Akram Mirzaei1, Sina Rashedi1, Mohammad Reza Akbari2,3, Fatemeh Khatami1, Seyed Mohammad Kazem Aghamir1. 1. Urology Research Center, Tehran University of Medical Sciences, Tehran, Iran. 2. Women's College Research Institute, Women's College Hospital, University of Toronto, Toronto, Canada. 3. Institute of Medical Science, Faculty of Medicine, University of Toronto, Toronto, Canada.
Abstract
Arsenic trioxide (ATO) and statins have been demonstrated to have anti-neoplastic properties; however, the data regarding their combination therapy is limited. Thus, we aimed to study the effects of ATO, Simvastatin and their combination in proliferation, apoptosis and pathological angiogenesis in prostate cancer cell lines. The human prostate cell lines were treated with different concentrations of Simvastatin and ATO alone and combined to find effective doses and IC50 values. In addition, the percentage of apoptotic cells was evaluated by annexin/PI staining, and mRNA expression levels of the apoptotic gene, including OPN isoforms and VEGF, were investigated using real-time PCR. Our data displayed that Simvastatin (12 and 8 μM in PC3 and LNCaP cell lines respectively), ATO (8 and 5 μM in PC3 and LNCaP cell lines respectively), and also their combination (12 μM Simvastatin and 8 μM ATO in PC3, 8 μM Simvastatin and 5 μM ATO in LNCaP cell lines respectively) significantly increased the percentage of apoptotic cells. Also, we showed that the combination therapy by Simvastatin and ATO increased cell apoptosis and inhibited cell proliferation, providing anti-proliferative and anti-angiogenic properties, possibly via downregulation of the expression of VEGF and OPN genes. These results provide new perceptions regarding the anticancer roles of ATO and statins' combination therapy in prostate cancer.
Arsenic trioxide (ATO) and statins have been demonstrated to have anti-neoplastic properties; however, the data regarding their combination therapy is limited. Thus, we aimed to study the effects of ATO, Simvastatin and their combination in proliferation, apoptosis and pathological angiogenesis in prostate cancer cell lines. The human prostate cell lines were treated with different concentrations of Simvastatin and ATO alone and combined to find effective doses and IC50 values. In addition, the percentage of apoptotic cells was evaluated by annexin/PI staining, and mRNA expression levels of the apoptotic gene, including OPN isoforms and VEGF, were investigated using real-time PCR. Our data displayed that Simvastatin (12 and 8 μM in PC3 and LNCaP cell lines respectively), ATO (8 and 5 μM in PC3 and LNCaP cell lines respectively), and also their combination (12 μM Simvastatin and 8 μM ATO in PC3, 8 μM Simvastatin and 5 μM ATO in LNCaP cell lines respectively) significantly increased the percentage of apoptotic cells. Also, we showed that the combination therapy by Simvastatin and ATO increased cell apoptosis and inhibited cell proliferation, providing anti-proliferative and anti-angiogenic properties, possibly via downregulation of the expression of VEGF and OPN genes. These results provide new perceptions regarding the anticancer roles of ATO and statins' combination therapy in prostate cancer.
Prostate cancer (PCa), as the leading type of diagnosed malignancy in men, imposes a significant health burden for the male population globally.
As demonstrated in previous studies, androgens play a pivotal role in the survival and growth of PCa cells by activating the androgen receptors (AR). Most prostate tumours require androgens for progression at early stages
; however, over time, most prostate tumours become androgen‐refractory with more aggressive and metastatic characteristics due to alterations in AR expression downstream signalling pathways.
These androgen‐refractory tumours do not further respond to androgen depletion therapy and a variety of cytotoxic drugs. Currently, no established and effective treatment has been identified to prolong the survival of patients with these tumours.
Therefore, the detection of new therapeutic measures is of utmost importance for managing PCa tumours.Arsenic trioxide (ATO) is an anticancer agent primarily employed to induce remission in patients with acute promyelocytic leukaemia.
,
The therapeutic efficacy of ATO in leukaemic patients has encouraged researchers to investigate its utility in other neoplasms and solid tumours, including PCa. In this regard, previous studies have demonstrated the capability of ATO to decrease cell proliferation, induce apoptosis and autophagy, and inhibit AR activity in PCa cell lines.
,
,
Moreover, ATO demonstrates anti‐angiogenic properties through modulation of transforming growth factor‐beta (TGF‐β)/SMAD signalling pathway.
However, previous studies have reported toxicity resulting in acute and chronic side effects following treatment with ATO.
Thus, strategies for reducing the therapeutic dose and diminishing the adverse effects of ATO in managing prostate tumours are crucial. Combination therapy could be one of those strategies for reducing ATO toxicity and enhancing its therapeutic efficacy.Statins, a class of lipid‐lowering drugs via inhibiting β‐hydroxy β‐methylglutaryl‐coenzyme A (HMG‐CoA) reductase, have been linked to reduced risk of PCa, particularly the advanced disease.
,
,
Cell‐based and animal‐based investigations have described the anti‐carcinogenic effects of statins in PCa through both cholesterol‐mediated and non‐cholesterol‐mediated mechanisms.
The anti‐neoplastic roles of statins include inhibition of neoplastic cell proliferation, migration, invasion and pathological angiogenesis, alongside promoting apoptosis.
,
,
Statins’ family have different intracellular effects, pravastatin and rosuvastatin (hydrophilic statins), simvastatin (lipophilic statins) display a greater ability to penetrate the cell membrane. Since lipophilic statins have higher pro‐apoptotic activity and cytotoxic potential than hydrophilic statins and may be beneficial in cancer treatment,
in this study, we used simvastatin to evaluate its effect on prostate cancer cells.In addition, accumulating evidence has suggested that statins downregulate AR expression in PCa cells, leading to a significant reduction in serum prostate‐specific antigen (PSA).
,Given these anti‐neoplastic effects, statins have been utilized with other anti‐PCa regimens in several reports.
,
However, to the best of our knowledge, no prior studies have investigated the combined effect of ATO and statins on PCa. Moreover, the evidence regarding the role of ATO in the management of prostate tumours is limited. Hence, we aimed to study the effects of ATO, Simvastatin, and their combination in both androgen‐dependent (LNCaP) and androgen‐independent (PC3) cell lines of PCa in terms of proliferation, apoptosis and pathological angiogenesis.
MATERIALS AND METHODS
Cell lines and cell culture
LNCaP (ATCC Number: CRL‐10995 and NCBI Code: C439) and PC3 (ATCC Number: CRL‐1435 and NCBI Code: C427) were obtained from the National Cell Bank of Pasteur Institute (Tehran, Iran). Both prostate cancer cell lines were cultured in RPMI‐1640 medium (Gibco, Carlsbad, CA), which was supplemented with 10% and 20% heat‐inactivated FBS (Gibco, Carlsbad, CA), 100 units/mL of Penicillin, 2 mM L‐glutamine and 100 µg/ml of Streptomycin (Gibco BRL, Grand Island, NY). Both prostate cancer cells were incubated at 37°C in a humidified atmosphere containing 5% CO2. Simvastatin was dissolved in DMSO and then dissolved in sterile double‐distilled water. ATO was dissolved in distilled water.
Cell viability assay
LNCaP and PC3 prostate cancer cell lines were treated with different doses of Simvastatin, and ATO with different concentrations (0–14 µM) were compared with the control group following 24, 48 and 72 h after treatment. The anti‐proliferative effect of these two drugs on cell survival was measured in a dose‐ and time‐dependent manner. Briefly, both prostate cancer cell lines were seeded 5 × 103 cells per well in a 96‐well plate. The experiment was accomplished in triplicate to determine the anti‐proliferative effect of the half‐maximal inhibitory concentration (IC50) of two drugs against the prostate cancer cell lines. In a microplate reader, the optical density was read at an absorbance of 570 nm wavelength (Hyperion, GmbH & Co. KG). Dose‐response curves were plotted, and IC50, an inhibitory concentration of 50% of the control cell's growth was calculated by GraphPad PRISM software version 6 (San Diego, CA). Outcomes were evidenced as a proliferation rate, with 100% representing control cells treated with 0.1% DMSO alone.
Evaluation of cell morphology by crystal violet staining
LNCaP and PC3 prostate cancer cell lines (5 × 104) treated with IC50 concentrations of Simvastatin and ATO for 48 h were implanted in a six‐well plate. Both cell lines were washed twice with PBS and then fixed with −20 methanol and stained the cells with 0.5% w/v violet crystal solution. Cell morphology was evaluated using a reverse microscope.
In vitro 3D colony formation assay
Colony Forming Assay was completed to estimate the invasiveness of prostate cancer cells in vitro. We prepared 2% and 0.7% sterile agarose for this protocol and stored them in a water bath at 45°C. LNCaP and PC3 prostate cancer cells (2 × 105 cells/well) were seeded in six‐well plates followed by ATO and Simvastatin treatment with desired concentrations (12 μM Simvastatin/8 μM ATO for PC3 and 8 μM Simvastatin/5 μM ATO for LNCaP), cells are poured on 2% agar. RPMI‐1640 medium with 10% FBS and 0.7% agarose was added to the cells. The plate was incubated at 37°C until cells grew to visible colonies, and after 14 days, washed with PBS twice and then, colonies were stained with 0.5% w/v crystal violet solution for 30 min at 25°C. Each well was examined for colony formation (Cells accumulate 50 or more cells) under an inverted microscope. All experiments were carried out independently three times.
Hoechst dye (33342) staining
Hoechst dye assay was used to estimate the apoptosis of prostate cancer cell lines in vitro. Both prostate cancer cell lines were seeded into a 24‐well plate (5 × 105 cells/well), then added desired concentrations of ATO, Simvastatin, and their combinations. After 72 h of incubation, the control and treated cells were fixed with 200 μl of methanol and placed at −20°C for 15 min. After centrifugation, PBS (50 μl) and Hoechst dye (2 μl) were added to the cell precipitate and incubated (30 min) at 25°C in the dark. A drop of each sample was placed on a slide and observed and imaged using a fluorescence microscope at 100 magnifications.
Measurement of cell migration
LNCaP and PC3 prostate cancer cell lines were cultured at 5 × 105 cells per well in a six‐cell culture dish. After the cells reached a density of 85%, using a sampler tip, a vertical line was created along the diameter of the six cells. For removing the isolated cells, the bottom of the culture dish was gently washed with a serum‐free culture medium. After 24 h of exposing the cells to the serum‐free culture medium, some cells were treated with deionized water as a control group and some others were treated with the drugs (ATO and Simvastatin treatment, PC3 cell: 12 μM Simvastatin/8 μM ATO and, LNCaP cell: 8 μM Simvastatin/5 μM ATO). Then, at zero and 24 h, photography was done. The rate of cell migration was calculated by calculating the distance between the two edges of the scratch and comparing the control and treated groups.
Apoptosis assay
Fluorescein‐conjugated annexin V (annexin V‐FITC) staining assay was performed for assessing cell apoptosis using manufacturer protocol. LNCaP and PC3 cell lines were seeded in six‐well plates at a density of 3 × 105 cells/well and incubated for 48 h in the absence and presence of desired concentrations of ATO, Simvastatin and their combinations. The treated and the control prostate cancer cell lines were washed with PBS twice, added 100 μl of staining solution containing annexin‐V and PI and incubated 15 min at 25°C in the dark. The fluorescent signals were then assessed using flow cytometry.In the scatter plots, the plots divided into four regions corresponding to, the viable cells (annexin‐V‐ negative and PI‐negative) were named Q4 and shown in the lower left quadrant, the early apoptotic cells (annexin‐V‐positive and PI‐negative) were named Q3 and displayed in the lower right quadrant, and the late apoptotic cells (annexin‐V‐positive and PI‐positive) were named Q2 and shown in the upper right quadrant, and the necrotic cells (annexin‐V‐ negative and PI‐positive) were named Q1 and displayed in the upper left quadrant. The percentage of apoptosis was determined as a percentage of the annexin V+/PI‐ cells through flow cytometry by BD flow cytometer instrument and analysed with flowjo program (Tree Star Inc., version 9.6.3, USA).
DNA cell cycle flow cytometry analysis
Cell cycle distribution was accomplished using Propidium Iodide staining. Both prostate cell lines PC3 and LNCaP (5 × 105 cells/well) were seeded into 6‐well plates, permeabilized and treated with desired concentrations of Simvastatin and ATO for 48h then washed with PBS twice, fixed with 70% cold ethanol and stored at −20°C overnight. Next, cells were washed with PBS twice and incubated at 37°C for 30 min with RNase I (100 μg/ml) and dye DNA with 500 μl propidium iodide (PI) (50 μg/ml in 0.1% Triton X‐100/0.1% sodium citrate). A BD flow cytometer set separated cells. The DNA content was analysed using flow cytometry, and the results were analysed with the Flowjo software (Tree Star Inc., version 9.6.3, USA). The apoptotic cell fraction could predict from the hypodiploid sub‐G0/G1 DNA fraction.
RNA isolation and real‐time PCR
According to the manufacturer's instructions, total RNA was extracted by the Highly Pure RNA isolation kit (Roche Applied Science, Germany). First, the quality and quantity of total RNA were assessed spectrophotometrically using Nanodrop ND‐1000 (Nanodrop Technologies, Wilmington, DE) at 260 and 280 nm. Next, according to the manufacturer's instructions, complementary DNAs (cDNAs) were reverse transcribed from 1 to 2 µg of total RNA using a cDNA synthesis PrimeScript RT reagent Kit (Takara Bio Inc., Otsu, Japan). The cDNA concentration was then normalized in a series of PCR by using GAPDH primers (Table 1). Finally, the normalized cDNAs were subjected to amplification using QIAGEN's real‐time PCR cycler. GAPDH was used as the housekeeping gene to normalize the expression levels, and the 2−ΔΔCT method was used to calculate the relative expression. The list of the used primers and their corresponding amplicon lengths are provided in Table 1.
TABLE 1
Nucleotide sequences of primers used for real‐time PCR
Gene
Accession number
Forward primer (5′−3′)
Reverse primer (5′−3′)
Size (BP)
OPN‐A
NM_001040058.1
ATCTCCTAGCCCCACAGAAT
CATCAGACTGGTGAGAATCATC
208
OPN‐B
NM_000582.2
ATCTCCTAGCCCCAGAGAC
AAAATCAGTGACCAGTTCATCAG
209
OPN‐C
NM_001040060.1
TGAGGAAAAGCAGAATGCTG
GTCAATGGAGTCCTGGCTGT
155
BCL−2
NM_000633.3
GGGGAGGATTGTGGCCTTC
CAGGGCGATGTTGTCCACC
90
BAX
NM_001291428.2
GATGCGTCCACCAAGAAGC
CCAGTTGAAGTTGCCGTCAG
165
P53
NM_000546.6
AGACCTATGGAAACTACTTC
GGACAGCATCAAATCATC
76
PTEN
NM_000314
ACCAGGACCAGAGGAAACCT
GCTAGCCTCTGGATTTGACG
135
VEGF‐A
NM_001316955.1
CTCACCAAGGCCAGCACATAGG
ATCTGGTTCCGAAAACCCTGAG
159
VEGF‐C
NM_005429.4
GTCTGTGTCCAGTGTAGATG
AGGTAGCTCGTGCTGGTGTT
360
GAPDH
NM−001289746.1
GTGAACCATGAGAAGTATGACAAC
CATGAGTCCTTCCACGATACC
123
Nucleotide sequences of primers used for real‐time PCR
Statistical analysis
All data were provided as means ± standard deviation (SD) of triplicate measurements. Analysis of variance ANOVA method, and t‐test, were used to estimate the outcomes, and a significance level of 95% was considered. Statistical significance was defined at *p < 0.05, **p < 0.01, and ***p < 0.001 compared to the corresponding control.
RESULTS
ATO/Simvastatin inhibits cell proliferation
The cytotoxic effects of Simvastatin (0–18 μM) and ATO (0–12 μM) alone and in combination were evaluated in two distinct prostate cancer cell types. Growth inhibitory effects of different concentrations of ATO, Simvastatin or their combination were evaluated by MTT for 24, 48 and 72 h (Figure 1). Based on the results, IC50 values for ATO were 8 and 5 μM for PC3 and LNCaP cells; IC50 values for Simvastatin were 12 and 8 μM for PC3 and LNCaP cells respectively. The results showed that ATO and Simvastatin had a significant cytotoxic effect on both cell lines in a dose‐ and time‐dependent manner. On the other hand, treatment of PC3 and LNCaP cells with 12/8 μM Simvastatin and 8/5 μM ATO caused a significant reduction in the number of colonies. These data showed that Simvastatin and ATO alone and in combination reduce the proliferation of PC3 and LNCaP cells and effectively reduce their viability (Figure 2).
FIGURE 1
Evaluation of cell morphology by crystal violet staining of prostate cancer PC3 and LNCap cell lines. Untreated PC3 and LNCap cells (A, B). PC3 and LNCap cells treated with eight and 5 μM ATO (C, D), PC3 and LNCap cells treated with 12 and 8 μM Simvastatin (E, F), PC3 cells treated with 12 μM Simvastatin plus 8 μM ATO (G), LNCaP cells treated with 8 μM Simvastatin and 5 μM ATO (H). Colony formation assay in PC3 cells. Cells were treated with 12 μM Simvastatin and 8 μM ATO at six‐well plates and were cultured for 14 days and stained with crystal violet. Colonies showed as overview images, from left to right, respectively, were control cells without treatment (I), treatment with 12 μM Simvastatin (J), treatment with 8 μM ATO (K), and finally, combination therapy with both drugs 12 μM Simvastatin and 8 μM ATO (L) resulted in a significant discount in the number of colonies. These figures endorse that Simvastatin and ATO alone and in combination decrease the metastatic effect of PC3 cells and are very effective in inhibiting migration. Scheme of forming a colony containing 50 or more cells (M)
FIGURE 2
Simvastatin and ATO with different concentrations (0–14 µM) on cell proliferation. The anti‐growth effect of cited drugs and their combination was measured by MTT assay following 24, 48, and 72 h in LNCaP and PC3 cell lines. IC50 pharmaceutical doses of 8 and 12 µM in PC3 cell line and 5 and 8 µM in LNCaP cell line for ATO and Simvastatin were determined respectively. Data displayed that the anti‐proliferative impact of these drugs reduces viability and a variety of cells during a dose‐ and time‐dependent manner. A combination of mentioned drugs was highly influential in inhibiting cell growth and promoting enormous programmed cell death in each cell line. MTT assays are presented as the mean ± SD of three independent experiments. Statistical significance was defined at *p < 0.05, **p < 0.01, and ***p < 0.001 compared to the corresponding control
Evaluation of cell morphology by crystal violet staining of prostate cancer PC3 and LNCap cell lines. Untreated PC3 and LNCap cells (A, B). PC3 and LNCap cells treated with eight and 5 μM ATO (C, D), PC3 and LNCap cells treated with 12 and 8 μM Simvastatin (E, F), PC3 cells treated with 12 μM Simvastatin plus 8 μM ATO (G), LNCaP cells treated with 8 μM Simvastatin and 5 μM ATO (H). Colony formation assay in PC3 cells. Cells were treated with 12 μM Simvastatin and 8 μM ATO at six‐well plates and were cultured for 14 days and stained with crystal violet. Colonies showed as overview images, from left to right, respectively, were control cells without treatment (I), treatment with 12 μM Simvastatin (J), treatment with 8 μM ATO (K), and finally, combination therapy with both drugs 12 μM Simvastatin and 8 μM ATO (L) resulted in a significant discount in the number of colonies. These figures endorse that Simvastatin and ATO alone and in combination decrease the metastatic effect of PC3 cells and are very effective in inhibiting migration. Scheme of forming a colony containing 50 or more cells (M)Simvastatin and ATO with different concentrations (0–14 µM) on cell proliferation. The anti‐growth effect of cited drugs and their combination was measured by MTT assay following 24, 48, and 72 h in LNCaP and PC3 cell lines. IC50 pharmaceutical doses of 8 and 12 µM in PC3 cell line and 5 and 8 µM in LNCaP cell line for ATO and Simvastatin were determined respectively. Data displayed that the anti‐proliferative impact of these drugs reduces viability and a variety of cells during a dose‐ and time‐dependent manner. A combination of mentioned drugs was highly influential in inhibiting cell growth and promoting enormous programmed cell death in each cell line. MTT assays are presented as the mean ± SD of three independent experiments. Statistical significance was defined at *p < 0.05, **p < 0.01, and ***p < 0.001 compared to the corresponding control
Induction of apoptosis by ATO /Simvastatin
We performed a flow cytometry assay to investigate apoptotic effects of ATO and Simvastatin on PC3 and LNCaP cell lines. Compared with ATO and Simvastatin alone, the results showed a significant apoptotic increase in PC3 and LNCaP cells treated with combined ATO and Simvastatin, compared with ATO and Simvastatin alone (Figure 3). In addition, we detected an increase in the number of early and late apoptotic cells (annexin+/ PI‐, +) and the minimum percentage of necrosis (annexin‐/PI+) in treated cells compared with control in both cell lines. Furthermore, a significant 85% increase in apoptotic cells was seen in PC3 cells treated with a combination of ATO and Simvastatin.
FIGURE 3
Flow cytometry analysis of LNCaP and cell apoptosis using Annexin‐V‐Flous. The lower left quadrant shows live cells, the lower right, early apoptotic cells, the upper right and late apoptotic cells, and the upper left quadrant shows necrotic cells. Results regarding induced apoptosis of PC3 and LNCaP cells untreated and treated with ATO, Simvastatin and combination of ATO and Simvastatin. Statistical significance was defined at *p < 0.05, **p < 0.01, and ***p < 0.001 compared with the corresponding control
Flow cytometry analysis of LNCaP and cell apoptosis using Annexin‐V‐Flous. The lower left quadrant shows live cells, the lower right, early apoptotic cells, the upper right and late apoptotic cells, and the upper left quadrant shows necrotic cells. Results regarding induced apoptosis of PC3 and LNCaP cells untreated and treated with ATO, Simvastatin and combination of ATO and Simvastatin. Statistical significance was defined at *p < 0.05, **p < 0.01, and ***p < 0.001 compared with the corresponding controlMore apoptosis was seen when ATO was first added to the prostate cancer cell lines than when Simvastatin was first added to both cells. In addition, more apoptosis and necrosis were seen when ATO was first added to the prostate cancer cell lines for 48 h and then 24 h after Simvastatin than when ATO was first added to both cancer cell lines for 24 h and then 24 h after Simvastatin. On the other hand, the effect of drugs (apoptosis) on the PC3 cell line was much more than LNCap for both (24+24)48 and (48+24)72 h (Figure 4).
FIGURE 4
Flow cytometry analysis of LNCaP and cell apoptosis using annexin‐V‐Flous. Simvastatin and B were added to both prostate cancer cell lines in two cases (first Simvastatin, second ATO) and (first ATO, second Simvastatin) at 24 and 48 h
Flow cytometry analysis of LNCaP and cell apoptosis using annexin‐V‐Flous. Simvastatin and B were added to both prostate cancer cell lines in two cases (first Simvastatin, second ATO) and (first ATO, second Simvastatin) at 24 and 48 h
ATO/Simvastatin induces subG1/G1 arrest in PC3 and LNCaP cells
Cell cycle flow cytometry analysis was applied for PC3 and LNCaP cells treated with ATO and Simvastatin and their combination with respect to inducing cell cycle arrest (Figure 5). Among the control LNCaP cells, cells in stages sub‐G1, G1, S and G2 accounted for 4.69%, 50.98%, 34.01% and 10.32% of the total cell population respectively. The Simvastatin therapy resulted in increase in sub‐G1 cells (4.69%–27.33%) and decrease in G1 (50.98%–49.25%), S (34.01%–13.17%) and G2 (10.32%–10.25%) cells. Additionally, treatment with ATO resulted in the elevation of sub‐G1 cells (4.69%–19.58%) and reduction of cells in G1 (50.98%–43.95%), S (34.01%–30.61%) and G2 (10.32%–5.86%) phases. The combination therapy of Simvastatin and ATO led to a more prominent rise in sub‐G1 cells (4.69%–32.35%) and a subsequent decrease in G1, S and G2 cells.
FIGURE 5
Cell cycle analysis of LNCaP and PC3 cell lines. (A) LNCaP cell untreated and treated with Simvastatin, ATO, and a combination of ATO and Simvastatin. (B) PC3 cell untreated and treated with Simvastatin, ATO and a combination of ATO and Simvastatin. DNA content of LNCaP and PC3 cells evaluated after treatment with ATO and Simvastatin and their combination by PI staining. According to the cell cycle analysis, we detected G1 area increased in LNCaP and PC3 cells when treated with ATO and Simvastatin and their combination. The percentages of cells at the G2 phase were concurrently reduced in all treated cells. Therefore, it appears that ATO, Simvastatin and their combination induce sub G1/G1 arrest in both LNCaP and PC3 cell lines
Cell cycle analysis of LNCaP and PC3 cell lines. (A) LNCaP cell untreated and treated with Simvastatin, ATO, and a combination of ATO and Simvastatin. (B) PC3 cell untreated and treated with Simvastatin, ATO and a combination of ATO and Simvastatin. DNA content of LNCaP and PC3 cells evaluated after treatment with ATO and Simvastatin and their combination by PI staining. According to the cell cycle analysis, we detected G1 area increased in LNCaP and PC3 cells when treated with ATO and Simvastatin and their combination. The percentages of cells at the G2 phase were concurrently reduced in all treated cells. Therefore, it appears that ATO, Simvastatin and their combination induce sub G1/G1 arrest in both LNCaP and PC3 cell linesThe results regarding the PC3 cells were similar with an increase in sub‐G1 phase cells following the administration of Simvastatin (3.73%–15.61%), ATO (3.73%–25.89%) and their combination (3.73%–36.50%), alongside the decline in the following cell cycle phases.The results revealed that the cells treated with ATO and Simvastatin significantly stopped the cell cycle in the sub‐G1/G1 phase compared with the control group. Moreover, the presence of this sub‐G1 peak after the drug therapy was indicative of increased apoptosis.
Effects of ATO and Simvastatin on the nucleus of PC3 and LNCaP cell lines
The results of the Hoechst 33342 fluorescent dye are displayed in Figure 6. The nuclei of the control group showed blue fluorescence. After treatment with ATO or Simvastatin, noticeable changes in the nuclei morphology were observed. Many nuclei split and disintegrated after the cells were treated with 12 μM Simvastatin/8 μM ATO for PC3 and, 8 μM Simvastatin/5 μM ATO for LNCaP cell. As a result, the nuclear contents were dispersed. In addition, apoptosis features were observed under a fluorescent microscope (Figure 6).
FIGURE 6
Hoechst dye (33342) Staining. As seen in the above image, LNCap cell lines treated with 5 μM ATO and 8 μM Simvastatin after 48 h (B) compared with control LNCap cells (A), there are fragmented nuclei cells that designate apoptotic cell, which is clearly within the cell (B1‐4). Cell migration assays in prostate cancer PC3 and LNCap cell lines control (C), treated with Simvastatin or ATO (D) and combined Simvastatin and ATO (E). Cells were photographed with 40 magnifications at different time points
Hoechst dye (33342) Staining. As seen in the above image, LNCap cell lines treated with 5 μM ATO and 8 μM Simvastatin after 48 h (B) compared with control LNCap cells (A), there are fragmented nuclei cells that designate apoptotic cell, which is clearly within the cell (B1‐4). Cell migration assays in prostate cancer PC3 and LNCap cell lines control (C), treated with Simvastatin or ATO (D) and combined Simvastatin and ATO (E). Cells were photographed with 40 magnifications at different time points
Effects of ATO and Simvastatin on the migration of the prostate cancer cells
The results of the migration assay are shown in Figure 6. As shown in Figure 6, ATO and Simvastatin have dramatically inhibited the migration of prostate cancer cells after the cells were treated with 8 μM ATO/12 μM Simvastatin for PC3 cell line and, 5 μM ATO/8 μM Simvastatin for LNCaP cell line. However, in the control group, the space created between the cells is completely filled.
Effect of Simvastatin and ATO on gene expression levels in LNCaP and PC3 cells
LNCaP and PC3 cells were treated with Simvastatin and ATO for 48h and then examined for Osteopontin (OPN) isoforms and angiogenesis genes (vascular endothelial growth factor (VEGF) A and C) and apoptosis genes (Bcl‐2, BAX, P53 and PTEN) expression by Real‐Time PCR.ATO and Simvastatin had a synergistic apoptotic effect on LNCaP and PC3 cells by up‐regulation of P53/PTEN and down‐regulation of the BAX/Bcl‐2 (Figure 7); hence, ATO may act as a potential anticancer agent against LNCaP and PC3 cells through triggering the mitochondrial pathway of apoptosis.
FIGURE 7
Results of LNCaP and PC3 cells treated with Simvastatin and ATO and their combination on gene expression for 48 h. Values are given as mean ± SD of three independent experiments. Statistical significance was defined at *p < 0.05, **p < 0.01, and ***p < 0.001 compared with the corresponding control
Results of LNCaP and PC3 cells treated with Simvastatin and ATO and their combination on gene expression for 48 h. Values are given as mean ± SD of three independent experiments. Statistical significance was defined at *p < 0.05, **p < 0.01, and ***p < 0.001 compared with the corresponding controlATO and Simvastatin each alone increase BAX and decrease Bcl‐2 expression, and this effect is significantly increased in combination therapy (Figure 7). Likewise, BAX/Bcl‐2 ratio in combination therapy was significantly higher than the treatment by ATO or Simvastatin alone (Figure 7).Our data showed that Simvastatin (an HMG‐CoA reductase inhibitor) as a natural element for inhibition of OPN significantly decreased OPN gene three isoforms expression in treated groups in both LNCaP and PC3 cell lines (Figure 7). In addition, we observed that in response to treatment with ATO and Simvastatin alone and combination of these two drugs, the expression level of OPN isoforms, VEGF isoforms, and Bcl‐2 genes was decreased compared with untreated cells; whereas P53, PTEN and BAX genes had a significant increase in expression in both LNCaP and PC3 cell lines (Figure 7).
DISCUSSION
This study investigated the therapeutic effects of ATO, Simvastatin and their combination in androgen‐dependent and androgen‐independent cell lines of PCa. Our findings showed that a combination of these two agents could effectively inhibit neoplastic cell proliferation and induce apoptosis, possibly through alterations in the expression of apoptotic genes and regulation of the pro‐angiogenic pathways. These results propose a novel combination regimen for managing prostate malignancies, especially for advanced tumours irresponsive to anti‐androgen therapy.Concerning PCa proliferation, ATO has been determined to contribute to malignant cell death via enhancement of apoptosis.
,
,
,
,
,
Although the exact mechanisms involved in ATO‐induced apoptosis in solid tumours have yet to be ascertained, several cellular processes have been suggested. For example, generation of reactive oxygen species (ROS),
inhibition of Akt/mTOR signalling pathway
and activation of p38/caspase 3
are among several cellular mechanisms identified in apoptosis of PCa cells after ATO administration. In addition, statins have been determined to regulate PCa growth via the regulation of numerous cellular mechanisms, for example decrease in Akt activity,
,
reduction in intratumoral androgen by lowering cholesterol levels
and activation of specific proteases involved in apoptosis.Our findings demonstrated that these two drugs and their combination could inhibit proliferation and enhance apoptosis of PCa cells. Furthermore, we observed that this process is mediated via sub G1/G1 cell cycle arrest. Similar to our results, Jadhav et al. previously showed that nanoparticulate formulation of ATO can induce caspase‐dependent apoptosis, along with G0‐G1 and G2‐M phase arrest in LNCaP and PC3 cell lines respectively.
Additionally, Hoque et al. described that Simvastatin and Lovastatin diminish the cell viability of both androgen‐sensitive and androgen‐insensitive PCa cells, trigger apoptosis and lead to arrest in the G1 phase.Deng J et al examined that Simvastatin and fluvastatin can promote apoptosis and reduce viable and cell proliferation via AKT/FOXO1 signalling pathway
and inhibition of MCL‐1 studied by Alqudah et al. (2018). Chen et al. (2017) investigated that irinotecan with simvastatin
in PC3 and DU145 prostate cancer cell lines and in another study Atorvastatin alone inhibit the expression of HIF‐1α protein level and increase hypoxia‐induced prostate cancer cells.
Wang et al. (2020), considered that The combination of caffeine and atorvastatin suppressed tumour spheres, invasion, migration, proliferation and prompted apoptotic via downregulating phosphorylated Akt, phosphorylated Erk1/2, Bcl‐2 and Survivin protein levels.
In another research, Zheng et al. (2010), showed that celecoxib with atorvastatin suppressed tumour progression and Akt, Erk1/2 and NF‐κB expression in prostate cancer cell.
Kochuparambil et al. (2011), confirmed that Simvastatin has anticancer effectiveness on prostate cancer cells and reduced prostate‐specific antigen expression and inhibit the Akt expression.
Rosuvastatin, mevastatin, simvastatin and atorvastatin decrease the migration and colony formation of metastatic prostate colonies of PC‐3 cells via preventing production of geranylgeranyl pyrophosphate.These antitumor properties of ATO and statins are mainly due to boosted caspase enzymatic activity and suppressed expression of cyclins.
,
The findings of our study combined with previous reports suggest that combination therapy with ATO and Simvastatin can prevent PCa cell proliferation via cell cycle arrest and increased apoptosis. More importantly, these results were achieved with 5µM and 8µM of ATO in LNCaP and PC3 cells, respectively, which are comparable to the previous reports and considered an acceptable dose for in vivo parental administration.
,ATO has been described as an effective anticancer and FDA‐approved drug for treating some cancers. Our results presented a significant reduction in the survival of the LNCaP and PC3 cells in ATO/Simvastatin‐treated groups. As estimated, cell survival was much less in combination treatment than treatment with only Simvastatin or ATO. The results show that ATO and Simvastatin worked additively in inducing cell death and inhibiting LNCaP and PC3 cell proliferation. In addition, the results suggest that combination treatment increases programmed cell death, possibly by enhancing the internal pathway of apoptosis.To evaluate the possible mechanism of apoptosis induced by the two drugs, we evaluated the expression of apoptotic (BAX) and anti‐apoptotic (Bcl‐2) genes, and their ratio was considered an indicator of mitochondrial apoptosis response to the drug. We observed downregulated expression of anti‐apoptotic Bcl‐2 and upregulation of pro‐apoptotic BAX gene, following treatment with ATO, Simvastatin and their combination. This gene expression alteration is associated with the expression of cyclin‐dependent kinase inhibitor p21, resulting in increased apoptosis.
Similar findings have been identified after ATO therapy in other solid tumours, such as hepatocellular carcinoma,
glioma
and breast cancer.
In addition, Simvastatin has been determined to induce the same apoptotic features in cell lines of numerous malignancies, including breast cancer, lung cancer and gastric carcinoma.
,
The proteins of the Bcl‐2 family are involved in programmed cell death through the modulation of mitochondrial function.
In fact, changes in the electrical potential of mitochondria under different physiological and pathological processes can lead to the release of apoptotic proteins, for instance, pro‐caspases 2, 3 and 9.ROS generation is postulated to play a pivotal role in mitochondrial oxidative damage, subsequently leading to apoptosis.
In this manner, Bcl‐2 employs an anti‐apoptotic function via a decrease in cellular ROS.
Thus, downregulation of Bcl‐2 accompanied by the overexpression of BAX favours mitochondrial‐mediated apoptosis, resulting from intracellular ROS accumulation. On the other hand, BAX and Bcl‐2 are two widely known transcriptional targets of the P53 protein, a tumour suppressor protein in charge of apoptosis and cell cycle arrest in case of DNA damage.
In this study, the expression of P53 was upregulated in LNCaP and PC3 cells after therapy with ATO, Simvastatin and their combination, which provides further evidence for increased apoptosis in PCa following this novel regimen.Moreover, we detected increased expression of the PTEN, a tumour suppressor regulating the PI3K/Akt/mTOR pathway, following treatment with ATO and Simvastatin. The PTEN exerts pro‐apoptotic features by several pathways, such as sensitization of PCa cells to death‐receptor mediated apoptosis
and augmentation of serum starvation‐induced apoptosis via inhibition of insulin‐like growth factor 1 receptor synthesis.
Taken together, the increased expression of BAX, P53, and PTEN alongside the decreased Bcl‐2 expression are all in favour of apoptosis and diminished proliferation of PCa cells.The results of our previous study showed that ATO and flutamide increase the antitumor effect on both prostate cancer cell lines. That study also showed ATO decreases VEGF expression alongside reducing the expression of two genes, KLK2 and Snail (prostate cancer biomarker). This gene expression effect was increased when ATO was combined with flutamide.In addition to the genes involved in apoptosis, we explored two important regulators of angiogenesis (VEGF and OPN). As one of the most potent pro‐angiogenic factors with two isoforms (A and C), VEGF is involved in microvascular remodelling, angiogenesis, and subsequently, metastasis and progression of PCa.
Furthermore, OPN, an integrin‐binding glycophosphoprotein in the extracellular matrix (with three A, B and C isoforms), can be secreted from malignant cells to increase their metastatic ability by regulating their metastatic capacity, VEGF production and angiogenesis.
Based on gene expression analysis, we detected a significant reduction in the expression of OPN and VEGF isoforms in both LNCaP and PC3 cells after administration of ATO, Simvastatin and their combination.These findings provide new insight into the anti‐angiogenic properties of these two drugs in PCa. Previously, Ji et al. have described that ATO can function as an anti‐angiogenic agent in PCa by inhibition of TGF‐β/SMAD pathway, which is crucial in VEGF secretion.
Also, our results align with the study by Al‐Husein et al. that indicated a reduction in VEGF‐A in PC3 cells following Simvastatin therapy, abrogating the endothelial barrier disruption.
Besides, Matsuura et al. detected that Simvastatin could provide anticancer effects via a reduction in OPN expression both in vitro and in vivo models.
All in all, ATO and Simvastatin treatment may provide anti‐angiogenic and anti‐proliferative properties in PCa.In conclusion, the findings of this study showed that ATO, Simvastatin and their combination exert anti‐neoplastic functions in PCa, possibly by overexpression of pro‐apoptotic BAX, P53, PTEN genes and downregulation of anti‐apoptotic Bcl‐2 gene. Moreover, these two agents can provide anti‐proliferative and anti‐angiogenic properties by reducing VEGF and OPN genes. These results provide new perceptions regarding ATO and Simvastatin's combination therapy in PCa, which requires further investigation in animal models and human clinical trials.
CONFLICTS OF INTEREST
All authors claim that there is not any potential competing or conflict of interest.
AUTHOR CONTRIBUTIONS
Akram Mirzaei: Methodology (supporting); Writing – original draft (lead). Sina Rashedi: Investigation (supporting). Mohammad Reza Akbari: Resources (supporting); Validation (supporting). Fatemeh Khatami: Data curation (supporting); Supervision (supporting). Seyed Mohammad Kazem Aghamir: Conceptualization (lead).
Authors: Mahmoud A Alfaqih; Emma H Allott; Robert J Hamilton; Michael R Freeman; Stephen J Freedland Journal: Nat Rev Urol Date: 2016-10-25 Impact factor: 14.432
Authors: Z X Shen; G Q Chen; J H Ni; X S Li; S M Xiong; Q Y Qiu; J Zhu; W Tang; G L Sun; K Q Yang; Y Chen; L Zhou; Z W Fang; Y T Wang; J Ma; P Zhang; T D Zhang; S J Chen; Z Chen; Z Y Wang Journal: Blood Date: 1997-05-01 Impact factor: 22.113
Authors: Robert J Hamilton; Kenneth C Goldberg; Elizabeth A Platz; Stephen J Freedland Journal: J Natl Cancer Inst Date: 2008-10-28 Impact factor: 13.506
Authors: Elahe A Mostaghel; Keith R Solomon; Kristine Pelton; Michael R Freeman; R Bruce Montgomery Journal: PLoS One Date: 2012-01-18 Impact factor: 3.240