| Literature DB >> 35372341 |
Ana Palma1,2, Juan Carlos Chara1,2, Alejandro Montilla1,2, Amaia Otxoa-de-Amezaga1, Francisca Ruíz-Jaén3, Anna M Planas3, Carlos Matute1,2, Alberto Pérez-Samartín1,2, María Domercq1,2.
Abstract
Abnormalities in myelination are associated to behavioral and cognitive dysfunction in neurodevelopmental psychiatric disorders. Thus, therapies to promote or accelerate myelination could potentially ameliorate symptoms in autism. Clemastine, a histamine H1 antagonist with anticholinergic properties against muscarinic M1 receptor, is the most promising drug with promyelinating properties. Clemastine penetrates the blood brain barrier efficiently and promotes remyelination in different animal models of neurodegeneration including multiple sclerosis, ischemia and Alzheimer's disease. However, its role in myelination during development is unknown. We showed that clemastine treatment during development increased oligodendrocyte differentiation in both white and gray matter. However, despite the increase in the number of oligodendrocytes, conduction velocity of myelinated fibers of corpus callosum decreased in clemastine treated mice. Confocal and electron microscopy showed a reduction in the number of myelinated axons and nodes of Ranvier and a reduction of myelin thickness in corpus callosum. To understand the mechanisms leading to myelin formation impairment in the presence of an excess of myelinating oligodendrocytes, we focused on microglial cells that also express muscarinic M1 receptors. Importantly, the population of CD11c+ microglia cells, necessary for myelination, as well as the levels of insulin growth factor-1 decrease in clemastine-treated mice. Altogether, these data suggest that clemastine impact on myelin development is more complex than previously thought and could be dependent on microglia-oligodendrocyte crosstalk. Further studies are needed to clarify the role of microglia cells on developmental myelination.Entities:
Keywords: clemastine; development; microglia; myelin; oligodendrocyte
Year: 2022 PMID: 35372341 PMCID: PMC8970281 DOI: 10.3389/fcell.2022.841548
Source DB: PubMed Journal: Front Cell Dev Biol ISSN: 2296-634X
Sequences for mouse primers used for qPCR.
| Target gene | Forward (5′->3′) | Reverse (5′->3′) |
|---|---|---|
|
| GAACATATCCCTGGGCCTGTC | CACAGTAGGACCACAAGCCAA |
|
| GCTTTTGCCTGTTTGGCATT | AATCAGTCACTTTCACCGGGAG |
|
| AGGTCCAGGAAGAGCTGCAG | GTGCCGTCAGTTCTTGTGTGA |
|
| AGAAGTCCCCGTCCCTATCG | CCTTCTCCTTTGCAGCTTCG |
|
| CAAGCCCAAATTCAAATCCG | CCAAGCCTTTCTTCCACCC |
|
| AGGGCGGAGACTCCGAAA | GAAGTAGCACTCGCCCATGAAC |
|
| GGATTGGCAAGGTGATGGAA | CGACATCAAAGCTCAGGTGAA |
|
| TCCAAAGGCCAACTGAAGCA | CTGCAGCCTTCCTTGGTGTA |
|
| AGGGAGTGTTTGTGCTGAAC | GCCAATGTCTGCCTTCTCTAC |
|
| AGCAGCAGGTGTCCCAAA | TTCTTGGGGTCAGCACAGAC |
|
| GGTGTGCTAGACATTGGCAAA | GACTTGCATGTAGGAAATGTGGAA |
|
| CATGGGCTTGGCAATCCTTA | ATTGAAATAAGCTTGCGTCTCC |
|
| GCCCACCAGGAAAGTACACA | CCTCAGTGGCTCCTTCATTCA |
|
| ACCACAAGCCCACAGAATCA | AGGAAGGCAAGGCTGAGAAA |
|
| CACAAAGCCATGCTGTAGTACC | GTAAAACCCATGCCGTTTCCA |
|
| GAGGAGCAGGTGGAAGACTA | GGAAAAGACTGCACCGAAGATA |
|
| GATGCCAGTCTGCAAGTTCC | TTGACACCAGGCACATCCA |
|
| ACCTCTCCACCAGTTTCTCC | AGTACATGACACCCTCAAGGAC |
|
| GCTGAGACTGAGTCGCCTTA | CTCTGTGTGTTGAGGTCACTGTA |
FIGURE 1(A) Schematic representation of clemastine treatment (50 μg/kg; i.p.) during development. The analysis was performed in corpus callosum (cc), retrospinal cortex (ctx rsp) and primary somatosensory cortex (ctx ss) at postnatal day 21 (P21). (B,C) Compressed confocal z stack images of APC+ mature oligodendrocytes [(B); green] and PDGFR+ oligodendrocyte progenitor cells [(C); OPCs; green] in cc, ctx rsp and ctx ss of control and clemastine-treated mice. Below, average of the percentage of mature oligodendrocytes (B) or OPCs (C) vs total Olig2+ oligodendroglial cells (n = 6 mice per experimental group). Scale bar = 50 μm *p < 0.05, **p < 0.01.
FIGURE 2(A) Schematic representation of compound action potentials (CAPs) recording in corpus callosum of 400 μm coronal slices from P21 mice. (B) Conduction velocity corresponding to N1 and N2 peaks in vehicle (n = 12) and clemastine-treated mice (n = 10–12). For each mice, the average measure come from at least four different sections recorded three times. (C) The input-output relationship for N1 myelinated fibers is left-shifted in clemastine-treated corpus callosum (n = 7–8). *p < 0.05.
FIGURE 3(A) Representative confocal images of nodes of Ranvier (Nav1.6; red) and paranodes (caspr; green) in corpus callosum of control and clemastine treated P21 mice. Scale bar = 5 μm. Rigth, histograms shows average node of Ranvier number and length in control and clemastine-treated mice (n = 6 per experimental group). (B) Representative confocal images of MBP+ myelin internodes (green) flanked by two caspr+ paranodes (red; arrows). Right, average and cumulative internode length distribution in cerebral cortex of control and clemastine-treated P21 mice (n = 6 per group). (C) Representative confocal images of MBP and Neurofilament (NF-L) immunostainings of the corpus callosum. Scale bar = 15 μm. Right, histograms show average immunoreactivity of MBP and NF-L staining in corpus callosum from control and clemastine-treated P21 mice (n = 6 per group).
FIGURE 4(A) Representative electron microscopy images of myelinated axons within corpus callosum in control and clemastine treated mice. Graphs represent the average of myelinated axons (at least 60 different images per animal from n = 3 mice per group). (B) Representative electron microscopy images of myelin thickness in control and clemastine treated mice. Graphs represent the mean g-ratios for small and bigger axons (100-150 axons in control and clemastine-treated mice) and the distribution of g-ratios for control and clemastine-treated mice (n = 3 mice per group).
FIGURE 5(A) Graph showing Chmr1 gen expression in all CNS cell types. Note that Chmr1 is also expressed in microglia. Data was taken from BrainRNA-seq database (Zhang et al., 2014). (B) Recordings of Ca2+ responses in microglia in vitro following application of muscarine (100 μM; arrow) using Fluo-4. Data represent average ±s.e.m. of values obtained from more than 50 cells from 3 different cultures. (C) Quantification of the number of Iba1+ microglia cells as well as Iba1 staining intensity in corpus callosum of control and clemastine-treated mice. (D) Representative skeletonized images of microglia used for morphological analysis. Scale bar = 10 μm. Graphs show average of the number of branches, junctions and sholl analysis of microglia in control and clemastine-treted mice. (E) Representative compressed z confocal images showing the expression of iNOS, a pro-inflammatory marker, and CD68, a phagocytic marker, in Iba1+ microglia in corpus callosum of control and clemastine-treated mice. Scale bar = 10 μm. Graphs show the average P2y12 and CD68 staining intensity (n = 6 mice per group). *p < 0.05, **p < 0.01.
FIGURE 6(A) Gene expression of Arginase, Chi3l3 and clec7a, anti-inflammatory markers, of ApoE, a disease associated marker, of CD36, a phagocytic marker and of IGF, a growth factor involved in myelinogenesis. The expression levels of genes are presented using fold-change values transformed to Log2 format compared to control (n = 4 mice per group). (B) Representative images and histogram showing Alexa-488-labeled myelin endocytosis (1 h, 37°C) by primary microglia in control and clemastine-treated cultures (n = 3 independent experiments performed in duplicate). Scale bar = 10 μm. (C,D) Representative confocal images of P21 corpus callosum showing engulfment of Olig2+ oligodendrocytes (red) by P2Y12+ microglia (green) (C) and of MBP+ myelin (green) by Iba1+ microglia (red) (D). Arrows indicate Olig2+ or MBP+ fragments inside microglia cell. Arrowhead, a microglia process physically interacting with a myelin sheath (D). Scale bar = 20 μm (C), 5 μm [inset in (C)] and 15 μm (D). Right, histogram shows the percentage of microglia cells with internalized MBP in control and clemastine-treated P21 mice n = 4-6 mice per group. (E) Analysis of the number of CD11c+ cells in control and clemastine treated CD11-eYFP mice. Representative z confocal images and histogram showing that clemastine reduced the number of CD11c+ cells (n = 3-4 mice per group). Scale bar = 20 μm*p < 0.05, **p < 0.01.