| Literature DB >> 35370672 |
Xing Chen1,2, Yao He1,2, Zhijie Yu1,2, Jianli Zuo1,2, Yan Huang1,2, Yi Ruan1,2, Xiaoyuan Zheng1,2, Yu Ma3.
Abstract
Objective: To study the effect of polydatin on the injury of pulmonary arterial hypertension (PAH) induced by monocrotaline (MCT).Entities:
Keywords: Arg1; EndMT; HIF-2α; polydatin; pulmonary arterial hypertension
Year: 2022 PMID: 35370672 PMCID: PMC8972160 DOI: 10.3389/fphar.2022.862017
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
FIGURE 1Scheme of the study.
FIGURE 2Polydatin alleviates right ventricular hypertrophy induced by MCT in SD rats. (A) Chemical structure of Polydatin. (B) Weight of SD rats (n = 6). (C) Morphology of rat heart. (D) the ratio of RV/(LV + S) (n = 6). (E) Morphology of right ventricular hypertrophy. Data correspond to mean values ±standard error. Groups were compared using One-way ANOVA adjusted with Dunnett’s test. *p < 0.05 and **p < 0.01 versus control group. # p < 0.05 and ## p < 0.01 versus model group.
Primers sequences.
| Gene | Forward primer (5-3′) | Reverse primer (5-3′) |
|---|---|---|
| Rat BMPR2 | CAAAGCCCAGAAGAGCACAGAGG | TTGCCATCCTGCGTTGACTCAC |
| Rat PHD2 | TCCGTCACGTCGATAACCCAAATG | CGAAGAATACCTCCGCTCACCTTG |
| Rat HIF-2α | ACTGAGACACCTGCCACCTTCC | CTTGCCACTCCTGACCCCTTTTG |
| Rat Arg1 | AGACCACAGTATGGCAATTGGAAGC | TTGTCAGCGGAGTGTTGATGTCAG |
| Rat CXCL12 | CGCTCTGCATCAGTGACGGTAAG | AAGGGCACAGTTTGGAGTGTTGAG |
| Rat CXCR4 | CAGCCTGTGGATGGTGGTGTTC | CTTGCCACTCCTGACCCCTTTTG |
Antibodies and other reagents.
| Antibodies and reagents | Dilution | Manufacturers |
|---|---|---|
| For immunohistochemical staining | ||
| Rabbit anti-human/Rat N-cadherin | 1/5,000–1/20,000 | Abcam |
| For Immunofluorescence | ||
| Rabbit anti-Rat β-catenin | 1/500 | Abcam |
| Rabbit anti-Rat vimentin | 1/250–1/1,000 | Abcam |
| Rabbit anti-human/Rat PECAM1 | 1/2000 | Abcam |
| Rabbit anti-Rat TAGLN | 1/100–1/1,000 | Abcam |
| Mouse anti-human/Rat GAPDH | 1:50,000 | Proteintech |
| Goat anti-rabbit IgG (H + L) | 1:20,000 | ZSGB-BIO |
| Goat anti-mouse IgG (H + L) | 1:20,000 | ZSGB-BIO |
FIGURE 3Polydatin ameliorates the pathological damage of PAH induced by MCT in SD rats. (A) Morphology of rat lung. (B) HE staining of rat lung tissue, Scale bar = 20 μm. (C–D) The mRNA expression levels of CXCL12 and CXCR4 (n = 6). Data correspond to mean values ±standard error. Groups were compared using One-way ANOVA adjusted with Dunnett’s test. *p < 0.05 and **p < 0.01 versus control group. # p < 0.05 and ## p < 0.01 versus model group.
FIGURE 4Polydatatin inhibits MCT-induced activation of HIF-2α/Arg1 signaling pathway. (A–D) The mRNA expression levels of BMPR2, PHD2, HIF-2ɑ and Arg1 (n = 6). (E–F) HIF-2ɑ and Arg1 expression and production was measured by ELISA (n = 6). Data correspond to mean values ±standard error. Groups were compared using One-way ANOVA adjusted with Dunnett’s test. *p < 0.05 and **p < 0.01 versus control group. # p < 0.05 and ## p < 0.01 versus model group.
FIGURE 5Polydatin improves lung endothelial cell dysfunction induced by MCT. (A–B) Representative immunohistochemical staining (100 × magnification) and gray mean values of N-cadherin expression in lung tissues. (C–D) Representative immunofluorescence staining (100 × magnification) and gray mean values of β-catenin expression in lung tissues. (E–F) Representative immunofluorescence staining (100 × magnification) and gray mean values of vimentin expression in lung tissues. Data correspond to mean values ±standard error. Groups were compared using One-way ANOVA adjusted with Dunnett’s test. *p < 0.05 and **p < 0.01 versus control group. # p < 0.05 and ## p < 0.01 versus model group.
FIGURE 6Polydatin improves pulmonary vascular remodeling induced by MCT. (A–B) Representative immunohistochemical staining (100 × and 200 × magnification) and gray mean values of TAGLN expression in lung tissues. (C–D) Representative immunofluorescence staining (100 × and 200 × magnification) and gray mean values of PECAM1 expression in lung tissues. Data correspond to mean values ±standard error. Groups were compared using One-way ANOVA adjusted with Dunnett’s test. *p < 0.05 and **p < 0.01 versus control group. # p < 0.05 and ## p < 0.01 versus model group.
FIGURE 7Molecular docking analysis of polydatin to key targets of PAH induced by MCT. (A–D) Complex model of polydatin to human BMPR2 (A), PHD2 (B), HIF-2α (C) and Arg1 (D) rendered in backbone cartoon (left) or in molecular surface (right).
FIGURE 8Polydatin improves MCT-induced PAH by inhibiting EndMT.