| Literature DB >> 35372301 |
Akihiko Yamamoto1, Amarish K Yadav1, Maxwell J Scott1.
Abstract
Drosophila suzukii (D. suzukii) (Matsumura, 1931; Diptera: Drosophilidae), also known as spotted wing Drosophila, is a worldwide pest of fruits with soft skins such as blueberries and cherries. Originally from Asia, D. suzukii is now present in the Americas and Europe and has become a significant economic pest. Growers largely rely on insecticides for the control of D. suzukii. Genetic strategies offer a species-specific environmentally friendly way for suppression of D. suzukii populations. We previously developed a transgenic strain of D. suzukii that produced only males on a diet that did not contain tetracycline. The strain carried a single copy of the FL19 construct on chromosome 3. Repeated releases of an excess of FL19 males led to suppression of D. suzukii populations in laboratory cage trials. Females died as a consequence of overexpression of the tetracycline transactivator (tTA) and tTA-activated expression of the head involution defective proapoptotic gene. The aim of this study was to generate additional male-only strains that carried two copies of the FL19 transgene through crossing the original line with a piggyBac jumpstarter strain. Males that carried either two chromosome 3 or a singleX-linked transgene were identified through stronger expression of the red fluorescent protein marker gene. The brighter fluorescence of the X-linked lines was likely due to dosage compensation of the red fluorescent protein gene. In total, four X-linked lines and eleven lines with two copies on chromosome 3 were obtained, of which five were further examined. All but one of the strains produced only males on a diet without tetracycline. When crossed with wild type virgin females, all of the five two copy autosomal strains examined produced only males. However, the single copy X-linked lines did not show dominant female lethality. Five of the autosomal lines were further evaluated for productivity (egg to adult) and male competition. Based on these results, the most promising lines have been selected for future population suppression experiments with strains from different geographical locations.Entities:
Keywords: Drosophila suzukii; fsRIDL; piggyBac transposon; spotted wing drosophila; sterile insect technique
Year: 2022 PMID: 35372301 PMCID: PMC8965018 DOI: 10.3389/fbioe.2022.829620
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
FIGURE 1Mating scheme to produce and identify males with a transposed FL19 transgene. FL19 females were crossed with the H7 piggyBac transposase jumpstarter males to initiate transposition. Males that could be carrying an X-linked or two autosomal copies of FL19 were identified by fluorescence intensity in G3.
Tetracycline-repressible female-specific lethality of FL19 transposition lines.
| Strain (chromo-some) | Tetra-cycline | Homozygous Number Males | Homozygous Number Females | Homoyzgous %Male | Hemizygous Number Males | Hemizygous Number Females | Hemizygous % Males |
|---|---|---|---|---|---|---|---|
| 7 (X) | − | 239 | 0 | 100 | 239 | 81 | 74.7 |
| + | 253 | 221 | 53.3 | 294 | 286 | 50.7 | |
| 46 (X) | − | 119 | 43 | 73.5 | 186 | 229 | 44.8 |
| + | 188 | 234 | 44.5 | 192 | 206 | 48.2 | |
| 77 (X) | − | 268 | 0 | 100 | 236 | 52 | 82 |
| + | 283 | 243 | 53.8 | 264 | 275 | 49 | |
| 79 (X) | − | 261 | 1 | 99.6 | 226 | 274 | 54.8 |
| + | 188 | 242 | 43.7 | 274 | 289 | 48.7 | |
| 7 (X) + FL19 | − | 66 | 0 | 100 | 115 | 0 | 100 |
| + | 54 | 42 | 56.2 | 146 | 166 | 46.8 | |
| 8 (3) | − | 60 | 0 | 100 | 179 | 0 | 100 |
| + | 46 | 55 | 45.5 | 263 | 258 | 50.5 | |
| 36 (3) | − | 64 | 0 | 100 | 245 | 0 | 100 |
| + | 61 | 32 | 65.6 | 198 | 248 | 44 | |
| 40 (3) | − | 34 | 0 | 100 | 51 | 0 | 100 |
| + | 74 | 34 | 68.5 | 139 | 161 | 46.3 | |
| 70 (3) | − | 40 | 0 | 100 | 190 | 0 | 100 |
| + | 89 | 29 | 75.4 | 258 | 225 | 53.4 | |
| 75 (3) | − | 20 | 0 | 100 | 176 | 0 | 100 |
| + | 49 | 21 | 70 | 257 | 290 | 53.8 |
Total count of offspring from three independent vials of flies except for the homozygous chromosome 3 and X + FL19 lines where the data is from the productivity experiment shown in Table 1.
The number of females obtained was significantly lower than expected (Pearson’s Chi-squared test, p < 0.001).
The number of females obtained was significantly lower than expected (Pearson’s Chi-squared test, p < 0.0001).
The number of females obtained was not significantly lower than expected.
Productivity of FL19 transposition lines.
| Strain (chromosome) | Tetra-cycline | Number eggs | Number unhatched eggs | Number pupae | Numbermales | Number females | Number total adults | Egg survival ratio Mean (SD) | Larval survival ratio Mean (SD) | Pupal survival ratio Mean (SD) | Egg to adult ratio |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Wild type |
| 150 | 10 | 133 | 65 | 59 | 124 | 0.93 (0.046) | 0.95 (0.111) | 0.93 (0.033) | 0.83 (0.11) |
|
| 183 | 15 | 165 | 67 | 89 | 156 | 0.92 (0.023) | 0.97 (0.1) | 0.95 (0.051) | 0.85 (0.103) | |
| Wild type (est. 2011) |
| 230 | 30 | 157 | 69 | 70 | 139 | 0.87 (0.064) | 0.79 (0.1) | 0.89 (0.076) | 0.62** (0.121) |
|
| 200 | 20 | 117 | 43 | 62 | 105 | 0.84 (0.054) | 0.70 (0.082) | 0.90 0.11) | 0.53** (0.079) | |
| 7 (X) + FL19 (3) |
| 200 | 16 | 70 | 66 | 0 | 66 | 0.92 (0.016) | 0.38 (0.074) | 0.94 (0.011) | 0.66NS (0.12) |
|
| 200 | 14 | 112 | 54 | 42 | 96 | 0.93 (0.035) | 0.6 (0.178) | 0.87 (0.091) | 0.48NS (0.099) | |
| FL19 (3) |
| 600 | 63 | 186 | 157 | 0 | 157 | 0.89 (0.041) | 0.35 (0.1) | 0.86 (0.11) | 0.52NS (0.145) |
|
| 600 | 70 | 350 | 161 | 150 | 311 | 0.88 (0.05) | 0.66 (0.106) | 0.89 (0.073) | 0.52NS (0.08) | |
| 8 (3) |
| 282 | 18 | 83 | 60 | 0 | 60 | 0.94 (0.049) | 0.32 (0.13) | 0.66 (0.3) | 0.44NS (0.32) |
|
| 200 | 16 | 112 | 46 | 55 | 101 | 0.92 (0.051) | 0.61 (0.13) | 0.9 (0.06) | 0.51NS (0.117) | |
| 36 (3) |
| 281 | 70 | 64 | 54 | 0 | 54 | 0.75 (0.071) | 0.3 (0.13) | 0.87 (0.14) | 0.37NS (0.135) |
|
| 146 | 36 | 61 | 27 | 32 | 59 | 0.75 (0.05) | 0.55 (0.06) | 0.97 (0.03) | 0.40NS (0.053) | |
| 40 (3) |
| 142 | 50 | 34 | 22 | 0 | 22 | 0.65 (0.08) | 0.37 (0.09) | 0.60 (0.42) | 0.3NS (0.27) |
|
| 166 | 53 | 74 | 36 | 34 | 70 | 0.68 (0.023) | 0.66 (0.113) | 0.96 (0.057) | 0.42NS (0.051) | |
| 70 (3) |
| 200 | 48 | 40 | 23 | 0 | 23 | 0.76 (0.059) | 0.26 (0.088) | 0.53 (0.33) | 0.23* (0.21) |
|
| 236 | 69 | 89 | 56 | 29 | 85 | 0.71 (0.069) | 0.53 (0.083) | 0.96 (0.057) | 0.36* (0.071) | |
| 75 (3) |
| 217 | 90 | 20 | 10 | 0 | 10 | 0.59 (0.102) | 0.17 (0.117) | 0.43 (0.159) | 0.1* (0.092) |
|
| 200 | 79 | 48 | 25 | 21 | 46 | 0.6 (0.066) | 0.4 (0.047) | 0.94 (0.04) | 0.23* (0.038) |
Total count of offspring from at least three replicates.
On diet without tetracycline this is the number of males divided by the number of eggs times two. On diet with tetracycline this is the total number of adults divided by the number of eggs. NS, indicates not significantly different compared to wild type (est. 2011). * indicates significantly reduced adult production compared to wild type (est. 2011) (p < 0.0016 for + tetracycline and p < 0.0033 on no tetracycline, see methods for details). ** indicates significantly reduced adult production compared to wild type (newly established).
Male sexual competitiveness.
| Line (chromosome) | Number replicates | Number mated with transgenic | Number mated with wild type | Number mated with both males (remating) | Total mated | MCI |
|
|---|---|---|---|---|---|---|---|
| FL19 (3) | 7 | 16 | 48 | 3 | 67 | 0.27 (0.06) | 0.0002 |
| 7 (X) + FL19 (3) | 4 | 14 | 23 | 1 | 38 | 0.39 (0.08) | 0.1944 |
| 8 (3) | 6 | 16 | 40 | 0 | 56 | 0.29 (0.07) | 0.0013 |
| 36 (3) | 5 | 25 | 18 | 1 | 44 | 0.59 (0.08) | 0.2278 |
| 40 (3) | 8 | 15 | 46 | 9 | 70 | 0.29 (0.06) | 0.0003 |
| 70 (3) | 7 | 14 | 46 | 3 | 63 | 0.25 (0.06) | <0.0001 |
| 75 (3) | 4 | 7 | 26 | 1 | 34 | 0.24 (0.09) | 0.0020 |
Mating competitiveness index or MCI, is the number mated with transgenic plus half the number that remated divided by the total number mated.
X-linked and third chromosome FL19 lines.
| Chromosome | Line | Homozygous condition |
|---|---|---|
| X | 7 | viable |
| X | 46 | viable |
| X | 77 | viable |
| X | 79 | viable |
| 3 | F8 | sterile |
| 3 | 6 | sterile |
| 3 | 8 | viable |
| 3 | 17 | viable |
| 3 | 18 | dead |
| 3 | 36 | viable |
| 3 | 40 | viable |
| 3 | 70 | viable |
| 3 | 75 | viable |
| 3 | 78 | viable |
| 3 | 83 | viable |
FL19 insertion sites in transposition lines.
| Line | Chromosome | Insertion site sequence (TTAA in bold) | Nearest gene | Relationship to original FL19 location |
|---|---|---|---|---|
| 7 | X | TCGATATCAGGTGGTGCACT |
| NA |
| 46 | X | GCTCCGCCGTCGTTTGTATT |
| NA |
| 77 | X | CGCCAAAACGCAAGAAACCT |
| NA |
| 79 | X | ND (repetitive) | ND | NA |
| 8 | 3 | TAAATAATTTCGAAACCACT |
| 67.8 kb 3′ |
| 36 | 3 | TTGTAAATTAAAATAAAGGC |
| 2.6 kb 5′ |
| 40 | 3 | ND | ND | ND |
| 70 | 3 | GAGGATCATGTTGATGCCCA |
| 60.8 kb 3′ |
| 75 | 3 | CGTGTTTACCGGTTCGTGC |
| 7.5 kb 3′ |
Contigs of the Paris et al. (2020) genome assembly.
FIGURE 2Relative location of FL19 transgenes on chromosome 3. The location of transgenes is indicated by vertical lines. The length and direction of arrows indicates the sizes and direction of transcription of transcription of genes as annotated (Paris et al., 2020).
Recombination mapping of X-linked FL19 transgenes.
| Cross | Number fluorescent F1 males | Number wild type F1 males | Map distance (cM) |
|---|---|---|---|
| 79♀ x 46♂ | 114 | 33 | 45 |
| 46♀ x 7♂ | 99 | 18 | 31 |
| 79♀ x 7♂ | 151 | 9 | 11 |
| 77♀ x 79♂ | 136 | 0 | 0 |
| 7♀ x 77♂ | 114 | 5 | 8 |