Literature DB >> 35377421

Gene activation in Caenorhabditis elegans using the Campylobacter jejuni CRISPR-Cas9 feeding system.

Zhenhuan Luo1, Wenyu Dai1, Chongyang Wang1, Qunshan Ye1, Qinghua Zhou1, Qin-Li Wan1.   

Abstract

Clustered regularly interspaced palindromic repeats-based activation system, a powerful genetic manipulation technology, can modulate endogenous gene transcription in various organisms through fusing nuclease-deficient Cas9 to transcriptional regulatory domains. At present, this clustered regularly interspaced palindromic repeats-based activation system has been applied to activate gene expression by microinjection manner in Caenorhabditis elegans. However, this complicated and time-consuming injection manner is not suitable for efficient and high-throughput gene regulation with clustered regularly interspaced palindromic repeats-Cas9 system. Here, we engineered a Campylobacter jejun clustered regularly interspaced palindromic repeats-Cas9-based gene activation system through bacteria feeding technique to delivering gene-specific sgRNA in C. elegans. It enables to activate various endogenous genes efficiently, as well as induce the corresponding phenotypes with a more efficient and labor-saving manner. Collectively, our results demonstrated that our novel dCjCas9-based activation feeding system holds great promise and potential in C. elegans.
© The Author(s) 2022. Published by Oxford University Press on behalf of Genetics Society of America.

Entities:  

Keywords:  zzm321990 Caenorhabditis eleganszzm321990 ; zzm321990 Campylobacter jejuni Cas9; feeding; gene activation

Mesh:

Substances:

Year:  2022        PMID: 35377421      PMCID: PMC9157054          DOI: 10.1093/g3journal/jkac068

Source DB:  PubMed          Journal:  G3 (Bethesda)        ISSN: 2160-1836            Impact factor:   3.542


Introduction

The clustered regularly interspaced palindromic repeats (CRISPR)-CRISPR-associated protein (CRISPR-Cas) system is most often based on the Streptococcus pyogenes Cas9 (SpCas9) nuclease, which is an RNA-guided genome editing tool for genetic manipulation in various organisms (Bevacqua ; Farbiak ; Yin ). In addition to SpCas9, various Cas9 orthologs from different bacteria have been characterized and developed, such as Neisseria meningitidis Cas9 (NmCas9), Staphylococcus aureus Cas9 (SaCas9), Francisella novicida Cas9 (FnCas9), and Campylobacter jejuni Cas9 (CjCas9). To date, the CRISPR-Cas9 system has been widely used for introducing indels and generating knockouts in vitro and in vivo (Bevacqua ; Farbiak ; Yin ). Moreover, when a missense substitution of the catalytic site was introduced to eliminate Cas9 nuclease activity that did not compromise its DNA binding activity, nuclease-deficient Cas9 (dCas9) was also able to upregulate RNA-guided transcription by fusing with trans-activators (Mali ). Among these various Cas9 orthologs, CjCas9, a newer CRISPR endonuclease, exhibits several unique features, including its smallest size (984 amino acid residues) for easier delivery, distinct target recognition of the 5′-NNNNACA-3′ or 5′-NNNNRYAC-3′ sequence, unique triple-helix tracrRNA structure, and potential for contact with the nucleotide sequences in both DNA strands of the target (Zhang ). In Caenorhabditis elegans, the CRISPR-Cas9 system, especially SpCas9, has been widely used for gene editing and transcriptional regulation, either alone or in combination with transcriptional regulatory domains (Long ; Wei ). Very recently, we also developed a robust CjCas9-based transcription activation system, miniCAFE, which combines a nuclease-deficient CjCas9 (dCjCas9) and the tripartite transcriptional activator VP64-p65-Rta (herpes simplex virus-derived VP64 activator, the human NF-KB p65 activator domain, and the Epstein-Barr-virus-derived R trans-activator, VPR), and then microinjected it into C. elegans to activate the expression of various genes (Zhang ). Microinjection in C. elegans is a reliable, versatile, and frequently used method for delivering genetic constructs. However, microinjection requires a specialized micromanipulator and a skilled microinjection operator (Berkowitz ), so it is not suitable for efficient and high-throughput gene disruption or regulation in the CRISPR-Cas9 system. In C. elegans, feeding-based RNAi is the most convenient and powerful method for silencing gene function by feeding animals with bacteria expressing dsRNA (Timmons ). This “feeding” method has also been used for delivering guide-RNA to achieve CRISPR-Cas9-based gene disruptions (Liu ). However, the CRISPR-based feeding system for gene activation has not been reported. Therefore, we engineered a CRISPR-Cas9-based gene activation system using a bacteria feeding technique to deliver gene-specific sgRNA to determine whether genes could be activated using a bacteria feeding-dependent CRISPR-Cas9 system.

Materials and methods

Caenorhabditis elegans strains and maintenance

Wild-type N2 (Bristol) was used as the wild-type strain [from the Caenorhabditis Genetic Center (CGC), University of Minnesota, USA]. Worms were grown and maintained on solid nematode growth medium (NGM) with the OP50 or HT115 Escherichia coli strains as food at 20°C.

Plasmid construction

The plasmid pCAG-VPR-L1-CjCas9 D8A H559A was constructed by Rong Lab. To implement VPR-dCjCas9 as a transcriptional activator in C. elegans, the dpy-30 promoter (a ubiquitous promoter) sequence was amplified from C. elegans N2 strain genomic DNA and cloned into a SpeI/EcoRI-digested pCAG-VPR-L1-CjCas9 D8A H559A plasmid to replace the CAG promoter. The VP64 sequence was amplified from the pCAG-VPR-L1-CjCas9 D8A H559A plasmid and cloned into the NcoI/RsrII-digested pdpy-30-VPR-L1-CjCas9 D8A H559A plasmid to replace the VPR activator sequence. To generate a plasmid expressing gene-specific sgRNA driven by the T7 promoter, a T7 promoter-lac operator-target sequence-sgRNA(F+E) scaffold-T7 terminator cassette was constructed and cloned into the L4440 vector to replace the convergently oriented T7 promoter fragment. The modified sgRNA scaffold [sgRNA(F+E)] was amplified from the PU6::unc-119 sgRNA(F+E) plasmid (Zhao ), and the T7 promoter-lac operator and the T7 terminator sequences were directly added to the forward and reverse primers, respectively. The sequences of gene-specific sgRNAs of interest were inserted into the sgRNA plasmid by nested overlap PCR, and all sgRNAs were designed using . The guide RNA sequences and their primers are listed in Table 1. The full sequence of the T7 promoter-lac operator-target sequence- sgRNA(F+E) scaffold-T7 terminator cassette is shown in Table 2.
Table 1.

The sgRNAs and primers in this study.

GeneTarget genomic sequences (5′- 3′)Primer sequences (5′–3′)
myo-2 ATAAGAGTAGCAAAATGGCAGGForwardATAAGAGTAGCAAAATGGCAGGGTTTAAGAGCTATGCTGGA
AAGAGCACReverseCCTGCCATTTTGCTACTCTTATGGAATTGTTATCCGCTCAC
lipl-4 GATTTGCACTTCACATACACAC ACACACACForwardGGATTTGCACTTCACATACACACGTTTAAGAGCTATGCTGGA
ReverseGTGTGTATGTGAAGTGCAAATCCGGAATTGTTATCCGCTCAC
lipl-5 AAGATAAGCTGTTTGGCGCTGT GAGGGTACForwardGGAAGATAAGCTGTTTGGCGCTGTGTTTAAGAGCTATGCTGGA
ReverseACAGCGCCAAACAGCTTATCTTCCGGAATTGTTATCCGCTCA
aak-2 AATATGTTCAGATGCTCGAGTGForwardGGAATATGTTCAGATGCTCGAGTGGTTTAAGAGCTATGCTGGA
CAACGCACReverseCACTCGAGCATCTGAACATATTCCGGAATTGTTATCCGCTCACA
pha-4 TCTGTGCGAGACTATTAAAGTGForwardGGTCTGTGCGAGACTATTAAAGTGGTTTAAGAGCTATGCTGGA
TTCAATACReverseCACTTTAATAGTCTCGCACAGACCGGAATTGTTATCCGCTCA
spr-4 AACCGAAAAGAGTGTTGGAGACForwardGGAACCGAAAAGAGTGTTGGAGACGTTTAAGAGCTATGCTGGA
GAAGATACReverseGTCTCCAACACTCTTTTCGGTTCCGGAATTGTTATCCGCTCACA
pie-1 (sgRNA1)CCATATCACTTTATGTGGCGTAForwardGGCCATATCACTTTATGTGGCGTAGTTTAAGAGCTATGCTGGA
AAGAATACReverseTACGCCACATAAAGTGATATGGCCGGAATTGTTATCCGCTCACA
pie-1 (sgRNA2)AAAAATCTGTGAGTATCGCAACForwardGGAAAAATCTGTGAGTATCGCAACGTTTAAGAGCTATGCTGGA
GAAAGCACReverseGTTGCGATACTCACAGATTTTTCCGGAATTGTTATCCGCTCACA
pie-1 (sgRNA3)TTTTCTCCAATGTACTCGTACTForwardGGTTTTCTCCAATGTACTCGTACTGTTTAAGAGCTATGCTGGA
CCAAGTACReverseAGTACGAGTACATTGGAGAAAACCGGAATTGTTATCCGCTCACA
ges-1 (sgRNA1)TTAAGCTTTTGGCATGAATACAForwardGGTTAAGCTTTTGGCATGAATACAGTTTAAGAGCTATGCTGGA
GTGAACACReverseTGTATTCATGCCAAAAGCTTAACCGGAATTGTTATCCGCTCACA
ges-1 (sgRNA2)AAAATTTCAGTGGCCAGCACAAForwardGGAAAATTTCAGTGGCCAGCACAAGTTTAAGAGCTATGCTGGA
ACACATACReverseTTGTGCTGGCCACTGAAATTTTCCGGAATTGTTATCCGCTCACA
ges-1 (sgRNA3)TTCTTGTAGTCAATAGATAGTGForwardGGTTCTTGTAGTCAATAGATAGTGGTTTAAGAGCTATGCTGGA
CGAGACACReverseCACTATCTATTGACTACAAGAACCGGAATTGTTATCCGCTCACA
rab-3 (sgRNA1)TGTAGGCGCTTCTGTTAGAGAGForwardGGTGTAGGCGCTTCTGTTAGAGAGGTTTAAGAGCTATGCTGGA
GAGAGCACReverseCTCTCTAACAGAAGCGCCTACACCGGAATTGTTATCCGCTCACA
rab-3 (sgRNA2)TGGTCGGATATTTGGGGATCAGForwardGGTGGTCGGATATTTGGGGATCAGGTTTAAGAGCTATGCTGGA
AGAAGTACReverseCTGATCCCCAAATATCCGACCACCGGAATTGTTATCCGCTCACA
chr IV (NC)AAAAGCTGGAAAACACACCAACForwardGGAAAAGCTGGAAAACACACCAACGTTTAAGAGCTATGCTGGA
ACACACACReverseGTTGGTGTGTTTTCCAGCTTTTCCGGAATTGTTATCCGCTCACA
Table 2.

The full sequence of sgRNA cassette.

The T7 promoter-lac operator-target sequence- sgRNA(F+E) scaffold-T7 terminator cassette sequence (5′–3′)
taatacgactcactataggggaattgtgagcggataacaattccGAACCCGTTGCCGAATACACGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTctagcataaccccttggggcctctaaacgggtcttgaggggttttttg
The sgRNAs and primers in this study. The full sequence of sgRNA cassette.

Microinjection and transgenic strains

To generate transgenic worms expressing the VPR-dCjCas9 or VP64-dCjCas9 fusion protein, microinjection was performed according to a standard protocol as previously described (Berkowitz et al. 2008). In brief, the relevant plasmids were injected into the gonads of young adult hermaphrodites. The DNA mixture for injection included 50 ng/μl Pdpy-30::VPR-L1-CjCas9 D8A H559A or Pdpy-30::VP64-L1-CjCas9 D8A H559A, 5 ng/μl Pmyo-2::GFP::H2B and 3 ng/μl Pmyo-3::mCherry (Pmyo-2::GFP::H2B and Pmyo-3::mCherry were used as the additional pharyngeal and body-wall fluorescence-bearing transgenic reporter plasmids, respectively). The VPR-dCjCas9 and VP64-dCjCas9 transgenic strains bearing the VPR-dCjCas9 or VP64-dCjCas9 expression plasmid and fluorescence reporter were obtained by microinjection as additional extrachromosomal arrays. To further generate stable transgenic worms, the extrachromosomal arrays were integrated into the chromosome by X-ray irradiation. The transgenic worms were back-crossed 4 times with the wild-type N2 strain before use.

The sgRNA bacteria feeding assay

The empty vector or gene-specific sgRNA plasmids were transformed into HT115(DE3) chemically competent cells using CaCl2 transformation protocols. The gene-specific sgRNA sequences were verified by Sanger sequencing. All sgRNA bacteria feeding experiments were performed at 20°C using an RNAi-like feeding protocol (Wan ). Briefly, in IPTG-supplemented plates, the VPR-dCjCas9 or VP64-dCjCas9 transgenic worms were fed HT115 bacteria carrying empty vector or gene-specific sgRNA plasmids starting at the L1 larval stage until the young adult stage. The sgRNA-fed worms were used for subsequent experiments.

RNA extraction and quantitative RT-PCR

Worms were fed HT115 bacteria carrying empty vector or gene-specific sgRNA plasmids until age-synchronized young adults and were then collected with M9 buffer and washed several times. Worm pellets were resuspended using AG RNAex PRO reagent (Accurate Biology, Changsha, China). Total RNA was isolated by chloroform extraction and isopropanol precipitation. Afterward, 500 ng of total RNA was used for reverse transcription with a high-capacity cDNA transcription kit (RK20400, ABclonal, Wuhan, China). Quantitative real-time PCR was performed using SYBR Green Select Master Mix (RK21203, ABclonal, Wuhan, China) on a CFX96 real-time system (Bio Rad, CA, USA), and each experiment was repeated at least 3 times. Quantification of transcripts was normalized to the cdc-42 gene, and results were computed using the 2–ΔΔCt method. P-values were calculated using the 2-tailed Student’s t-test. The primers used in this study are shown in Table 3.
Table 3.

The primers used in qRT-PCR.

GenePrimer sequences (5′–3′)
GFP(S65C)ForwardTCTGTCAGTGGAGAGGGTGA
ReverseGACAAGTGTTGGCCATGGAAC
lipl-4 ForwardAAAACAAGACCTGGAAGAAACG
ReverseATAAACTTGGCTGGCTGCAT
lipl-5 ForwardTCAGGATGTTGTGGGAAGCC
ReverseGGCCATGTTACGTTTGTTTTCC
aak-2 ReverseATAGGAAGGAGGACGGTGGT
ForwardGTCCTTGCGTTCCTTTCTTGAC
pha-4 ForwardGCCAATTTCATGCAAGGAGG
ReverseGCCAGTGGTAAAACCAAGAGGT
spr-4 ForwardAATTGTTCACAAGGTCAAGA
ReverseCCAACACATTCCTTCAAATA
pie-1 ForwardTTCAATGATTCGCTGTCGTCC
ReverseCGCGTTTTGTATTCTGTGTGCTTA
ges-1 ForwardTGCTAAAACCGGAGTTCCCC
ReverseGCAGTTCGTTCCAGAAAGCG
rab-3 ForwardTGACGATGTGTTGGAGGCATT
ReverseCCAGCCGCCATTCGACTT
cdc-42 ForwardCTGCTGGACAGGAAGATTACG
ReverseCTCGGACATTCTCGAATGAAG
acl-1 ForwardGCTGGACGTGATCTTACTGATTACC
ReverseGTAGCAGAGCTTCTCCTTGATGTC
csq-1 ForwardAACTGAGGTTCTGACCGAGAAG
ReverseTACTGGTCAAGCTCTGAGTCGTC
The primers used in qRT-PCR.

Fluorescence microscopy and image analyses

To assess the fluorescence intensity of myo-2::GFP, we fed VPR-dCjCas9 and VP64-dCjCas9 transgenic worms HT115 bacteria carrying an empty vector or sgRNA targeting the myo-2 promoter. We mounted the worms on 2% agar pads after they were anesthetized using M9 buffer containing NaN3 (50 mM) and then observed fluorescence using a Nikon Ti2-U (Zhang ), The GFP fluorescence intensity of each worm was analyzed using ImageJ as previously described. Each experiment used at least 30 animals. P values were calculated using the 2-tailed Student’s t-test.

Lifespan assay

All lifespan experiments were performed using standard protocols, as previously described (Zhang ). Briefly, synchronized L1 animals were fed HT115 bacteria carrying empty vector or gene-specific sgRNA plasmids until the L4 larval stage. Then, approximately 100–120 young adult worms were transferred to IPTG-supplemented plates to conduct survival analyses. The corresponding HT115 bacteria were seeded before use. To prevent progeny production, 10 μM 5-fluoro-2′-deoxyuridine (FUDR, Sigma) was also added. Death events were scored daily, and experiments were repeated at least twice. The SPSS package was used for statistical analysis, and the log-rank (Mantel–Cox) method was used to determine the significant difference. A P-value < 0.05 was considered statistically significant.

Oil Red O staining and quantification

Synchronized worms were collected in M9 buffer. Then, Oil Red O (ORO) staining was conducted according to standard protocols (Zhang ). ORO-stained animals were mounted onto 2% agar pads and imaged using a Nikon Ti2-U fluorescence microscope at 20× magnification. The mean intensity values in arbitrary units (a.u.) of per worm were graphed by using Image-Pro-Plus processing software and the lipid levels were determined using GraphPad Prism using a 2-tailed Student’s t-test. At least 30 animals were used in each experiment. The experiment was repeated at least twice.

Results and discussion

In this study, considering efficiency and specificity, we used CjCas9-based transcriptional activator plasmid pCAG-VPR-L1-CjCas9 D8A H559A {containing a DNase-dead CjCas9 [dCjCas9 (D8A H559A)] and a strong synthetic VPR activator} to conduct our examination. To implement VPR-dCjCas9 as a transcriptional activator in C. elegans, we replaced the CAG promoter with a ubiquitous (dpy-30) promoter (Fig. 1a). Afterward, we constructed transgenic animals ubiquitously and stably expressing the VPR-dCjCas9 fusion protein by microinjecting the Pdpy-30::VPR-dCjCas9 plasmid into worm gonads.
Fig. 1.

Transcriptional activation of multiple targeted genes and corresponding phenotype induction in C. elegans using the C. jejuni CRISPR–Cas9 activation feeding system. a) Schematic of the VRP-dCjCas9 activation feeding system. VPR-dCjCas9 transgenic worms were generated by injection of the Pdpy-30::VPR-dCjCas9 plasmid. By delivering the engineered sgRNA plasmid containing the gene-specific gRNA sequence through bacterial feeding, the VRP-dCjCas9 activator can activate gene expression in C. elegans. b) Pmyo-2::GFP fluorescence in the pharyngeal region of the VPR-dCjCas9 and VP64-dCjCas9 strains bearing the Pmyo-2::GFP::H2B transgene in the presence or absence of myo-2-specific sgRNA targeting the promoter region. c) Survival analyses of the VPR-dCjCas9 worms in the presence or absence of aak-2-, pha-4-, or lipl-4-specific sgRNA targeting the promoter region. d) Fat levels in the intestinal region of the VPR-dCjCas9 strains in the presence or absence of lipl-4- or lipl-5-specific sgRNA targeting the promoter region. e) Survival analyses of the VPR-dCjCas9 worms in the presence or absence of the spr-4-specific sgRNA targeting the promoter region. f) Relative mRNA expression of target genes in the VPR-dCjCas9 worms in the presence or absence of the specific sgRNA targeting the target gene promoter region. sgRNA (−), empty vector L4440; sgRNA (+), gene-specific sgRNA plasmid; NC sgRNA, negative control sgRNA plasmid. g) Schematic of the distribution of all designed sgRNAs in the promoter regions of the target genes. h) Relative mRNA expression of tissue-specific genes, including pie-1, ges-1, and rab-3, in the VPR-dCjCas9 worms in the presence or absence of the specific sgRNA targeting the target gene promoter region. In (b) and (d), data are displayed as the mean ± SD, n ≥ 30. In (c) and (e), lifespan analyses were performed using the Kaplan–Meier plotter, and the p value was determined by the log-rank test. The detailed lifespan values are listed in Table 5. In (f) and (h), the data are displayed as the mean ± SD of 3 independent experiments. In (b), (d), (f), and (h), ***P < 0.001, *P < 0.05, ns, not significant (Student’s t-test).

Transcriptional activation of multiple targeted genes and corresponding phenotype induction in C. elegans using the C. jejuni CRISPR–Cas9 activation feeding system. a) Schematic of the VRP-dCjCas9 activation feeding system. VPR-dCjCas9 transgenic worms were generated by injection of the Pdpy-30::VPR-dCjCas9 plasmid. By delivering the engineered sgRNA plasmid containing the gene-specific gRNA sequence through bacterial feeding, the VRP-dCjCas9 activator can activate gene expression in C. elegans. b) Pmyo-2::GFP fluorescence in the pharyngeal region of the VPR-dCjCas9 and VP64-dCjCas9 strains bearing the Pmyo-2::GFP::H2B transgene in the presence or absence of myo-2-specific sgRNA targeting the promoter region. c) Survival analyses of the VPR-dCjCas9 worms in the presence or absence of aak-2-, pha-4-, or lipl-4-specific sgRNA targeting the promoter region. d) Fat levels in the intestinal region of the VPR-dCjCas9 strains in the presence or absence of lipl-4- or lipl-5-specific sgRNA targeting the promoter region. e) Survival analyses of the VPR-dCjCas9 worms in the presence or absence of the spr-4-specific sgRNA targeting the promoter region. f) Relative mRNA expression of target genes in the VPR-dCjCas9 worms in the presence or absence of the specific sgRNA targeting the target gene promoter region. sgRNA (−), empty vector L4440; sgRNA (+), gene-specific sgRNA plasmid; NC sgRNA, negative control sgRNA plasmid. g) Schematic of the distribution of all designed sgRNAs in the promoter regions of the target genes. h) Relative mRNA expression of tissue-specific genes, including pie-1, ges-1, and rab-3, in the VPR-dCjCas9 worms in the presence or absence of the specific sgRNA targeting the target gene promoter region. In (b) and (d), data are displayed as the mean ± SD, n ≥ 30. In (c) and (e), lifespan analyses were performed using the Kaplan–Meier plotter, and the p value was determined by the log-rank test. The detailed lifespan values are listed in Table 5. In (f) and (h), the data are displayed as the mean ± SD of 3 independent experiments. In (b), (d), (f), and (h), ***P < 0.001, *P < 0.05, ns, not significant (Student’s t-test).
Table 5.

The lifespan data and statistics.

FigureStrainsTreatmentsMean lifespan ± SEM (d) P-value VS sgRNA (−)Change in mean lifespan (%) N
Fig. 1c VPR-dCjCas9
EXP.1sgRNA (−)20.262 ± 0.160
229
aak-2 sgRNA (+)21.593 ± 0.168<0.0016.57
214
pha-4 sgRNA (+)21.432 ± 0.177<0.0015.77
192
lipl-4 sgRNA (+)21.821 ± 0.218<0.0017.69
117
EXP.2sgRNA (−)20.291 ± 0.162
206
aak-2 sgRNA (+)21.208 ± 0.166<0.0014.52
178
pha-4 sgRNA (+)21.680 ± 0.180<0.0016.85
181
lipl-4 sgRNA (+)21.284 ± 0.235<0.0014.89
95
EXP.3sgRNA (−)19.807 ± 0.151//
187
aak-2 sgRNA (+)21.410 ± 0.177<0.0018.09
173
pha-4 sgRNA (+)21.241 ± 0.165<0.0017.24
170
lipl-4 sgRNA (+)21.039 ± 0.266<0.0016.22
77
Fig. 1e VPR-dCjCas9
EXP.1sgRNA (−)20.554 ± 0.223
195
spr-4 sgRNA (+)21.743 ± 0.195<0.0015.78
191
EXP.2sgRNA (−)20.444 ± 0.205
178
spr-4 sgRNA (+)22.227 ± 0.221<0.0018.72
181
EXP.3sgRNA (−)20.217 ± 0.177
180
spr-4 sgRNA (+)22.151 ± 0.220<0.0019.57
166
To ensure efficient transcription of sgRNA in HT115 bacteria, a T7 promoter was used to drive an sgRNA cassette, including a target-specific sequence and a structurally modified sgRNA [sgRNA (F+E); Zhao ] scaffold sequence. A lac operator was added between the T7 promoter and the target sequence to ensure sgRNA expression induced by isopropyl-beta-D-galactoside (IPTG). Furthermore, a T7 RNA polymerase terminator was added to the 3′ end of the scaffold to ensure the correct termination of sgRNA transcription (Fig. 1a). Afterward, the sgRNA cassette was cloned into the L4440 vector to replace the convergently oriented T7 promoter fragment and then transformed into HT115 bacteria (Fig. 1a). We fed VPR-dCjCas9 transgenic worms grown on plates containing IPTG using HT115 bacteria carrying gene-specific sgRNA for the promoter or empty vector L4440 (without the sgRNA cassette as a control) from L1 larvae to the young adult stage. The worms fed sgRNA were then collected to determine transcriptional levels and corresponding phenotype analyses to assess the efficacy of our VPR-dCjCas9 activation feeding system. Quantification of transcripts was normalized using the housekeeping gene cdc-42 (Hoogewijs ), whose mRNA levels were not affected by sgRNA-bacteria, which was verified using other internal reference genes (acl-1 and csq-1; Hoogewijs ; data not shown). In addition, to quantify transcripts, we used both empty vector L4440 and an sgRNA targeting an intergenic sequence as the negative control (Fig. 1f). During injection of plasmid Pdpy-30::VPR-dCjCas9, Pmyo-2::GFP::H2B was used as a coinjection maker to ensure successful microinjection. To test the capacity of the VPR-dCjCas9 feeding system, we first examined whether our VPR-dCjCas9 activator could up-regulate the pharyngeal GFP fluorescence expression by sgRNA targeting the myo-2 promoter. We fed the VPR-dCjCas9 transgenic worms HT115 bacteria carried with myo-2-specific sgRNA for promoter. We observed a significant increase in the fluorescence intensity of pharyngeal-GFP (Fig. 1b) and mRNA expression level when compared with the VPR-dCjCas9-only control worms (Fig. 1f), suggesting that the VPR-dCjCas9 feeding system could be used to activate the target gene in C. elegans. Given the ability of the VPR-dCjCas9 system to upregulate reporter gene expression, we speculated that it might also induce endogenous gene transcription in C. elegans. Therefore, we used the VPR-dCjCas9 feeding system to activate a series of endogenous genes and conducted phenotype analyses. First, we chose aak-2 and pha-4 to examine the ability of the VPR-dCjCas9 system to induce endogenous gene transcription. Both the AMPK α-catalytic subunit AAK-2 and the human FoxA transcription factor ortholog PHA-4 play important roles in lifespan regulation (Greer ; Panowski ). By delivering specific sgRNA targeting the aak-2 or pha-4 promoter using bacterial feeding, we observed a significant extension in mean lifespan (Fig. 1c) and greatly increased mRNA levels of the target (Fig. 1f), compared with control. Furthermore, we used lipid metabolism-regulating genes (lipl-4 and lipl-5) to assess our VPR-dCjCas9 system. The lysosomal acid lipases LIPL-4 and LIPL-5 have been reported to regulate lipid storage and longevity in C. elegans (Folick ; Buis ). Consistent with previous findings, using ORO staining, we found that the fat storage levels of C. elegans were significantly decreased when the VPR-dCjCas9 feeding system was used to target the lipl-4 or lipl-5 promoter, respectively (Fig. 1d). Moreover, up-regulation of the mRNA expression levels of lipl-4 or lipl-5 was also detected (Fig. 1f). Similar to aak-2 and pha-4, we also observed a significant lifespan extension when targeting lipl-4 promoter (Fig. 1c). Recently, researchers have used engineered dCas9::VP46 by microinjection manner, to successfully induce the mammalian REST orthologue spr-4 transcriptional activation and lifespan extension in worms (Zullo ). Consistently, using our VPR-dCjCas9 feeding system with spr-4-specific-sgRNA, we also observed upregulation of the mRNA level of spr-4 with corresponding lifespan extension (Fig. 1, e and f). Altogether, these results suggest that the feeding-based VPR-dCjCas9 activation system enables efficient activation of endogenous genes in C. elegans. Compared with the traditional microinjection activation system, our VPR-dCjCas9 feeding system, although not as efficient as microinjection systems, is more efficient and less labor-intensive than injection systems (Zhang ). Another gene activation system using herpes simplex virus-derived VP64 as an activator has been reported in C. elegans (Long ; Zullo ). To compare the activation efficiency of VP64 and the VPR activator, we generated VP64-dCjCas9 transgenic worms and then assessed the ability of VP64 and the VPR activator to induce gene expression using the same sgRNA targeting the myo-2 promoter by feeding manner. Compared with the control worms, we observed a significant increase in the fluorescence intensity of pharyngeal-GFP both in VPR-dCjCas9 and VP64-dCjCas9 worms, but those of VP64-dCjCas9 worms were weaker, suggesting that the activation efficiency of the VPR activator was obviously stronger than that of VP64 (Fig. 1b). Furthermore, to determine the activation efficiency of our VPR-dCjCas9 feeding system in different tissues, we attempted to activate tissue-specific genes including pie-1 (germline), ges-1 (intestine), and rab-3 (neuron), by delivering specific-sgRNAs of targets through bacteria feeding. We found significant up-regulation of the mRNA levels of ges-1 and rab-3, but not pie-1, by feeding the gene-specific sgRNA bacteria (Fig. 1h). These results suggest that our feeding-based VPR-dCjCas9 system exhibits different efficiencies in different tissues, with a high activation efficiency in the intestine, pharynx (confirmed by myo-2) and neuron, but poor efficiency (even nonfunctional) in the germline. As so far, a modular and flexible platform for gene activation in vivo has been built using the dCas9 protein combined with trans-activator domains (Böhm ; Chiarella ). In this study, we developed a CRISPR-CjCas9-based system to efficiently activate transcription through bacteria feeding to deliver gene-specific sgRNA in C. elegans, which is cost-effective and efficient. However, it is worth noting that targeting either the different genes or the same gene in different sites using our VPR-dCjCas9 feeding system exhibited markedly different activation efficiencies (Table 4). Therefore, a preliminary screening to obtain suitable and efficient sgRNAs is required before corresponding studies using the VPR-dCjCas9 feeding system. To better select the functional sgRNAs, we analyzed the distribution of all designed sgRNAs in the promoter region of the different target genes and found that the functional sgRNAs were primarily distributed between 400 and 700 bp upstream of the 5′UTR of target genes (Fig. 1g). Moreover, a previous study indicated that over-expression SID-1 and SID-2 transgenic worms could be selected as a powerful genetic background to increase gRNA uptake (Liu ). In further study, we will attempt to use the SID-1 and SID-2 over-expression transgenic background to optimize our VPR-dCjCas9 feeding system. Furthermore, the expression of most genes could be regulated by transcription factors or epigenetic modifiers. Therefore, combining dCjCas9 with other functional domains, such as an epigenetic modifier, would greatly expand the applicability of our CRISPR-Cas9 feeding system in C. elegans. Overall, this novel dCjCas9-based feeding system may hold great promise for genome editing, transcriptome modulation, and other applications in C. elegans.
Table 4.

The sgRNA screening of multiple targeted genes.

Target geneTarget sequences (5′–3′)Fold change
myo-2 sgRNA1GGGGATGTCACAATAAAACGTC CACAGCAC1.30
sgRNA2AAATGAAGAATCGGGGGCACTG ATTAACAC 3.98
sgRNA3ATAAGAGTAGCAAAATGGCAGG AAGAGCAC 2.72
myo-3 sgRNA1GCGAATATAATGGAATATAATG GATCACAC1.49
sgRNA2AGCAACAGAATCTATACAACAC GCACACAC1.09
sgRNA3CTATTTTCACTTCGGGAGCCCA ACCAACAC1.38
aak-2 sgRNA1AATATGTTCAGATGCTCGAGTG CAACGCAC 3.14
sgRNA2TTTTGTTTGGCGAGAGGAAGGA AAAAGCAC1.77
sgRNA3AAAGGTTTGCTGTGTAAATAGA ACAAGTAC1.06
akt-1 sgRNA1GTTGGAAAACAAAAAACCACAG ACGAACAC1.31
sgRNA2GTGACCCTATTTCAGCGGAAAC AAGAACAC 1.92
sgRNA3TGGAAAACAAGATTATTTCTAC GATAACAC1.21
lipl-4 sgRNA1CGTAGTCTGGCTTCTCCCTCAT CTTAATAC1.09
sgRNA2GATTTGCACTTCACATACACAC ACACACAC1.83
sgRNA3ATGACAACTGAAATTGCAGGAG CATCATAC 8.69
lipl-5 sgRNA1TGCCGGGGAAGAGTGTGGTGAA CGTAGTAC1.34
sgRNA2AAGATAAGCTGTTTGGCGCTGT GAGGGTAC 2.60
sgRNA3CACAGTACCCTTAATGCGTCGA TAAAGTAC 3.70
cps-6 sgRNA1ATTTCCCGGTGATTGCCGAATC GGAGACAC1.87
sgRNA2AGGTAGAAGTTGCCAACAAAAC CGACACAC1.43
sgRNA3GCCAGCGACAAATTGCTCCACG AGTAGTAC1.57
pha-4 sgRNA1ACCACTATACGATTCTGGGTCA CTAAACAC0.92
sgRNA2AAGGGAATGGACATAGAGACGC AGTAACAC1.58
sgRNA3TCTGTGCGAGACTATTAAAGTG TTCAATAC 3.00
spr-4 sgRNA1TCAGACACAGGGTCAACGTAAT TAAAGTAC1.23
sgRNA2GTCGGCTAATGGGCGGTTAGAA ACTAGCAC 2.46
sgRNA3AACCGAAAAGAGTGTTGGAGAC GAAGATAC 6.05
pie-1 sgRNA1TCAGACACAGGGTCAACGTAAT TAAAGTAC0.99
sgRNA2GTCGGCTAATGGGCGGTTAGAA ACTAGCAC1.00
sgRNA3AACCGAAAAGAGTGTTGGAGAC GAAGATAC1.20
ges-1 sgRNA1TCAGACACAGGGTCAACGTAAT TAAAGTAC1.02
sgRNA2GTCGGCTAATGGGCGGTTAGAA ACTAGCAC 2.36
sgRNA3AACCGAAAAGAGTGTTGGAGAC GAAGATAC 1.76
rab-3 sgRNA1TCAGACACAGGGTCAACGTAAT TAAAGTAC1.22
sgRNA2GTCGGCTAATGGGCGGTTAGAA ACTAGCAC 1.89

Bold values: p < 0.05

The sgRNA screening of multiple targeted genes. Bold values: p < 0.05

Data availability

The C. elegans strains and plasmids are available upon request. Table 1 contains the sgRNAs and primers sequence. Table 2 contains the full sequence of feeding sgRNA cassette. Table 3 contains the primers used in qRT-PCR. Table 4 contains the sgRNA screening data of all candidate genes. Table 5 contains the statistics data of all lifespan assays. The authors affirmed that all data necessary for confirming the conclusions of the article are present within the article. The lifespan data and statistics. QZ, Q-LW, and ZL designed the study, ZL, WD, CW, and QY conducted the experiments. Q-LW, ZL, and CW analyzed the data. ZL and WD wrote the manuscript. QZ and Q-LW reviewed and edited the manuscript.

Funding

This project has been supported by the National Key R&D Program of China (2018YFC2002000), the Program of Introducing Talents of Discipline to Universities (111 Project, no. B16021), the Natural Science Foundation of Guangdong Province, China (2018A0303131003), the Science and Technology Plan Project of Guangzhou, China (202002030021), the National Natural Science Foundation of China (82001465), and the Guangdong Basic and Applied Basic Research Foundation (2020A1515111026).

Conflicts of interest

None declared.
  20 in total

1.  An AMPK-FOXO pathway mediates longevity induced by a novel method of dietary restriction in C. elegans.

Authors:  Eric L Greer; Dara Dowlatshahi; Max R Banko; Judit Villen; Kimmi Hoang; Daniel Blanchard; Steven P Gygi; Anne Brunet
Journal:  Curr Biol       Date:  2007-09-27       Impact factor: 10.834

2.  Regulation of transcriptionally active genes via the catalytically inactive Cas9 in C. elegans and D. rerio.

Authors:  Lijiang Long; Hong Guo; Di Yao; Kai Xiong; Yongjun Li; Pengpeng Liu; Zuoyan Zhu; Dong Liu
Journal:  Cell Res       Date:  2015-03-27       Impact factor: 25.617

3.  Aging. Lysosomal signaling molecules regulate longevity in Caenorhabditis elegans.

Authors:  Andrew Folick; Holly D Oakley; Yong Yu; Eric H Armstrong; Manju Kumari; Lucas Sanor; David D Moore; Eric A Ortlund; Rudolf Zechner; Meng C Wang
Journal:  Science       Date:  2015-01-02       Impact factor: 47.728

4.  Generation of stable transgenic C. elegans using microinjection.

Authors:  Laura A Berkowitz; Adam L Knight; Guy A Caldwell; Kim A Caldwell
Journal:  J Vis Exp       Date:  2008-08-15       Impact factor: 1.355

5.  Targeting herpes simplex virus with CRISPR-Cas9 cures herpetic stromal keratitis in mice.

Authors:  Di Yin; Sikai Ling; Dawei Wang; Yao Dai; Hao Jiang; Xujiao Zhou; Soren R Paludan; Jiaxu Hong; Yujia Cai
Journal:  Nat Biotechnol       Date:  2021-01-11       Impact factor: 54.908

6.  All-In-One Dendrimer-Based Lipid Nanoparticles Enable Precise HDR-Mediated Gene Editing In Vivo.

Authors:  Lukas Farbiak; Qiang Cheng; Tuo Wei; Ester Álvarez-Benedicto; Lindsay T Johnson; Sang Lee; Daniel J Siegwart
Journal:  Adv Mater       Date:  2021-06-17       Impact factor: 32.086

7.  Coelomocytes Regulate Starvation-Induced Fat Catabolism and Lifespan Extension through the Lipase LIPL-5 in Caenorhabditis elegans.

Authors:  Alexia Buis; Stéphanie Bellemin; Jérôme Goudeau; Léa Monnier; Nicolas Loiseau; Hervé Guillou; Hugo Aguilaniu
Journal:  Cell Rep       Date:  2019-07-23       Impact factor: 9.423

8.  N6-methyldeoxyadenine and histone methylation mediate transgenerational survival advantages induced by hormetic heat stress.

Authors:  Qin-Li Wan; Xiao Meng; Wenyu Dai; Zhenhuan Luo; Chongyang Wang; Xiaodie Fu; Jing Yang; Qunshan Ye; Qinghua Zhou
Journal:  Sci Adv       Date:  2021-01-01       Impact factor: 14.136

9.  MiniCAFE, a CRISPR/Cas9-based compact and potent transcriptional activator, elicits gene expression in vivo.

Authors:  Xin Zhang; Sihan Lv; Zhenhuan Luo; Yongfei Hu; Xin Peng; Jie Lv; Shanshan Zhao; Jianqi Feng; Guanjie Huang; Qin-Li Wan; Jun Liu; Hongxin Huang; Bing Luan; Dong Wang; Xiaoyang Zhao; Ying Lin; Qinghua Zhou; Zhen-Ning Zhang; Zhili Rong
Journal:  Nucleic Acids Res       Date:  2021-04-19       Impact factor: 16.971

10.  Dose-dependent activation of gene expression is achieved using CRISPR and small molecules that recruit endogenous chromatin machinery.

Authors:  Anna M Chiarella; Kyle V Butler; Berkley E Gryder; Dongbo Lu; Tiffany A Wang; Xufen Yu; Silvia Pomella; Javed Khan; Jian Jin; Nathaniel A Hathaway
Journal:  Nat Biotechnol       Date:  2019-11-11       Impact factor: 54.908

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.