometrix Panel. However, the in-Silico data is shown as NC_021928.1 (Human parainfluenza virus 4a viral cRNA, complete genome, strain: M-25).

--We have amended the Strain nomenclature for COL to reflect the full nomenclature MRSA; COL (as provided by the vendor). The strain refers to S.aureus.

--Thank you for your time and suggestions. These were greatly appreciated.

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

25 Mar 2022

A rapid, specific, extraction-less, and cost-effective RT-LAMP test for the detection of SARS-CoV-2 in clinical specimens.

PONE-D-22-04921R1

Dear Dr. Marino,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Ruslan Kalendar

Academic Editor

PLOS ONE

Reviewers' comments:

Reviewer #2: the authors provided a sound revision of their manuscript addressing all the points raised

Reviewer #3: The paper now sounds well. The description of a simple, unexpensive, rapid, sensitive and specific molecular assay for the virological diagnosis of COVID-19 is of importance especially for LMIC.

I thank the authors for taking into account my suggestions.

Dr Jean-Michel MANSUY (MD)

1 Apr 2022

PONE-D-22-04921R1

A rapid, specific, extraction-less, and cost-effective RT-LAMP test for the detection of SARS-CoV-2 in clinical specimens.

Dear Dr. Marino:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Professor Ruslan Kalendar

Academic Editor

PLOS ONE