| Literature DB >> 35369428 |
Maria Gisele Gonçalves1, Lucila Okuyama Fukasawa1, Karoline Rodrigues Campos1, Fábio Takenori Higa1, Adele Caterino-de-Araujo1.
Abstract
Brazil currently has the highest number of individuals infected with human T-lymphotropic virus 1- and 2- (HTLV-1 and HTLV-2) globally. At present, neither molecular protocols nor commercial assays are available for HTLV-1/-2 diagnosis or validated by the Brazilian Ministry of Health regulatory agency (ANVISA). We developed and validated two in-house multiplex quantitative real-time PCR for HTLV-1/-2 (mqPCR_HTLV) assays, targeting the pol and tax genes, for the simultaneous identification of HTLV-1, HTLV-2, and the albumin reference gene. The robustness of the assays was evaluated on two platforms using seven commercial master mix formulations. The reactions employed double plasmids (pHTLV1-Alb and pHTLV2-Alb) for the standard curve's construction and for expressing the detection limit of the assays. They were able to detect 10 and 10 copies of HTLV-1 and 10 and 70 copies of HTLV-2 for the tax and pol targets, respectively. High efficiency was obtained using both the platforms and all the reagents evaluated and were successfully reproduced by other analysts. DNA samples from HTLV-1/-2-infected and non-infected patients and from HIV/HTLV-coinfected patients were evaluated to determine the feasibility of their use in routine diagnosis. The mqPCR_HTLV (pol and tax) assays demonstrated an overall specificity of 100% and a sensitivity of 97.4% when testing samples from patients without HIV infection, and sensitivities of 77.1% (pol) and 74.6% (tax) in samples from HIV/HTLV-coinfected patients. In addition, they resolved the issue of HTLV western blotting (WB) indeterminate and WB-untyped results in 45.5 and 66.7% of cases, respectively. The developed mqPCR_HTLV (pol and tax) assays indicated their feasibility for efficient and reliable HTLV diagnosis in various core facility laboratories under different conditions and supplies.Entities:
Keywords: HTLV-1; HTLV-2; multiplex qPCR; pol; tax
Year: 2022 PMID: 35369428 PMCID: PMC8965094 DOI: 10.3389/fmicb.2022.831594
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Primers and probes employed in two multiplex qPCR_HTLV assays (pol and tax) for detecting HTLV-1 and HTLV-2.
| Gene | Primer/probe | Sequences (5′→3′) | Nucleotide position | Amplicon size (bp) | References |
|
| HTLV-1 F | GAACGCTCTAATGGCATTCTTAAAACC | 4,788–4,814 |
| |
| HTLV-1 R | GTGGTTGATTGTCCATAGGGCTAT | 4,895–4,872 | 108 | ||
| HTLV-1 Pb | FAM- ACTTTACTGACAAACCCGACCTACCCATGG-BHQ1 | 4,828–4,857 | |||
| HTLV-2 F | CAACCCCACCAGCTCAGG | 4,740–4,757 | |||
| HTLV-2 R | GGGAAGGTTAGGACAGTCTAGTAGATA | 4,830–4,804 | 91 | ||
| HTLV-2 Pb | Cy5- TGGTCGAGAGAACCAATGGT | 4,760–4,789 | |||
|
| HTLV-1 F | CGGATACCCAGTCTACGTGTT | 7,359–7,379 | ||
| HTLV-1 R | CAGTAGGGCGTGACGATGTA | 7,458–7,439 | 100 |
| |
| HTLV-1 Pb | FAM-CTGTGTACAAGGCGACTGGTGCC-BHQ1 | 7,386–7,408 | |||
| HTLV-2 F | CGATTGTGTACAGGCCGATTG | 7,272–7,292 | |||
| HTLV-2 R | CAGGAGGGCATGTCGATGTAG | 7,347–7,327 | 76 |
| |
| HTLV-2 Pb | Cy5-TGTCCCGTCTCAGGTGGTCTATGTTCCA-BHQ2 | 7,294–7,321 | |||
| Albumin F | GCTCAACTCCCTATTGCTATCACA | 16,222–16,245 |
| ||
|
| Albumin R | GGGCATGACAGGTTTTGCAATATTA | 16,351–16,327 | 130 | |
| Albumin Pb | HEX-TCTCTTGTGGGCTGTAATCATCGTCTAGGC-BHQ1 | 16,290–16,319 |
F, Forward; R, Reverse; Pb, Probe; FAM, 6-carboxy-fluorescein; CY5, cyanine dye; HEX, phosphoramidite dye; BHQ, black hole quencher, R, degenerate base—recognition of A or G bases (in bold and underlined).
FIGURE 1Comparative efficiency of the singleplex and multiplex qPCR_HTLV in detecting HTLV-1/-2 pol (A,B) and tax (C,D) target genes using serial plasmid dilutions and linear regression analyses, conducted in ROCHE platform.
Efficiency of the mqPCR_HTLV (pol and tax), slope and correlation coefficients (R2) for detecting HTLV-1 and HTLV-2 using two platform/equipment.
| gene | HTLV-1 | HTLV-2 | |||
| Platforms | ABI | ROCHE | ABI | ROCHE | |
| Efficiency % |
| 100.0 | 101.4 | 99.3 | 104.0 |
| Slope | −3.32 | −3.29 | −3.33 | −3.19 | |
| Linearity– | 0.991 | 0.998 | |||
| LOD | 10 | 10 | 70 | 70 | |
| Efficiency % |
| 110.6 | 100.2 | 96.2 | 100.2 |
| Slope | −3.30 | −3.31 | −3.41 | −3.31 | |
| Linearity– | 0.996 | 1.000 | |||
| LOD | 10 | 10 | 10 | 10 | |
LOD, limit of detection (copy per reaction); ABI, Applied Biosystems 7.500-ABI platform; ROCHE, LightCycler 480 II equipment.
Limit of detection and intra-assay reproducibility of the mqPCR_HTLV (pol) for detecting HTLV-2.
| Copy number | positive + / negative – (HTLV-2_ | Reproducibility (%) (number of positive/number of replicates) |
| 100 | ++++++ | 100 (6/6) |
| 90 | ++++++ | 100 (6/6) |
| 80 | ++++++ | 100 (6/6) |
| 70 | ++++++ | 100 (6/6) |
| 60 | −/++++/− | 66 (4/6) |
| 50 | ++/−−/++ | 66 (4/6) |
| 40 | −−−−/++ | 33 (2/6) |
| 30 | −−/++/−− | 33 (2/6) |
| 20 | −+++/−− | 50 (3/6) |
| 15 | −−−−/+/− | 16 (1/6) |
| 10 | −−−−−−/+/−/+/−−− | 16 (2/12) |
Reactions conducted using plasmid number dilutions ranging from 100 to 10 copies, Kapa Biosystems master mix, ROCHE LightCycler 480II equipment, and six and twelve replicates.
FIGURE 2Limit of copy number detection of the mqPCR_HTLV assay (pol) for detecting HTLV-1 (A) and HTLV-2 (B) using plasmids and seven different master mix trademarks, and ROCHE LightCycler 480II equipment. The Cq values are disclosed inside the rectangles.
FIGURE 3Limit of copy number detection of the mqPCR_HTLV assay (tax) for detecting HTLV-1 (A) and HTLV-2 (B) using plasmids and seven different master mix trademarks, and ABI 7.500 equipment. The Cq values are disclosed inside the rectangles.
Efficiency values of the mqPCR_HTLV assays for detecting HTLV-1 and HTLV-2 (pol and tax) and the reference gene (human albumin gene), using seven commercial master mix reagents.
| Efficiency of Master Mix solutions detections in the mqPCR_HTLV | ||||||||
| Trademark | ||||||||
| HTLV-1 | RG | HTLV-2 | RG | HTLV-1 | RG | HTLV-2 | RG | |
| ROCHE | 101.20% | 111.70% | 100.45% | 97.80% | 108.98% | 94.20% | 94.60% | 99.40% |
| Invitrogen | 100.30% | 106.70% | 100.45% | 100.10% | 102.90% | 102.60% | 91.24% | 93.90% |
| Promega | 98.20% | 108.10% | 107.80% | 103.40% | 105.15% | 106.80% | 94.60% | 94.80% |
| Quanta | 100.35% | 100.35% | 100.25% | 108.00% | 101.80% | 99.60% | 101.60% | 93.20% |
| BioRad | 100.45% | 95.90% | 100.35% | 100.50% | 100.10% | 102.30% | 93.37% | 94.90% |
| Kapa | 100.45% | 107.40% | 100.25% | 100.10% | 102.06% | 107.60% | 96.37% | 94.20% |
| Sigma | 100.35% | 109.60% | 102.00% | 102.50% | 105.90% | 107.80% | 94.17% | 94.80% |
| Eff. Mean | 100.14% | 105.68% | 101.65% | 101.77% | 103.84% | 102.99% | 95.14% | 95.03% |
Intra- and inter-assay reproducibility of mqPCR_HTLV (pol and tax) for detecting HTLV-1 and HTLV-2 using serial plasmid dilutions prepared by three analysts and a robot, conducted in duplicate using the ABI equipment.
| Target gene | Copies/5 μL | mqPCR_HTLV-1 | mqPCR_HTLV-2 | ||||||||||||
| *QIAgility Cq | Analyst 1 Cq | Analyst 2 Cq | Analyst 3 Cq | Mean Cq |
| CV% | *QIAgility Cq | Analyst 1 Cq | Analyst 2 Cq | Analyst 3 Cq | Mean Cq |
| CV% | ||
|
| 1,000,000 | 20/20 | 20/20 | 21/21 | 21/21 | 20.5 | 0.5 | 2.6 | 23/23 | 23/23 | 24/24 | 25/25 | 23.8 | 0.9 | 3.7 |
| 100,000 | 23/24 | 24/24 | 25/25 | 24/24 | 24.1 | 0.6 | 2.7 | 27/27 | 26/27 | 27/27 | 29/28 | 27.3 | 0.9 | 3.3 | |
| 10,000 | 27/27 | 27/27 | 28/28 | 27/27 | 27.3 | 0.5 | 1.7 | 30/30 | 30/30 | 31/31 | 32/32 | 30.8 | 0.9 | 2.9 | |
| 1,000 | 30/30 | 30/30 | 31/31 | 31/31 | 30.5 | 0.5 | 1.8 | 34/34 | 33/33 | 34/35 | 35/35 | 34.1 | 0.8 | 2.4 | |
| 100 | 34/33 | 34/34 | 35/35 | 34/34 | 34.1 | 0.6 | 1.9 | 37/37 | 36/37 | 37/38 | 37/38 | 37.1 | 0.6 | 1.7 | |
| 10 | 38/36 | 37/38 | 38/38 | 38/37 | 37.4 | 0.7 | 2.0 | 40/40 | 0/39 | 38/39 | 39/38 | 39.0 | 0.8 | 2.1 | |
| 1 | 0/37 | 0/39 | 0/0 | 38/0 | 0/0 | 0/0 | 0/0 | 0/0 | |||||||
|
| 1,000,000 | 18/18 | 18/19 | 17/18 | 18/19 | 18.1 | 0.6 | 3.5 | 19/20 | 20/21 | 20/19 | 20/19 | 19.8 | 0.7 | 3.6 |
| 100,000 | 22/22 | 22/22 | 21/20 | 22/21 | 21.5 | 0.8 | 3.5 | 23/23 | 23/23 | 23/22 | 22/23 | 22.8 | 0.5 | 2.0 | |
| 10,000 | 25/25 | 26/26 | 24/24 | 25/25 | 25.0 | 0.8 | 3.0 | 26/26 | 25/26 | 27/25 | 26/26 | 25.9 | 0.6 | 2.5 | |
| 1,000 | 28/28 | 29/29 | 27/28 | 28/28 | 28.1 | 0.6 | 2.3 | 30/30 | 29/29 | 30/29 | 28/29 | 29.3 | 0.7 | 2.4 | |
| 100 | 31/31 | 32/32 | 30/31 | 30/31 | 31.8 | 0.8 | 2.2 | 33/33 | 31/31 | 33/33 | 33/33 | 32.5 | 0.9 | 2.8 | |
| 10 | 35/35 | 36/36 | 34/35 | 34/35 | 35.0 | 0.8 | 2.2 | 36/36 | 34/35 | 36/36 | 36/35 | 35.5 | 0.8 | 2.1 | |
| 1 | 38/39 | 0/0 | 45/0 | 38/37 | 39/38 | 0/39 | 0/0 | 38/0 | |||||||
*QIAgility, robotic PCR setup; SD, standard deviation; CV, coefficient of variation (calculated between non-zero values).
Results of HTLV-1/2 confirmatory tests (WB, mqPCR_HTLV pol and tax) when employed in HIV-infected individuals suspected of HTLV-1/2 infection by screening assays (Group 2).
| Confirmatory test | HTLV-1 | HTLV-2 | HTLV-1 and HTLV-2 | HTLV | Ind | Neg | Pos | Total | Positivity % |
| WB | 77 | 29 | 3 | 9 | 22 | 12 | 118 | 152 | 77.6 |
| mqPCR_HTLV ( | 69 | 31 | 1 | 51 | 101 | 152 | 66.4 | ||
| mqPCR_HTLV ( | 68 | 25 | 2 | 57 | 95 | 152 | 62.5 |
WB, western blot; mqPCR_HTLV (pol), multiplex quantitative real-time PCR for pol target gene; mqPCR_HTLV (tax), multiplex quantitative real-time PCR for tax target gene; HTLV, HTLV untyped sample; Ind, indeterminate; Neg, negative; Pos, positive. *Three samples with discrepant results described in the text.
Final results of HTLV-1/2 confirmatory tests (mqPCR_HTLV pol and tax, WB when employed in 152 HIV-infected individuals suspected of HTLV-1/2 infection by screening assays (Group 2).
| N | mqPCR_ | mqPCR_ | WB | N | mqPCR_ | mqPCR_ | WB | N | mqPCR_ | mqPCR_ | WB |
|
| HTLV-1 | NEG | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-2 | HTLV-2 | HTLV-2 |
|
| HTLV-1 | HTLV-1 | HTLV-1 |
| NEG | NEG | HTLV-1 |
| HTLV-2 | HTLV-2 | HTLV-2 |
|
| HTLV-1/-2 | HTLV-1/-2 | HTLV-1/-2 |
| HTLV-2 | HTLV-2 | HTLV-2 |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-2 | HTLV-2 | IND |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| HTLV-2 | HTLV-2 | HTLV-2 |
| NEG | NEG | IND |
| NEG | NEG | HTLV-2 |
|
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV |
| HTLV-1 | HTLV-1 | HTLV-1/-2 |
|
| HTLV-1 | HTLV-1 | IND |
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| NEG | NEG | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| HTLV-2 | HTLV-2 | HTLV-2 |
| HTLV-2 | HTLV-2 | IND |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| HTLV-1 | HTLV-1 | HTLV-1/-2 |
| HTLV-2 | HTLV-2 | HTLV-2 |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV-1 |
| NEG | NEG | IND |
|
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| HTLV-2 | HTLV-2 | IND |
| HTLV-2 | NEG | HTLV-2 |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-2 | HTLV-1/-2 | HTLV-2 |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| NEG | NEG | NEG |
| HTLV-2 | HTLV-2 | HTLV-2 |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| NEG | NEG | NEG |
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| HTLV-2 | NEG | IND |
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| NEG | NEG | HTLV-1 |
| HTLV-2 | HTLV-2 | HTLV-2 |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| NEG | NEG | NEG |
| NEG | NEG | NEG |
| NEG | NEG | HTLV-2 |
|
| NEG | NEG | HTLV-1 |
| HTLV-2 | HTLV-2 | HTLV-2 |
| NEG | NEG | IND |
|
| HTLV-2 | HTLV-2 | HTLV-2 |
| NEG | NEG | HTLV-2 |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| HTLV-2 | HTLV-2 | HTLV-2 |
| HTLV-1 | HTLV-1 | HTLV-1 |
| NEG | NEG | NEG |
|
| HTLV-1 | HTLV-1 | HTLV-1 |
| NEG | NEG | IND |
| HTLV-1 | NEG | HTLV-1 |
|
| NEG | NEG | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-2 | NEG | HTLV |
|
| NEG | NEG | IND |
| HTLV-1 | HTLV-1 | HTLV-1 |
| NEG | NEG | HTLV-1 |
|
| HTLV-2 | HTLV-2 | HTLV-2 |
| NEG | NEG | HTLV-2 |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| HTLV-1 | HTLV-1 | HTLV-1 |
| NEG | NEG | HTLV |
| NEG | NEG | IND |
|
| NEG | NEG | NEG |
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| NEG | NEG | NEG |
| NEG | HTLV-1 | HTLV |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| HTLV-2 | HTLV-2 | IND |
| NEG | NEG | HTLV-2 |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| HTLV-2 | HTLV-2 | HTLV |
| NEG | HTLV-1 | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| NEG | NEG | NEG |
| NEG | NEG | IND |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| HTLV-2 | HTLV-2 | HTLV-2 |
| NEG | NEG | HTLV-2 |
| NEG | HTLV-1 | HTLV-1 |
|
| NEG | NEG | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| HTLV-1 | HTLV-1 | HTLV |
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-1 | NEG | HTLV-1 |
|
| NEG | NEG | HTLV-1 |
| NEG | NEG | HTLV-1 |
| NEG | NEG | IND |
|
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-2 | NEG | IND |
| HTLV-2 | HTLV-2 | HTLV-2 |
|
| NEG | NEG | NEG |
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| HTLV-1 | HTLV-1 | HTLV-1 |
| NEG | NEG | HTLV-2 |
| HTLV-2 | HTLV-2 | IND |
|
| NEG | NEG | NEG |
| HTLV-1 | NEG | HTLV-1 |
| HTLV-2 | HTLV-2 | HTLV-2 |
|
| NEG | NEG | NEG |
| HTLV-1 | HTLV-1 | HTLV |
| HTLV-2 | HTLV-2 | IND |
|
| NEG | NEG | HTLV-1 |
| HTLV-2 | HTLV-2 | HTLV-2 |
| HTLV-2 | HTLV-2 | HTLV-2 |
|
| NEG | NEG | NEG |
| NEG | NEG | HTLV |
| HTLV-2 | NEG | IND |
|
| NEG | NEG | IND |
| NEG | NEG | IND |
| NEG | NEG | HTLV-1 |
|
| HTLV-1 | HTLV-1 | HTLV-1 |
| NEG | NEG | HTLV-1 |
| NEG | NEG | HTLV-2 |
|
| HTLV-1 | HTLV-1 | HTLV-1 |
| NEG | NEG | IND |
| HTLV-1 | HTLV-1 | HTLV-1 |
|
| NEG | NEG | IND |
| HTLV-1 | HTLV-1 | HTLV-1 |
| HTLV-2 | HTLV-2 | HTLV-2 |
|
| NEG | NEG | HTLV-2 |
| NEG | NEG | HTLV |
N, patient code number; mqPCR_HTLV (pol), multiplex quantitative real-time PCR for pol target gene; mqPCR_HTLV (tax), multiplex quantitative real-time PCR for tax target gene; WB, western blot (HTLV Blot 2.4, MP Biomedicals); HTLV, HTLV WB untyped sample; Ind, indeterminate; Neg, negative.
*Discrepant results described in the text, HTLV-1 positive by PCR-RFLP (tax). Results according to in section “Materials and Methods”.
Intra- and inter-assay reproducibility of mqPCR_HTLV assays (pol and tax) for detecting HTLV-1 and HTLV-2 using DNA samples from eight individuals with different positive Cq profiles, in duplicate and in four consecutive days of analysis.
| Positive profiles | HTLV-1+ ( | HTLV-1+ ( | HTLV-2+ ( | HTLV-2+ ( | ||||||||||||||||||||
| S | REP | Cq | Mean | SD | CV% | ND | Cq | Mean | SD | CV% | ND | S | REP | Cq | Mean | SD | CV% | ND | Cq | Mean | SD | CV% | ND | |
| High |
| 1 | 28.9 | 29 | 0.4 | 1.5 | 8/8 | 28.8 | 29 | 0.1 | 0.5 | 8/8 |
| 1 | 32.2 | 33 | 0.2 | 0.5 | 8/8 | 29.7 | 30 | 0.4 | 1.2 | 8/8 |
| 28.0 | 28.9 | 32.5 | 29.7 | |||||||||||||||||||||
| 2 | 28.9 | 28.8 | 2 | 32.5 | 29.8 | |||||||||||||||||||
| 28.9 | 28.8 | 32.5 | 30.0 | |||||||||||||||||||||
| 3 | 29.0 | 28.9 | 3 | 32.8 | 30.7 | |||||||||||||||||||
| 29.4 | 29.2 | 32.5 | 30.5 | |||||||||||||||||||||
| 4 | 29.5 | 28.8 | 4 | 32.3 | 29.6 | |||||||||||||||||||
| 28.6 | 28.7 | 32.6 | 29.7 | |||||||||||||||||||||
| Median |
| 1 | 32.7 | 33 | 0.3 | 0.9 | 8/8 | 32.3 | 33 | 0.4 | 1.2 | 8/8 |
| 1 | 35.8 | 36 | 0.4 | 1.1 | 8/8 | 32.9 | 33 | 0.7 | 2.1 | 8/8 |
| 32.2 | 33.3 | 35.4 | 32.8 | |||||||||||||||||||||
| 2 | 32.6 | 32.2 | 2 | 35.8 | 32.9 | |||||||||||||||||||
| 32.6 | 33.3 | 35.7 | 32.7 | |||||||||||||||||||||
| 3 | 32.6 | 32.8 | 3 | 35.9 | 34.2 | |||||||||||||||||||
| 32.4 | 32.5 | 36.2 | 32.8 | |||||||||||||||||||||
| 4 | 32.6 | 32.6 | 4 | 35.8 | 32.9 | |||||||||||||||||||
| 33.4 | 32.4 | 34.7 | 31.3 | |||||||||||||||||||||
| Low |
| 1 | 35.8 | 36 | 0.2 | 0.6 | 8/8 | 35.8 | 36 | 0.6 | 1.8 | 8/8 |
| 1 | 39.3 | 39 | 0.5 | 1.3 | 8/8 | 34.9 | 36 | 1 | 2.8 | 8/8 |
| 35.6 | 35.7 | 38.0 | 36.4 | |||||||||||||||||||||
| 2 | 35.9 | 34.9 | 2 | 39.4 | 34.5 | |||||||||||||||||||
| 36.4 | 34.5 | 39.3 | 36.4 | |||||||||||||||||||||
| 3 | 36.0 | 36.9 | 3 | 39.4 | 38.2 | |||||||||||||||||||
| 36.1 | 35.7 | 38.2 | 35.7 | |||||||||||||||||||||
| 4 | 35.8 | 35.9 | 4 | 38.5 | 36.4 | |||||||||||||||||||
| 35.9 | 35.2 | 38.5 | 35.9 | |||||||||||||||||||||
| Scarce |
| 1 | 0.0 | *38 | 18 | 46.7 | 2/8 | *37.5 | *38 | 18 | 46.7 | 2/8 |
| 1 | 0.0 | *40 | 17 | 43.8 | 1/8 | 0.0 | 0 | 0 | 0.0 | 0/8 |
| 0.0 | *37.6 | 0.0 | 0.0 | |||||||||||||||||||||
| 2 | 0.0 | 0.0 | 2 | 0.0 | 0.0 | |||||||||||||||||||
| 0.0 | 0.0 | 0.0 | 0.0 | |||||||||||||||||||||
| 3 | *37.0 | 0.0 | 3 | 0.0 | 0.0 | |||||||||||||||||||
| 0.0 | 0.0 | 0.0 | 0.0 | |||||||||||||||||||||
| 4 | 0.0 | 0.0 | 4 | 0.0 | 0.0 | |||||||||||||||||||
| *37.8 | 0.0 | *40 | 0.0 | |||||||||||||||||||||
S, samples; REP, repetition/days; Cq, Cycle quantification/amplification value; SD, Standard deviation; CV, Coefficient of variation; ND, number of detections. *Calculated between non-zero values; Positive profiles: high (Cq < 30), median (Cq from 31 to 35), low (Cq from 36 to 37) and scarce (Cq from 38 to 40).