CRISPR-Cas System: An Adaptive Immune System's Association with Antibiotic Resistance in Salmonella enterica Serovar Enteritidis.

Several factors are involved in the emergence of antibiotic-resistant bacteria and pose a serious threat to public health safety. Among them, clustered regularly interspaced short palindromic repeat- (CRISPR-) Cas system, an adaptive immune system, is thought to be involved in the development of antibiotic resistance in bacteria. The current study was aimed at determining not only the presence of antibiotic resistance and CRISPR-Cas system but also their association with each other in Salmonella enteritidis isolated from the commercial poultry. A total of 139 samples were collected from poultry birds sold at the live bird markets of Lahore City, and both phenotypic and genotypic methods were used to determine antimicrobial resistance. The presence of the CRISPR-Cas system was determined by PCR, followed by sequencing. All isolates of S. enteritidis (100%) were resistant to nalidixic acid, whereas 95% of isolates were resistant to ampicillin. Five multidrug-resistant isolates (MDR) such as S. enteritidis isolate (S. E1, S. E2, S. E4, S. E5, and S. E8) were found in the present study. The CRISPR-Cas system was detected in all of these MDR isolates, and eight spacers were detected within the CRISPR array. In addition, an increased expression of CRISPR-related genes was observed in the standard strain and MDR S. enteritidis isolates. The association of the CRISPSR-Cas system with multiple drug resistance highlights the exogenous acquisition of genes by horizontal transfer. The information could be used further to combat antibiotic resistance in pathogens like Salmonella.

1. Introduction

Antibiotic resistance is a natural phenomenon, and the emergence of antibiotic-resistant bacteria necessitates updating treatment regimens [1]. Globally, deaths with antibiotic-resistant pathogens are expected to increase from 700,000 fatalities per year in 2014 to 10 million by 2050, which could result in a total cost of $100 trillion [2]. S. enteritidis is one of the most common Salmonella serovars causing foodborne infections and has veterinary and public health concerns [3]. The resistance of S. enteritidis to penicillin, aminoglycosides, β-lactams, and fluoroquinolones has been reported worldwide, including Pakistan [4, 5]. It has conclusively been shown that Salmonella can acquire these resistance genes via mobile genetic elements (MGEs) like plasmids, which allow host bacteria more flexibility to disseminate these genes across varied bacterial populations [6].

The CRISPR-Cas system is an acquired immune system that protects bacteria from MGEs, including viruses, plasmids, and transposons [7]. The genome architecture of a CRISPR-Cas locus typically has three parts: sequence of CRISPR arrays, a cas gene locus, and AT-rich leader region [8]. The CRISPR arrays consist of direct repeat sequences of 21-48 base pairs (bp) separated by 26-72 bp long spacer sequences. The spacers are 4-10 highly conserved short nucleic acid sequences obtained from previous encounters with MGEs [9]. The mechanism of action of the CRISPR-Cas system is generally divided into three stages: acquisition of new spacers (the adaptation stage), crRNA biogenesis (the CRISPR transcripts), and interference against foreign invaders directed by crRNAs [10].

Overall, the CRISPR-Cas system is divided into three types: types I, II, and III [11]. S. enteritidis have a type I-E CRISPR system and consists of a cas operon and two CRISPR arrays, CRISPR1 and CRISPR2, separated by 16 bp [12]. The cas operon is located next to the CRISPR1 array [7] and consists of a cluster of cas3, cas2, cas1, cas6e, cas7, cse2, and cse1 and cas5 genes [13]. Apart from defending bacteria against invaders, the CRISPR-Cas system has been suggested to increase bacterial virulence, but its role in antibiotic resistance is still under debate [11].

The literature is scarce regarding the CRISPR-Cas system's role in the development of antibiotic resistance; hence, the present study is designed to determine the association of the CRISPR-Cas system with antibiotic resistance in MDR S. enteritidis isolated from the commercial poultry. Later, the CRISPR-Cas system identified from these isolates was analyzed to identify spacer sequences. At last, an association of the CRISPR-Cas system was determined through qRT-PCR.

2. Materials and Methods

2.1. Bacterial Isolation and Growth Conditions

A total of 139 samples, including sixty-nine freshly passed poultry droppings and seventy cloacal swab samples, were collected from major commercial poultry markets (Tollinton and Sheranwala) of Lahore. Samples were kept in peptone broth, transported to the bacteriology laboratory, and stored at 4°C. Samples were enriched in selenite broth and subcultured on Salmonella Shigella Agar and then incubated at 37°C for 24-28 hours. Black-centered colonies were subcultured for purification after incubation [14].

2.2. Identification of Salmonella

The DNA of all biochemically confirmed isolates was extracted by a commercially available GF-1 nucleic acid extraction kit from Vivantis (Vivantis, Malaysia). Molecular identification of the genus and species was performed by PCR using previously used specific primers [15, 16]. For reaction mixture, 6.5 μL of nuclease-free water, 12.5 μL of 2x PCR Taq Plus MasterMix (abm, Canada), 2 μL each of forward and reverse primers, and 2 μL of DNA template were used and amplified in a C1000™ thermal cycler (Bio-Rad, Singapore). The cyclic conditions used for the PCR were the following: primary denaturation for 2 minutes at 94°C, denaturation for 40 seconds at 94°C, annealing for 50 seconds at the ideal temperature of different primers given in Table 1, and extension for 50 seconds at 72°C. The amplicons were electrophoresed using 1.5% agarose gel for 30 minutes at 100 volts and later on visualized using a gel documentation system (Omega Fluor Plus Systems, Aplegen Inc., California, USA) and GeneRuler™ 100 bp plus DNA ladder.

Table 1

Primers used for the identification of genus and species antibiotic-resistant genes and CRISPR-Cas genes of Salmonella enteritidis isolated from poultry.

Target gene	Amplicon (bp)	Primers (5′-3′)	T m	Reference
InvA	423	F: TCGTGACTCGCGTAAATGGCGAAR: GCAGGCGCACGCCATAATCAATA	63°C	[15]
IE	316	F: AGTGCCATACTTTTAATGACR: ACTATGTCGATACGGTGGG	55°C	[16]
gyrA	610	F: CGAGAGAAATTACACCGGTCAR: AGCCCTTCAATGCTGATGTC	55°C	[19]
blaTEM-1	643	F: CAGCGGTAAGATCCT TGAGAR: ACTCGCCGTCGTGTAGATAA	54°C	[20]
tetB	659	F: TTGGTTAGGGGCAAGTTTTGR: GTAATGGGCCAATAACACCG	57°C	[21]
Cas1	892	F: CCAGTGATTCAGGTTCCGGTR: GTGACGTTCGTACCGCTCAA	55°C	This study
Cas2	262	F: AACCAAACGCAGTCCATCCAR: TATGGTGGTTGTGGTCACGG	55°C	This study
Cas3	692	F: GCAAAGTCCGTCACCACAATR: GATTTAGCGCCGGTGGATTT	55°C	This study
Cas3∗	201	F: GGGATAGACATAGGCGCTGTR: GATTTAGCGCCGGTGGATTT	55°C	This study

2.3. Antibiotic Resistance Profiling

The PCR-confirmed S. enteritidis isolates were tested for antibiotic susceptibility using the Kirby-Bauer disc diffusion method [17]. The optical density of S. enteritidis culture was set at 0.5 McFarland units and seeded on a plate (150 mm) containing Mueller-Hinton (MH) agar. Antibiotic discs with a single concentration of nalidixic acid (30 μg), ampicillin (10 μg), gentamicin (10 μg), chloramphenicol (30 μg), tetracycline (30 μg), and sulfamethoxazole (25 μg) were placed on the agar surface. After 24 hours of incubation at 37°C, the diameter of the zone of inhibition was determined. Isolates were classified as resistant, intermediate, or sensitive using the Clinical Laboratory Standards Institute's (CLSI) guidelines [18].

2.4. Detection of Antibiotic Resistance Genes

Antibiotic-resistant genes such as gyrA, bla, and tetB were screened by PCR as described previously [19-21]. Nuclease-free water (6.5 μL), 2x PCR Taq plus MasterMix (12.5) (abm, Canada), forward and reverse primers (2 μL) each, and DNA template (2 μL) were used to make a PCR mixture (25 μL). After that, PCR products were electrophoresed for 30 minutes using 1.5% gel.

2.5. CRISPR-Cas System Detection

The specific primers (cas3, cas2, and cas1) were designed online using the tool Primer 3 (http://primer3.ut.ee/) and are mentioned in Table 1. The amplified PCR products were electrophoresed on a 1.5 percent gel and analyzed using a gel documentation system (Omega Fluor Plus Systems, Aplegen Inc., California, USA). Afterwards, the amplified MDR and cas3 genes were subjected to DNA sequencing by a commercial facility (Advance Bioscience International, Lahore, Pakistan).

2.6. Detection of CRISPR Spacers

The online bioinformatics tool CRISPR-Finder (https://crispr.i2bc.paris-saclay.fr/Server/) was used to identify CRISPR spacer sequences [22]. Spacers were retrieved from CRISPR-Finder output using a nucleotide BLAST search (https://blast.ncbi.nlm.nih.gov/) and analyzed for their identity on GenBank. Because of the small spacer length (50 nt) and relatively large database (more than 1010 nt), the significance of alignment was calculated using an E value of 0.02 [23]. Alignment with an E value less than the cutoff value and greater than 80% similarity was chosen from all isolates.

2.7. Identification of CRISPR Gene Expression after Exposure to Antimicrobials by qRT-PCR

One MDR S. enteritidis isolate and its standard strain were exposed (1/2 MPC) to six antibiotics. The QIAamp Viral RNA Mini Kit (QIAGEN, Hilden, Germany) was used to extract RNA from each sample. A Revert Aid First-Strand cDNA Kit (Thermo Scientific, USA) was used to make cDNA.

The CFX96 real-time PCR thermocycler (Bio-Rad, Singapore) was used for amplification. Preincubation at 95°C for 3 minutes was followed by 45 cycles of 10 seconds at 95°C and 40 seconds at 52°C in the cycling conditions for amplification. The specific primers used were cas3∗F (GGGATAGACATAGGCGCTGT) and cas3∗R (GATTTAGCGCCGGTGGATTT) (Table 1). A housekeeping gene (16S rRNA) was used as an internal control for normalization. The experiment was repeated three times to calculate the mean fold change.

3. Results

3.1. Confirmed Bacterial Isolates

The collected samples were cultured and processed through conventional bacteriological methods; 45% (62/139) isolates were confirmed as Salmonella. From these 62 isolates, 32% (20/62) isolates were confirmed as S. enteritidis through PCR (Figure 1).

Figure 1

Identification of Salmonella isolates: presence of the (a) invA gene and (b) IE gene by PCR to identify the Salmonella genus and S. enteritidis species. L indicates the 100-base pair (bp) ladder. The numeric characters represent the sequential number of S. enteritidis of isolates.

3.2. Antibiotic-Resistant Profiling of Poultry Isolates of S. Enteritidis

The susceptibility of 20 confirmed S. enteritidis isolates to six antibiotics was determined. All S. enteritidis isolates were resistant (100%) to nalidixic acid, and 95% were found resistant to ampicillin. The intermediate levels of resistance to tetracycline (60%), gentamicin (50%), and chloramphenicol (45%) and low levels of resistance to sulfamethoxazole (30%) were found in the present study (Table 2).

Table 2

Antibiotic susceptibility patterns (Kirby-Bauer) of S. enteritidis against different antibiotics.

Antibiotics	Disk (μg)	Antibiotic resistance profile
		S. enteritidis (n = 20)
		Sensitive (%)	Intermediate (%)	Resistant (%)
AMP	10	0	5	95
CHL	30	40	15	45
CN	10	35	15	15
TE	30	35	5	60
NA	30	0	0	100
SXT	25	45	25	30

AMP: ampicillin; CHL: chloramphenicol; CN: gentamicin; TE: tetracycline; NAL: nalidixic acid; SXT: sulfamethoxazole.

3.3. Detection of Antibiotic Resistance Genes

Antibiotic resistance-associated genes (gyrA, tetB, and blaTEM-1) in all confirmed S. enteritidis isolates were detected by PCR as shown in Figure 2. Out of 20 isolates, 5 were MDR (only one or two antibiotic classes remain sensitive to bacterial isolates) and contained all 3 antibiotic-resistant genes. At the same time, 1 or 2 of these antibiotic-resistant genes were present in non-MDR isolate.

Figure 2

Detection of antibiotic resistance genes: presence of the (a) gyrA gene, (b) tetB gene, and (c) bla gene by PCR for the detection of drug resistance in S. enteritidis species. L indicates the 100-base pair (bp) ladder. The numeric characters represent the sequential number of S. enteritidis of isolates.

3.4. CRISPR-Cas System Detection

A conventional PCR was performed to detect the presence of the CRISPR-Cas system in these confirmed 20 S. enteritidis isolates. The CRISPR-Cas genes such as cas1, cas2, and cas3 amplified through PCR are shown in Figure 3.

Figure 3

Detection of the CRISPR-Cas system: presence of the (a) cas1 gene, (b) cas2 gene, and (c) cas3 gene by PCR for the detection of the CRISPR-Cas system in S. enteritidis species. L indicates the 100-base pair (bp) ladder. The numeric characters represent the sequential number of S. enteritidis of isolates.

3.5. Spacer's Identification and Analysis of Poultry Isolates of S. Enteritidis

CRISPR-Finder analysis revealed that the CRISPR array has a direct repeat sequence of 29 bp: 5′- GTGTTCCCCGCGCCAAGCGGGGATAAACCG-3′ separated by spacer sequences of 32-40 bp. The 8 spacer sequences were present in all four isolates. All spacers revealed homology with the CRISPR and chromosome regions of different S. enteritidis strains, as shown in Table 3. Based on bioinformatics analysis, it is safer to say that antibiotic resistance genes are also carried by CRISPR-Cas system-carrying isolates, which may have an association with antibiotic resistance.

Table 3

Spacer sequence homology of poultry isolates of S. enteritidis to other strains.

Homology to other strains
Poultry isolates	+SE95 (%)	+S. enteritidis SEO (%)	+S. enteritidis SE81 (%)	+S. enteritidis SE104 (%)	+S. enteritidis SAP18-H9654 (%)	+S. enteritidis 95-0621 (%)	+S. enteritidis SE74 (%)
S.E1	99.13	−	98.98	99.13	−	−	99.13
S.E4	99.12	−	99.12	99.12	−	−	99.12
S.E5	−	99.41	−	−	99.41	99.41	−
S.E8	−	99.70	−	−	99.70	99.70	−

“+” indicates homology to the clustered regularly interspaced short palindromic repeat region of the strain. “−” means not significant.

3.6. CRISPR-Cas Gene Expression in the Standard Strain and MDR Isolate

The qRT-PCR was used to determine the association between the CRISPR-Cas system and antibiotic resistance. Increased cas3 gene expression was found in the Salmonella ATCC 13076 strain and MDR S. enteritidis isolate, as shown in Figure 4. This high expression might be because the CRISPR-Cas system regulates several genes that play a role in maintaining the membrane integrity and overcoming different stress such as antibiotic resistance [24].

Figure 4

Clustered regularly interspaced short palindromic repeat- (CRISPR-) Cas gene (cas3) expression in S. enteritidis and Salmonella ATCC13076 under the exposure of different antibiotics.

4. Discussion

The CRISPR-Cas system, known as bacteria's adaptive immune system, has some additional functions, increasing bacterial virulence [11]. However, its role in antibiotic resistance has not been thoroughly considered. Therefore, the involvement of the said system in antibiotic resistance of S. enteritidis is assessed in this study through phenotypic and genotypic methods and bioinformatic analysis. The findings highlight that the CRISPR-Cas system is involved in antibiotic resistance, and the result is in the lines of earlier literature [24].

The present study employed genus-specific and species-specific PCR to detect S. enteritidis; such an approach has also been used in the previously described studies [15, 16]. The sample prevalence of Salmonella was 45% (62/139). The current study's findings are consistent with a previous study describing S. enteritidis as the most prevalent serovar [25] prevailing in poultry.

Antibiotics are reported to be irrationally used in chicken production as growth promoters, for prophylaxis, and to treat Salmonellae and other bacterial infections. This irrational use of antibiotics in feed and drinking water could result in antibiotic resistance. Transfer of such antibiotic-resistantSalmonellae to humans could occur via a contaminated food chain that could have strong public health concerns [26]. It is apparent from this study that most of the isolates of S. enteritidis were resistant to nalidixic acid (quinolones) and ampicillin (95%). These findings are in good agreement with the results of previous studies where the highest resistance to quinolones and ampicillin was found when compared to other antibiotics [26, 27]. Interestingly, the intermediate resistance levels estimated against gentamycin, chloramphenicol, and tetracycline are also consistent with the previous literature [27, 28].

The CRISPR-Cas system in S. enteritidis isolated from poultry was confirmed by PCR using CRISPR-Cas gene-specific primers. The CRISPR-Cas system was found in all S. enteritidis with antibiotic resistance confirmed. Likewise, recently, a study reported similar findings, which are in accordance with the results of our study [29].

With the help of cas proteins, the CRISPR-Cas system can integrate spacers derived from the invader's mobile genetic elements [30]. Upon bioinformatic analysis, spacers were found in four of the MDR S. enteritidis poultry isolates. Several S. enteritidis strains exhibit similarities with these spacer sequences. Homology was found with the CRISPR region and chromosomes of S. enteritidis strain SE 95 and S. enteritidis strain SEO in some cases. The present finding is also supported by the findings of the previous study [24] where they also found spacer homology in the genetic elements of C. jejuni strains with their closely related spacer-carrying strains.

In the current study, the authors used qRT-PCR to determine the association between the CRISPR-Cas system and antibiotic resistance. The CRISPR gene expression was increased in the MDR poultry isolate of S. enteritidis than its standard strain suggesting the association of the said system with antibiotic resistance. As mentioned earlier, this increased expression of CRISPR genes might be because the said system regulates several genes that play roles in membrane integrity and provide resistance against different membrane stressors such as antibiotics, as also reported by Samson and colleagues in 2015 [31]. Although the present study provides baseline information regarding the association of the CRISPR system with antibiotic resistance, there is still a need to look deeper to understand whether this system promotes antibiotic resistance alone or by regulating several other genes.

5. Conclusion

The CRISPR-Cas system did have an association or role in antibiotic resistance because high antibiotic resistance in poultry isolates and similarity of spacers with other S. enteritidis strains suggest that this system is involved in antibiotic resistance.