Literature DB >> 35365624

The impact of autophagy modulation on phenotype and survival of cardiac stromal cells under metabolic stress.

Isotta Chimenti1,2, Vittorio Picchio3, Francesca Pagano4, Leonardo Schirone3,5, Sonia Schiavon3, Luca D'Ambrosio3, Valentina Valenti6, Maurizio Forte7, Flavio di Nonno7, Speranza Rubattu7,8, Mariangela Peruzzi9,5, Francesco Versaci6,10, Ernesto Greco5, Antonella Calogero3, Elena De Falco3,9, Giacomo Frati3,7, Sebastiano Sciarretta3,7.   

Abstract

Cardiac stromal cells (CSCs) embrace multiple phenotypes and are a contributory factor in tissue homeostasis and repair. They can be exploited as therapeutic mediators against cardiac fibrosis and remodeling, but their survival and cardioprotective properties can be decreased by microenvironmental cues. We evaluated the impact of autophagy modulation by different pharmacological/genetic approaches on the viability and phenotype of murine CSCs, which had been subjected to nutrient deprivation or hyperglycemia, in order to mimic relevant stress conditions and risk factors of cardiovascular diseases. Our results show that autophagy is activated in CSCs by nutrient deprivation, and that autophagy induction by trehalose or autophagy-related protein 7 (ATG7)-overexpression can significantly preserve CSC viability. Furthermore, autophagy induction is associated with a higher proportion of primitive, non-activated stem cell antigen 1 (Sca1)-positive cells, and with a reduced fibrotic fraction (positive for the discoidin domain-containing receptor 2, DDR2) in the CSC pool after nutrient deprivation. Hyperglycemia, on the other hand, is associated with reduced autophagic flux in CSCs, and with a significant reduction in primitive Sca1+ cells. Autophagy induction by adenoviral-mediated ATG7-overexpression maintains a cardioprotective, anti-inflammatory and pro-angiogenic paracrine profile of CSCs exposed to hyperglycemia for 1 week. Finally, autophagy induction by ATG7-overexpression during hyperglycemia can significantly preserve cell viability in CSCs, which were subsequently exposed to nutrient deprivation, reducing hyperglycemia-induced impairment of cell resistance to stress. In conclusion, our results show that autophagy stimulation preserves CSC viability and function in response to metabolic stressors, suggesting that it may boost the beneficial functions of CSCs in cardiac repair mechanisms.
© 2022. The Author(s).

Entities:  

Year:  2022        PMID: 35365624      PMCID: PMC8975847          DOI: 10.1038/s41420-022-00924-7

Source DB:  PubMed          Journal:  Cell Death Discov        ISSN: 2058-7716


Introduction

Chronic maladaptive remodelling and progressive heart failure (HF) [1] represent life-threatening terminal conditions characterized by cardiomyocyte death, fibrosis, and remodelling [2, 3]. Nowadays, despite multiple advances in medical treatments and prognoses, valid options for end-stage HF patients are heart transplantation and left ventricular assist device implantation [4, 5]. However, these therapies are often limited by organ availability and several clinical complications [6]. Therefore, new therapeutic strategies against HF progression are needed in order to reduce its incidence and morbidity. The progression of the disease after acute myocardial infarction (MI) includes cardiomyocyte death by necrosis [7] and apoptosis [8], followed by scar formation caused by collagen-depositing interstitial cells to prevent heart rupture [9, 10]. Interstitial and stromal myocardial cells embrace a variety of phenotypes and functional states [11, 12], e.g. endothelial cells, fibroblasts and myofibroblasts [13, 14], telocytes [15], pericytes [16], mesenchymal-like cells [17], and immune cells [18], and play a primary role in cardiac homeostasis and repair after injury. Among resident stromal cells, a population of primitive cardiac stromal cells (CSCs) is discernible in the adult mammalian heart [19]. CSCs can be derived from myocardial tissue, and selected for a primitive non-activated phenotype by the spontaneous capacity to grow as 3D spheroids on a permissive substrate [20]. CSCs affect tissue architecture and the microenvironment [21], participate in tissue repair, and can be used as a therapeutic cell product [22, 23]. In fact, it was shown that in vivo transplantation of human primitive CSCs in the peri-infarct zone of a SCID-murine model of MI can have a positive effect on infarct size, cell death, and tissue revascularization [24]. This beneficial effect is largely due to paracrine mechanisms, i.e. release of diffusible molecules and vesicles with cardioprotective, pro-angiogenic, and anti-inflammatory properties [25-27]. These benefits on tissue repair, however, depend on specific features of CSCs. In fact, myocardial remodelling and cardiovascular risk factors, such as diabetes [28], may lead to pro-fibrotic polarization and loss of the reparative potential of CSCs [29, 30], with impaired paracrine potency [31-33]. Overall, the health status, comorbidities, and ongoing therapies of a patient can strongly affect the phenotype of CSCs [30–32, 34], and in this way their direct and indirect contribution to fibrosis and remodelling. Moreover, the survival of CSCs with a beneficial pro-repair phenotype after MI or during HF progression may be significantly affected by stress conditions, including nutrient deprivation in the ischemic and inflammatory milieu, or metabolic derangements [35]. For all the above reasons, CSCs can be considered targets for regenerative medicine approaches. Their survival in the damaged myocardium, as well as their reparative phenotype, represent important features to be considered and preserved for novel therapeutic strategies designed to counteract fibrosis and HF progression. We hypothesized that, among other mechanisms, autophagy modulation may affect CSC survival and phenotype in response to stress. In fact, autophagy is a dynamic process involving degradation of damaged intracellular components and recycling of molecules useful for cell metabolism. Specific proteins, such as autophagy-related protein 7 (ATG7) and microtubule-associated proteins 1 A/1B light chain 3B (LC3-II), are involved in autophagy initiation, sustaining membrane nucleation and autophagosome formation [36]. It is noted that autophagy was reported to be dysregulated in patients with heart diseases or dysmetabolic conditions [37], while pharmacological activation of autophagy was shown to attenuate ischemic injury and postischemic chronic remodelling [38, 39]. Notwithstanding, the role of autophagy in CSC biology is still unclear. The present study investigates the effects of autophagy modulation in CSCs when subjected to metabolic stress conditions, mimicking endogenous derangements associated with ischaemic injury (e.g. nutrient deprivation) and/or altered metabolism (e.g. hyperglycemia). We assayed CSCs for their viability and phenotype, and assessed whether autophagy activation can preserve a beneficial and protective paracrine profile in response to stress.

Results

CSC characterization

CSCs were isolated from primary explant cultures of C57BL6/J murine hearts, and selected through spontaneous spheroid formation for a primitive non-activated phenotype [40, 41]. To validate these features in our conditions, we tested isolated CSCs for clonogenic efficiency, which is a feature of undifferentiated phenotypes [40], and found a mean value of 64.7±7.3% (Fig. 1A, B). We also assessed their phenotype by immunofluorescence staining (Fig. 1C, D), and confirmed that 2.0±0.7% were positive for the differentiation marker troponin I (TnI) and 14.4±3.6% for smooth muscle actin (SMA) [42]. Moreover, cells were largely positive for the cardiac transcription factors GATA4 and Nkx2.5, in line with previous reports [43-45]. In addition, we characterized CSCs for surface marker expression using flow cytometry. We designed a panel to screen for the presence of contaminating haematopoietic or mature endothelial cells, and to better dissect possible phenotypic shifts in the CSC stromal population. Flow cytometry analysis at basal conditions (Fig. 1E, Supplementary fig. 1A) showed that isolated CSCs express very low levels of CD45 and Flk1 markers, consistent with a non-hematopoietic and non-endothelial lineage. Moreover, 66.7±2.2% of cells are positive for the primitive stromal marker stem cell antigen 1 (Sca1, which is associated with a non-activated primitive phenotype in situ) [12, 46], 56.7±8.9% are positive for the mesenchymal marker CD90, and 15.8±5.5 are positive for the mature/activated cardiac fibroblast marker discoidin domain-containing receptor 2 (DDR2) (Fig. 1F). In all the following experiments, we gated on the CD45-/Flk1- population (95.8±3.2% of total events), and used the DDR2 marker to quantify a differentiated myofibroblast population [47, 48]. Furthermore, analysis of the CD45-/Flk1-/Sca1+ population showed that in our conditions Sca1 and DDR2 are mutually exclusive (Fig. 1G, Supplementary Fig. 1B), and that 45.5±4.4% of the Sca1+ CSCs are also positive for CD90, consistent with a mesenchymal primitive phenotype (Sca+/CD90+/DDR2-).
Fig. 1

CSC characterization.

A Representative microscopy image of a fixed GIEMSA-stained CSC colony. Scale bar=500 µm. B Quantification of clonogenic efficiency (n=6). C Quantification of positive cells (n=5), and representative immunofluorescence panels (D) for selected cardiac markers (GATA4, Nkx2.5, TnI, SMA). Arrows indicate positive nuclei. Scale bars=20 µm. E Quantification of single marker positivity by flow cytometry analysis of the whole CSC population (n=5). F Conceptual scheme of the association among the Sca1, CD90, and DDR2 markers with corresponding phenotypes. G Quantification by flow cytometry of the percentage of CD90 or DDR2 cells among the CD45-/Flk1-/Sca1+ population (n=3).

CSC characterization.

A Representative microscopy image of a fixed GIEMSA-stained CSC colony. Scale bar=500 µm. B Quantification of clonogenic efficiency (n=6). C Quantification of positive cells (n=5), and representative immunofluorescence panels (D) for selected cardiac markers (GATA4, Nkx2.5, TnI, SMA). Arrows indicate positive nuclei. Scale bars=20 µm. E Quantification of single marker positivity by flow cytometry analysis of the whole CSC population (n=5). F Conceptual scheme of the association among the Sca1, CD90, and DDR2 markers with corresponding phenotypes. G Quantification by flow cytometry of the percentage of CD90 or DDR2 cells among the CD45-/Flk1-/Sca1+ population (n=3).

Autophagy is activated in CSCs in response to nutrient deprivation

Autophagy activation was confirmed in CSCs which were acutely subjected to 4 hours of nutrient deprivation (0.1% FBS, 0 mM glucose). Western blot analysis showed increased LC3-II, ATG5 and ATG7 protein levels under this stress condition, as compared to control (Fig. 2A, B). To define whether the observed increase in LC3-II protein levels was caused by increased autophagosome formation rather than decreased lysosome degradation, the lysosomal inhibitor bafilomycin A1 (BAF) was used. Treatment with 100 nM BAF showed LC3-II accumulation in cells which had been cultured both under normal conditions and in nutrient deprivation, with higher levels in starved cells (Fig. 2C, D). This result confirmed that the different levels of LC3-II protein were in fact due to higher autophagosome formation, and not to reduced degradation. Furthermore, autophagy activation in CSCs under nutrient deprivation was confirmed by ad-mRFP-GFP-LC3 transduction and fluorescent dots quantification, highlighting a significant increase in the number of autophagosomes, as compared to control (Fig. 2E, F).
Fig. 2

Autophagy is activated in CSCs in response to nutrient deprivation.

Representative WB panels (A) of LC3-II, ATG5 and ATG7 protein levels, and corresponding densitometric analysis (B) after 4 hours of nutrient deprivation (0.1% FBS, 0 mM glucose) (n=3). Representative panels (C) and relative quantification of LC3-II (D) with or without concomitant treatment for 2 hours with 100 nM bafilomycin A1 (BAF) are also shown (n=3). E Representative fluorescence microscopy images of Ad-mRFP-GFP-LC3 transduced cells, exposed for 4 hours either to nutrient deprivation or control media (5 mM glucose), with corresponding quantification of the number of mRFP+/GFP+ autophagosomes per cell surface area (F). Scale bars=20 µm. *P<0.05, **P<0.01, ***P<0.001.

Autophagy is activated in CSCs in response to nutrient deprivation.

Representative WB panels (A) of LC3-II, ATG5 and ATG7 protein levels, and corresponding densitometric analysis (B) after 4 hours of nutrient deprivation (0.1% FBS, 0 mM glucose) (n=3). Representative panels (C) and relative quantification of LC3-II (D) with or without concomitant treatment for 2 hours with 100 nM bafilomycin A1 (BAF) are also shown (n=3). E Representative fluorescence microscopy images of Ad-mRFP-GFP-LC3 transduced cells, exposed for 4 hours either to nutrient deprivation or control media (5 mM glucose), with corresponding quantification of the number of mRFP+/GFP+ autophagosomes per cell surface area (F). Scale bars=20 µm. *P<0.05, **P<0.01, ***P<0.001.

Autophagy stimulation reduces apoptosis in starved CSCs

We then investigated whether autophagy activation improves CSC survival in response to prolonged nutrient deprivation (up to 32 hours), which mimics the microenvironment features of the ischemic myocardium. Consolidated autophagy modulation tools were tested and optimized in our system. In particular, we either performed a 24 hour pretreatment with 50 mM of trehalose (TRE), a pharmacological autophagy activator, or overexpressed ATG7 (i.e. an initiator of macroautophagy) by adenovirus transduction (ad-ATG7) 48 hours before starvation to activate autophagy; in parallel we designed an RNA-interference approach to switch off autophagy through ATG7-knock down (Fig. 3A). We previously observed that 24 hours of TRE treatment significantly increases LC3-II protein levels, ATG7 mRNA expression, and the number of autophagosomes in CSCs, as compared with untreated controls (Supplementary Fig. 2). Similarly, both ATG7 mRNA and protein levels were significantly upregulated 48 hours after infection with ad-ATG7, as well as LC3-II protein, with respect to ad-LacZ control (Supplementary Fig. 3). Conversely, transfection of an ATG7-targeting small interference RNA (si-ATG7) significantly reduced ATG7 mRNA levels, and ATG7 and LC3-II protein levels after 48 hours, as compared with scramble (Scr) control (Supplementary fig. 4).
Fig. 3

Autophagy stimulation reduces apoptosis in starved CSCs.

A Experimental timeline and design for autophagy modulation and cell viability assessment. B Representative contour plot of the positive control of apoptotic induction. Representative flow cytometry density plots (C) and relative quantification (D) of early (Annexin-V+/7AAD-) and late (Annexin-V+/7AAD+) apoptotic CSCs after 32 hours of nutrient deprivation (0.1% FBS, 0 mM glucose), with or without pretreatment with 50 mM trehalose (TRE) for 24 hours (n=8); corresponding WB panel for cleaved caspase 3 is shown in paneI (E). Representative flow cytometry density plots (F) and relative quantification (G) of early and late apoptotic cells after 32 hours of nutrient deprivation in CSCs that were previously transduced with ad-ATG7 or ad-LacZ 48 hours before stress (n=7); corresponding WB panel for cleaved caspase 3 is shown in panel (H). Representative flow cytometry density plots (I) and relative quantification (J) of early and late apoptosis after 32 hours of nutrient deprivation in CSCs that were pre-treated with si-ATG7 or scramble control (Scr) transfection 48 hours before stress (n=7); corresponding WB panel for cleaved caspase 3 is shown in panel (K). *P<0.05, **P<0.01, ***P<0.001.

Autophagy stimulation reduces apoptosis in starved CSCs.

A Experimental timeline and design for autophagy modulation and cell viability assessment. B Representative contour plot of the positive control of apoptotic induction. Representative flow cytometry density plots (C) and relative quantification (D) of early (Annexin-V+/7AAD-) and late (Annexin-V+/7AAD+) apoptotic CSCs after 32 hours of nutrient deprivation (0.1% FBS, 0 mM glucose), with or without pretreatment with 50 mM trehalose (TRE) for 24 hours (n=8); corresponding WB panel for cleaved caspase 3 is shown in paneI (E). Representative flow cytometry density plots (F) and relative quantification (G) of early and late apoptotic cells after 32 hours of nutrient deprivation in CSCs that were previously transduced with ad-ATG7 or ad-LacZ 48 hours before stress (n=7); corresponding WB panel for cleaved caspase 3 is shown in panel (H). Representative flow cytometry density plots (I) and relative quantification (J) of early and late apoptosis after 32 hours of nutrient deprivation in CSCs that were pre-treated with si-ATG7 or scramble control (Scr) transfection 48 hours before stress (n=7); corresponding WB panel for cleaved caspase 3 is shown in panel (K). *P<0.05, **P<0.01, ***P<0.001. The autophagic response in CSCs was thus strengthened by either pretreatment with 50 mM of TRE or Ad-ATG7 transduction, before nutrient deprivation stress (32 hours, 0.1% FBS, 0 mM glucose) (Fig. 3A). Annexin-V/7AAD labelling by flow cytometry analysis was used to quantify early (Annexin-V+/7AAD-) and late (Annexin-V+/7AAD+) apoptotic cells, and caspase 3 cleavage was also assessed by WB. A positive apoptotic control sample was also considered (Fig. 3B). Flow cytometry analysis showed that TRE pre-treatment significantly reduced both early and late apoptosis after nutrient deprivation stress in CSCs (Fig. 3C, D). This effect was confirmed by decreased levels of caspase 3 cleavage (Fig. 3E). Similarly, ATG7 overexpression significantly reduced late apoptosis after stress (Fig. 3F, G), and reduced cleaved caspase 3 levels (Fig. 3H). Conversely, autophagy inhibition by si-ATG7 transfection significantly increased the proportion of both early and late apoptotic cells after 32 hours of nutrient deprivation, as compared with Scr control (Fig. 3I, J), with a consistent increase in caspase 3 cleavage (Fig. 3K).

Autophagy stimulation enriches the primitive fraction of CSCs

We then checked whether autophagy stimulation affects the relative cell-type composition within the CSC population by the use of flow cytometry to evaluate the surface marker expression (Fig. 1E, F). While Ad-ATG7 transduction and si-ATG7 transfection did not modulate CSC immunophenotype after 32 hours of nutrient deprivation (Supplementary Fig. 5), TRE pre-treatment, on the other hand, preserved a significantly higher proportion of Sca1+ cells after stress, including the Sca1+/CD90+/DDR2- primitive mesenchymal fraction (Fig. 4A, B). By contrast, the proportion of DDR2+ fibroblast-like cells (including the Sca1-/CD90-/DDR2+ subpopulation) was significantly reduced after nutrient deprivation stress in TRE-treated CSCs, as compared to controls (Fig. 4C, D). These results, together with the above-mentioned outcome on cell viability, suggest that TRE may be more effective than ad-ATG7 in activating autophagy in CSCs under our conditions, albeit a direct comparison is not feasible given the different nature of the two stimuli.
Fig. 4

Autophagy stimulation enriches CSCs with primitive mesenchymal cells.

Normalized quantification by flow cytometry of the CD45-/Flk1-/Sca1+ population (A), the Sca1+/CD90+/DDR2- mesenchymal primitive subpopulation (B), the whole CD45-/Flk1-/DDR2+ fibroblast-like fraction (C), and of the Sca1-/CD90-/DDR2+ subpopulation (D) in CSCs after 32 hours of nutrient deprivation stress, with or without pretreatment with 50 mM trehalose (TRE) for 24 hours (n=8). *P<0.05, **P<0.01.

Autophagy stimulation enriches CSCs with primitive mesenchymal cells.

Normalized quantification by flow cytometry of the CD45-/Flk1-/Sca1+ population (A), the Sca1+/CD90+/DDR2- mesenchymal primitive subpopulation (B), the whole CD45-/Flk1-/DDR2+ fibroblast-like fraction (C), and of the Sca1-/CD90-/DDR2+ subpopulation (D) in CSCs after 32 hours of nutrient deprivation stress, with or without pretreatment with 50 mM trehalose (TRE) for 24 hours (n=8). *P<0.05, **P<0.01.

Autophagy is reduced in CSCs exposed to hyperglycemia

CSC autophagy, viability, and immunophenotype were then investigated after exposure to high glucose (50 mM) to mirror the clinically detrimental condition of hyperglycemia. This latter is associated with several cardiovascular risk conditions and comorbidities (e.g. metabolic syndrome, diabetes), and it is known to impair autophagy [49]. CSCs were cultured in 50 mM of glucose for 24 hours. We found that LC3-II, ATG5 and ATG7 protein levels were significantly reduced in hyperglycemic conditions (Fig. 5A, B), as well as ATG7 mRNA expression (Fig. 5C). To demonstrate that the downregulation of LC3-II protein was caused by a decrease in autophagosome formation rather than increased autophagic flux, BAF treatment was performed in addition to high-glucose stress. We observed that hyperglycemia reduced LC3-II level both in the presence or the absence of BAF treatment (Fig. 5D, E). Autophagy reduction by hyperglycemia was also confirmed by ad-mRFP-GFP-LC3 transduction and fluorescent dots quantification, highlighting a significant reduction in the number of autophagosomes in CSCs exposed to high glucose versus control (Fig. 5F, G). CSC viability (evaluated by Annexin V/7AAD labelling) was not affected by hyperglycemia, up to one week (Supplementary Fig. 6A).
Fig. 5

Autophagy is reduced in CSCs exposed to high-glucose concentration.

Representative WB panels (A) and relative densitometric quantification (B) of LC3-II (n=8), ATG5, and ATG7 protein expression after exposure for 24 h to 5 mM or 50 mM glucose (n=3). C ATG7 mRNA expression levels after 24 h of culture in 5 mM or 50 mM glucose (n=5). Representative WB panels (D) and relative densitometric quantification (E) of LC3-II expression profile after 24 h of exposure to 50 mM glucose, with or without treatment for 2 hours with 100 nM bafilomycin A1 (BAF) (n=4). LC3-I and II panel is displayed twice with different exposure times, for the optimized detection of the two bands (higher exposure, top panel; lower exposure, lower panel). F Representative fluorescence microscopy images of Ad-mRFP-GFP-LC3 transduced cells, exposed for 24 h to 50 mM glucose or 5 mM glucose as control. G Corresponding quantification of the number of mRFP+/GFP+ autophagosomes per cell surface area in 50 mM glucose or 5 mM control (n=3). Scale bars=20 µm. *P<0.05, **P<0.01.

Autophagy is reduced in CSCs exposed to high-glucose concentration.

Representative WB panels (A) and relative densitometric quantification (B) of LC3-II (n=8), ATG5, and ATG7 protein expression after exposure for 24 h to 5 mM or 50 mM glucose (n=3). C ATG7 mRNA expression levels after 24 h of culture in 5 mM or 50 mM glucose (n=5). Representative WB panels (D) and relative densitometric quantification (E) of LC3-II expression profile after 24 h of exposure to 50 mM glucose, with or without treatment for 2 hours with 100 nM bafilomycin A1 (BAF) (n=4). LC3-I and II panel is displayed twice with different exposure times, for the optimized detection of the two bands (higher exposure, top panel; lower exposure, lower panel). F Representative fluorescence microscopy images of Ad-mRFP-GFP-LC3 transduced cells, exposed for 24 h to 50 mM glucose or 5 mM glucose as control. G Corresponding quantification of the number of mRFP+/GFP+ autophagosomes per cell surface area in 50 mM glucose or 5 mM control (n=3). Scale bars=20 µm. *P<0.05, **P<0.01.

Hyperglycemia deprives CSCs of the primitive fraction

We screened whether hyperglycemia may polarize CSC phenotype towards fibrotic features over time by flow cytometry analysis. We found a significant change in the surface marker profile of CSCs after 1 week of culture in 50 mM glucose (Fig. 6A). In actual fact, we observed that the Sca1+ population was significantly reduced in CSCs after 7 days of hyperglycemia, with respect to normoglycemia (Fig. 6B), as well as the Sca1+/CD90+/DDR2- fraction (Fig. 6C). However, no significant modulation in the proportion of DDR2+ cells could be detected in these conditions. In order to test whether autophagy reactivation could oppose the depletion of Sca1+ cells during high glucose stress, CSCs were transduced with Ad-ATG7 at day 4 of hyperglycemia treatment. Then they were analyzed by flow cytometry analysis at the end of a 1 week-treatment (Fig. 6A). Late autophagy reactivation by ATG7 overexpression did not exert any detectable effect on CSC surface marker profile during prolonged culture in high glucose conditions (Supplementary fig. 6B-E).
Fig. 6

Hyperglycemia deprives CSCs of primitive cells and alters their paracrine profile.

A Experimental timeline and design for autophagy modulation during hyperglycemia treatment. Quantification by flow cytometry of total Sca1+ (B) and Sca1+/CD90+/DDR2- (C) cells in the CSC population after 1 week of culture in 50 mM glucose, or 5 mM as control (n=3). D Heatmap with hierarchical clustering of Euclidean distance, calculated on Log2 values from normalized optical density of protein arrays on conditioned media from ad-ATG7 or ad-LacZ transduced CSCs exposed to 50 mM glucose; the heatmap is shown associated to the fold change (FC) histogram of ad-ATG7 versus ad-LacZ levels, for a selection of the most modulated cytokines. E Network of functional associations from the STRING database among cytokines of interest, showing only associations with edge confidence >0.7 (high/highest). *P<0.05, #P<0.0001.

Hyperglycemia deprives CSCs of primitive cells and alters their paracrine profile.

A Experimental timeline and design for autophagy modulation during hyperglycemia treatment. Quantification by flow cytometry of total Sca1+ (B) and Sca1+/CD90+/DDR2- (C) cells in the CSC population after 1 week of culture in 50 mM glucose, or 5 mM as control (n=3). D Heatmap with hierarchical clustering of Euclidean distance, calculated on Log2 values from normalized optical density of protein arrays on conditioned media from ad-ATG7 or ad-LacZ transduced CSCs exposed to 50 mM glucose; the heatmap is shown associated to the fold change (FC) histogram of ad-ATG7 versus ad-LacZ levels, for a selection of the most modulated cytokines. E Network of functional associations from the STRING database among cytokines of interest, showing only associations with edge confidence >0.7 (high/highest). *P<0.05, #P<0.0001.

Autophagy counteracts the detrimental paracrine profile of CSCs after hyperglycemia

CSCs act significantly through paracrine mechanisms, so we investigated whether their paracrine profile was different after one week of exposure to hyperglycemia. Since this was a non-lethal stress with no effect on the proportion of Annexin V/7AAD labelled cells (Supplementary fig. 6A), we could exclude any altered cytokine release due to cell death. We screened conditioned media by protein arrays, and then analyzed the transformed optical density data of each cytokine by hierarchical clustering and heatmap, and by calculating the ad-ATG7/ad-LacZ ratio. We detected a consistent decrease in the levels of several proinflammatory cytokines and chemokines in CSC-conditioned media after autophagy activation by Ad-ATG7 transduction, as compared to ad-LacZ control (Fig. 6D). In particular, we found a consistent decrease in the secreted levels of chemokines CXCL1, CXCL5, CXCL16, CCL5, CCL2, and CXCL3, as well as other cytokines such as IL-6 and colony-stimulating factor 1 (CSF1), in ATG7-overexpressing CSCs after hyperglycemic stress, as compared to LacZ-overexpressing control cells. It is interesting to note that we also detected a downregulation of Lipocalin-2 (NGAL), VEGF, IGF-binding protein 3 (IGFBP3), and low-density lipoprotein receptor (LDLR) in CSCs with ATG7 overexpression in response to hyperglycemia treatment. Functional association network analysis on the STRING database demonstrated a significant enrichment (False Discovery Rate >0.05) in several GO terms related to biological processes, molecular functions, and cellular components in ATG7-overexpressing CSCs versus control cells in response to hyperglycemia (Supplementary Table 1). Specifically, two functional sub-networks emerged, as shown in Fig. 6E: one among chemokines (except CCL2), all belonging to the “Chemokine receptors bind chemokines” pathway (Supplementary fig. 7A); another one connecting IL-6, IGFBP3, CSF1, cystatin C (CST3), and secreted phosphoprotein 1 (SPP1), sharing the “regulation of IGF activity by IGFBP” pathway (Supplementary Fig. 7B). In order to assess the functional potential of this altered paracrine profile as a possible microenvironmental cue, we tested the ability of CSC-conditioned media to affect endothelial tube formation. Complete endothelial growth medium (EGM) was used as the positive control, while basal DMEM medium 0.1% FBS was considered as the negative control (Fig. 7A). Human umbilical vein endothelial cells (HUVECs) were exposed to conditioned media from ad-ATG7-transduced CSCs in hyperglycemia, and they were able to form significantly more closed loops (Fig. 7B, C) with a significantly higher total tube length (Fig. B, D), as compared to ad-LacZ-transduced CSCs.
Fig. 7

Autophagy induction enhances the pro-angiogenic paracrine capacity of CSCs.

Tube-forming assay was performed with HUVECs exposed to conditioned media from ad-ATG7 or ad-LacZ transduced CSCs, in 5 or 50 mM glucose. Representative culture images are shown (A, B), together with the quantification of closed-loop number (C) and total tube length (D) (n=4). Scale bars=200 µm. *P<0.05.

Autophagy induction enhances the pro-angiogenic paracrine capacity of CSCs.

Tube-forming assay was performed with HUVECs exposed to conditioned media from ad-ATG7 or ad-LacZ transduced CSCs, in 5 or 50 mM glucose. Representative culture images are shown (A, B), together with the quantification of closed-loop number (C) and total tube length (D) (n=4). Scale bars=200 µm. *P<0.05. Overall, autophagy reactivation was capable of promoting a less inflammatory/fibrotic and a more angiogenic/cardioprotective paracrine profile.

Autophagy induction protects CSCs from hyperglycemia-impaired stress resistance

Overall, hyperglycemia was able to impair autophagy activation and to reduce the primitive fraction in CSCs. Hyperglycemia is also known to reduce cardiac cell resistance to stress, such as ischemia and nutrient deprivation [50, 51]. Therefore, we investigated whether exposure to high glucose levels may affect CSC resistance to nutrient deprivation and, if so, whether autophagy reactivation may be a protective factor. CSCs were infected with ad-ATG7 or ad-LacZ, and concomitantly exposed to 50 mM glucose for 3 days, followed by 32 hours of nutrient deprivation stress (0.1% FBS, 0 mM glucose) (Fig. 8A). Viability analysis showed that hyperglycemia pre-conditioning determined an increase in apoptotic cells detected by AnnexinV/7AAD labelling after nutrient deprivation in ad-LacZ transduced control CSCs. Conversely, cell sensitivity to nutrient deprivation stress after exposure to high glucose was significantly rescued by ATG7-overexpression, as shown by representative density plots and relative quantification (Fig. 8B, C), and by nuclear translocation of cleaved caspase 3 (Fig. 8D) [52].
Fig. 8

Autophagy induction protects CSCs from hyperglycemia-impaired stress resistance.

A Experimental timeline of hyperglycemia (50 mM) pretreatment for 72 hours, with parallel ad-ATG7/ad-LacZ transduction for autophagy modulation, followed by 32 hours of nutrient deprivation stress (0.1% FBS, 0 mM glucose). Representative flow cytometry density plots (B) and relative quantification (C) of early (Annexin-V+/7AAD-) and late (Annexin-V+/7AAD+) apoptotic CSCs, to evaluate hyperglycemia-impaired and autophagy-enhanced resistance to nutrient deprivation stress (n=4). Representative immunofluorescence panels are displayed with higher magnification insets (D), showing differential nuclear translocation of cleaved caspase 3 (Csp3) in the different conditions. *P<0.05. Scale bar = 20 µm.

Autophagy induction protects CSCs from hyperglycemia-impaired stress resistance.

A Experimental timeline of hyperglycemia (50 mM) pretreatment for 72 hours, with parallel ad-ATG7/ad-LacZ transduction for autophagy modulation, followed by 32 hours of nutrient deprivation stress (0.1% FBS, 0 mM glucose). Representative flow cytometry density plots (B) and relative quantification (C) of early (Annexin-V+/7AAD-) and late (Annexin-V+/7AAD+) apoptotic CSCs, to evaluate hyperglycemia-impaired and autophagy-enhanced resistance to nutrient deprivation stress (n=4). Representative immunofluorescence panels are displayed with higher magnification insets (D), showing differential nuclear translocation of cleaved caspase 3 (Csp3) in the different conditions. *P<0.05. Scale bar = 20 µm.

Discussion

Primitive mesenchymal-like CSCs can be identified and isolated from the adult mammalian heart by different criteria and protocols [24, 32, 46, 53]. These cells are identified as non-activated stromal cells in myocardial homeostasis [12, 21], and can also be utilised for regenerative medicine strategies [54]. In fact, previous studies showed that CSCs can exert beneficial effects in the injured myocardium, mostly by positive microenvironmental conditioning through paracrine factors, which are able to render activated fibroblasts anti-fibrotic, and to polarize macrophages towards M2-like anti-inflammatory features [24, 26, 55–58]. Moreover, CSC phenotype can shift from cardioprotective features towards a pro-inflammatory and pro-fibrotic behaviour in response to different cues [29, 33, 59, 60]. This phenotypic shift within the heterogeneous stromal population may significantly affect adaptation and therapeutic mechanisms in response to stress and injury [33]. Therefore, CSC survival and phenotype balance in the injured and remodelled myocardium represent important features to be considered and studied, as a potential therapeutic target for anti-fibrotic or regenerative strategies [61, 62]. We did, in fact, aim to determine whether a cytoprotective strategy through autophagy enhancement could exert a positive effect on survival and phenotype of CSCs in response to different kinds of metabolic stress. Our results show increased activation of autophagy in CSCs exposed to nutrient deprivation, in line with the known protective role of this degradation system in response to energy stress [63, 64] or oxidative stress [65]. Autophagy boosting with both ATG7-overexpression and TRE treatment before starvation induced a significant increase in CSC survival. Conversely, ATG7 downregulation exacerbated cell death. These data confirm the concept that autophagy can increase the resilience of cardiac cells (now including CSCs) towards nutrient deprivation in ischemic settings. We also described the relative abundance of stromal cells with a primitive phenotype versus an activated/fibrotic phenotype within the CSC population, designing an immunophenotyping strategy based on the wide experience available from the literature from several groups [12, 66]. It is worth arguing that, despite the ongoing debate on the complex phenotypic profile of cardiac fibroblasts and CSCs [67], DDR2 is a protein expressed in mature cardiac fibroblasts and directly involved in their functions [47, 48, 68]. We therefore considered it as a positive marker for the presence of activated functional fibroblasts in culture, regardless of the concomitant staining for both CD90 and Sca1. Overall, we observed a shift towards a pro-fibrotic phenotype of surviving CSCs after exposure to FBS and glucose deprivation, that was significantly counteracted by autophagy boosting. In fact, CSCs that were pre-treated with TRE showed a higher relative amount of total Sca1+ cells, including Sca1+/CD90+/DDR2- mesenchymal primitive cells, and a reduced proportion of cells expressing the fibroblast marker DDR2. This finding is in line with the notion that fibrotic tissues display decreased autophagy [69], and that autophagy homeostasis is crucial to preserving an undifferentiated primitive phenotype [70]. Among the main cardiovascular risk factors and comorbidities, glucose dysmetabolism represents a specific pathogenetic factor in cardiomyopathy development [28]. The consequent detrimental microenvironment may impair the reparative capacity of CSCs in the damaged myocardium [31]. Here we investigated whether hyperglycemia, which is associated with metabolic syndrome and diabetes, may cause impairment of the phenotype of CSCs, and of their resistance to nutrient deprivation stress. Indeed, we showed that acute exposure to hyperglycemia reduces the autophagic flux in CSCs, in line with several other studies about autophagy in diabetic cardiomyopathy [37]. Moreover, one week of hyperglycemia significantly depleted the primitive pool of CSCs, although delayed autophagy enhancement could not counteract this phenotypic shift in our conditions. Nonetheless, after intermediate autophagy activation during prolonged hyperglycemic stress, CSCs released lower levels of several chemokines and cytokines associated with inflammation and immune cell recruitment [71]. These results are consistent with the available data regarding the direct effects of autophagy activation on reducing transcription, processing, and secretion of numerous pro-inflammatory cytokines [72, 73]. Functional association analyses in the STRING database included all downregulated chemokines in the same sub-network, indicating overall reduced pro-inflammatory signalling in ATG7-overexpressing CSCs. Moreover, several other modulated cytokines were included and interlinked in another sub-network, as they were united by functional association with the “regulation of IGF activity by IGFBP” pathway. The IGF-1 pathway is indeed involved in cardioprotective and adaptive mechanisms in response to metabolic stress and ischemia [74]. Interestingly, IGF-1 bioavailability has been shown to be tightly regulated in CSCs cultured in a 3D microenvironment [75], and to mediate their cardioprotective features [76]. Interestingly, we also found reduced secreted levels of Lipocalin-2 (NGAL), that is known to positively correlate with HF progression. In fact, NGAL activation can suppress the beneficial cardiac autophagic response to ischemia, contributing to enhanced ischemia-induced cell death and cardiac dysfunction [77]. Finally, autophagy activation in CSCs exposed to hyperglycemia consistently reduced VEGF release, as described in other cell types [78]. Finally, we showed that autophagy boosting could preserve the paracrine capacity of CSCs to support the angiogenic function of endothelial cells under hyperglycemic conditions, indicating positive microenvironmental conditioning by CSCs upon enhanced autophagy activation. We also investigated if autophagy could improve cell resistance to stress after exposure to high glucose, that could represent a CSC-independent preconditioning strategy for the myocardial microenvironment in vivo [49]. Indeed, our results showed that autophagy activation during hyperglycemia treatment could significantly reduce cell death in CSCs subsequently exposed to nutrient deprivation. Overall, these results suggest that autophagy stimulation after initial exposure to high glucose, albeit not having the ability to counteract the depletion in the primitive fraction of CSCs, may at least reduce their pro-inflammatory signalling while enhancing pro-angiogenic signals in pathological conditions, such as diabetes or metabolic syndrome. Moreover, TRE- or ATG7-driven activation of autophagy may be considered as a strategy for empowering transplanted primitive CSCs in the injured and/or dysmetabolic myocardium, enhancing both their survival and paracrine potency, thus possibly ameliorating myocardial regeneration. Future studies are required to address this issue. In conclusion, our results show that autophagy stimulation may prove useful for CSC survival and for preservation of a positive cardio-protective phenotype, in particular when exposed to dysmetabolic stressors. Finally, autophagy promotion may potentially increase the efficacy of cardiac cell therapy protocols by improving cell resistance to stress after transplantation in the damaged tissue, and by preserving a beneficial paracrine phenotype of engrafted cells.

Material and methods

Cardiac stromal cell culture

Cardiac stromal cells (CSCs) were isolated as cardiosphere-derived cells, as previously described as a resident cell population of non-hematopoietic stromal cells containing primitive undifferentiated cells [79, 80] . CSCs were derived from atrial tissue of 4-week old C57Bl6J mice. In brief, atrial tissue was fragmented, digested, and plated as explant cultures in Petri dishes previously coated with Fibronectin (FN) (CELL guidance system, Cambridge, UK) in complete explant media (CEM): Iscove’s modified Dulbecco’s medium (IMDM) (Sigma-Aldrich, St Louis, USA) supplemented with 20% FBS (Sigma-Aldrich), 1% penicillin-streptomycin (Sigma-Aldrich), 1% L-glutamine (Lonza), and 0.1 mM 2-mercaptoethanol (Thermo-Fisher, Waltham, USA). Explant-derived cells were collected after 3 weeks by sequential washes with Ca2+-Mg2+ free PBS, 0.48 mM/L Versene (Thermo-Fisher) for 3 minutes, and with 0.05% trypsin-EDTA (Lonza, Basel, CH) for 5 minutes at room temperature under visual control. Collected cells were seeded at low density (2,5x104 cells/cm2) in 12-well plate previously coated with poly-D-lysine (Corning, New York, USA) in spheroid-growing medium: 35% complete IMDM/65% DMEM–F-12 mix, containing 2% B27, 0.1 mmol/L 2-mercaptoethanol, 10 ng/mL epidermal growth factor (EGF; Peprotech, London, UK), 20 ng/mL fibroblast growth factor (FGF), 40 nmol/L cardiotrophin-1 (both Miltenyi Biotec, Bergisch Gladbach, DU), 40 nmol/L thrombin (Sigma-Aldrich), antibiotics and L-Glu as in CEM. After 1 week, cells spontaneously formed 3D-spheroids, which were collected by gently pipetting without enzymatic digestion, and then expanded as a monolayer on FN-coating in CEM. For these experiments cells were plated at a density of 1.25×104 cells/cm2. Eight CSCs lines were used, each obtained from a tissue pool of five mice.

Colony-forming unit assay

The colony-forming unit (CFU) assay was performed as previously described [81]. Briefly, CSCs were seeded at low density (10 cells/cm2) in CEM on FN-coated plates, and incubated for 14 days at 37 °C with 5% CO2. Colonies were then fixed with 4% paraformaldehyde, stained with Giemsa (Sigma-Aldrich) for 1 hour, and counted under an optical microscope. A cluster with at least 50 cells was considered to be a colony; clonogenic efficiency was calculated as number of colonies per plated cells, and plotted as percentage.

Immunostaining and fluorescence microscopy analysis

For immunofluorescence, CSCs cultured for 1 day in 3% FBS-CEM on fibronectin-coated plates were fixed for 10 minutes with 4% paraformaldehyde at 4 °C, and permeabilized with 0.1% Triton X-100 (Sigma-Aldrich) in PBS with 1% BSA. Nonspecific antibody binding sites were blocked with 10% goat serum (Sigma-Aldrich) in PBS, before overnight incubation at 4 °C with primary antibodies: GATA-4 (ab84593), NKX2-5 (ab97355), SMA (ab5694) (all Abcam, Cambridge, UK), TnI (sc-365446, Santa Cruz Biotechnology, Dallas, USA), cleaved caspase 3 (9661 s, Cell Signalling Technologies, Danvers, USA). After thorough washing, slides were incubated for 2 hours at room temperature with the appropriate Alexa-conjugated secondary antibodies (A11029, A1103, Thermo-Fisher) and DAPI nuclear dye (D1306, Thermo-Fisher). Slides were mounted in 70% glycerol in PBS. Image capture was performed on a Nikon Eclipse Ni microscope equipped with VICO system and NIS-Elements AR 4.30.02 software with a 20X objective (Nikon Corporation, Tokyo, JA). Percentage of positive cells was calculated by semi-automatic counting normalized to the number of nuclei per each 20X field.

Western blot

Total protein cell extracts were made using a Lemli 2x with 5% β-mercapto-ethanol buffer, and stored at −80 °C until western blotting analysis. Equal volumes of protein lysate were boiled at 100 °C for 5 minutes, loaded on sodium dodecyl sulfate 15% polyacrylamide gels for electrophoresis (SDS-PAGE), and transferred to PVDF membranes (Sigma-Aldrich). Membranes were then blocked with 3% BSA for 1 hour at room temperature, and incubated with primary antibodies against tubulin (2148 S, Cell Signalling Technologies), vinculin (sc-73264, Santa Cruz), β-actin (C54070S, Cell Signalling Technologies), ATG7 (8558 S, Cell Signalling Technologies), cleaved caspase 3 (9661 s, Cell Signalling Technologies), ATG5 (NB110–53818, Novus Biological), and LC3 (M186–3, MBL International, Woburn, USA) at 4 °C overnight under gentle agitation. Membranes were then washed three times with TBS-0.01% Tween, and incubated with appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies (Bio-Rad, Hercules, USA) for 1 hour at room temperature, before detection with Clarity western ECL substrate (Bio-Rad), following the manufacturer’s instructions. The chemiluminescence signal was detected by a ChemiDoc XRS+ with ImageLab software, and the densitometric analysis was performed using Image Lab software (all Bio-Rad). The relative band abundance was normalized versus ACT-β or vinculin, as the loading control. All the original western blots of all figures are available as supplementary material.

Adenoviral infection

Recombinant adenovirus vectors were kindly donated by Junichi Sadoshima (Rutgers University) [82, 83]. For routine amplification of the vectors, HEK293 cells at 60% confluency were transduced with diluted supernatant from previous amplification rounds (1:4 ratio with fresh media); cells were collected 48 hours later by pipetting, and centrifuged at 300rcf for 10 minutes. The pellet was then resuspended in 1 ml PBS, and subjected to four cycles of sudden freezing in liquid nitrogen and thawing at 37 °C. Finally, the solution was centrifuged at 3250rcf for 30 minutes, the supernatant was collected and stored at −80 °C until use. For the ATG7 upregulation experiments, CSCs (1x105 cells) were infected with a recombinant Adenovirus carrying ATG7 (Ad-ATG7) 1 day after plating. An adenovirus carrying the β-galactosidase gene (Ad-LacZ) was used as control in all overexpression experiments. Transduction efficiency was evaluated through ATG7 mRNA expression and protein level (Supplementary Fig. 3).

mRFP-GFP-LC3 fluorescent dots assay

CSCs cultured in chamber-slides were transduced with Ad-mRFP-GFP-LC3 adenovirus for 48 hours [84]. After treatments, cells were washed with PBS, fixed with 4% paraformaldehyde, mounted with Vectashield (Vector Laboratories, Burlingame, USA), and viewed under a fluorescence Nikon Eclipse Ni microscope with VICO system (Nikon Corporation). The number of autophagosomes was determined by semiautomatic counting of GFP+/mRFP+ fluorescent puncta (yellow dots) under a 20X objective with the NIS Elements software (Nikon Corporation), normalizing to the cell surface area. At least 30 cells were analyzed for each condition; 30 pictures were taken for each sample.

Small interfering RNA silencing

For ATG7 mRNA downregulation experiments, CSCs (1x105 cells) were transfected with 100 µM of siRNA-ATG7 Smart pool (Dharmacon, Lafayette, USA) using Lipofectamine 2000 (Thermo-Fisher) in OptiMem (Thermo-Fisher), following the manufacturer’s instructions. A scramble (Scr) siRNA (Dharmacon) was used as control in all silencing experiments. Transfection efficiency was evaluated through ATG7 mRNA expression and protein level (Supplementary Fig. 4).

Flow cytometry and apoptosis analysis

CSC immunophenotype was assessed by flow cytometry. Semi-confluent cultures were harvested with Accutase (Sigma-Aldrich) and stained with DDR2-APC (sc-81707, Santa Cruz), CD45-PerCP-cy5.5 (103131), Flk1-PE (121905), CD90-FITC (105305), Sca1-APC-cy7 (108125) antibodies (all Biolegend, San Diego, USA), according to the manufacturer’s guidelines. The percentage of apoptotic cells was measured by 7AAD/AnnexinV labelling (640908, BD Biosciences, San Jose, USA), according to the manufacturer’s modified protocol for adherent cells. Data acquisition was performed on a FACS-Aria II platform equipped with FACSDiva software (BD Biosciences), which was also used to calculate the compensation parameters. All flow cytometry data were analyzed with FlowJo software (FlowJo LLC, Ashland, USA), and plotted as fold change versus controls.

RNA extraction and real-time PCR

Total RNA was extracted using column-based kits (Qiagen, Hilden, DE), according to the manufacturer’s instructions. RNA was quantified using NANODROP (Thermo-Fisher). For gene expression analyses, cDNA was synthesized from 0.5 μg of RNA with High Capacity cDNA Reverse Transcription Kit (Life Technologies, Carlsbad, USA). Real-time qPCR was performed using Power SYBR Green PCR Master Mix (Life Technologies) on a 7900HT Fast Real-Time platform (Applied Biosystems, Waltham, USA), using the manufacturer’s standard thermocycling conditions. The relative ratio versus control sample was calculated using the comparative Ct method (2−ΔΔCt), with ACT-β selected as the housekeeping gene, according to the Norm Finder algorithm (MOMA, Aarthus University, DK). ATG7 primers (FW= ATGATCCCTGTAACTTAGCCA, REV= CACGGAAGCAAACAACTT), ACT-β primers (FW= CACCAACTGGGACGACAT, REV= ACAGCCTGGATAGCAACG).

Cytokine array for secretome profiling

Conditioned media were supplemented with 0.1% FBS and collected after the last 48 hours of culture from 3 independent experiments. Media were centrifuged at 2000rcf for 5 minutes to remove cells and debris, and then stored at −80 °C until analysis. Culture medium was assayed by the Proteome Profiler Mouse XL Cytokine Array (R&D Systems, Minneapolis, USA) to simultaneously detect 111 targets. Briefly, array membranes were blocked with blocking buffer for 1 hour at room temperature, and then 1 ml of culture medium was added to each membrane and incubated at 4 °C for overnight. Membranes were repeatedly washed, and then incubated with biotin-conjugated antibody for 1 hour at room temperature. After further washes, membranes were incubated for 30 minutes at room temperature with HRP-conjugated streptavidin, and washed one last time to remove unbound reagents. All incubation steps were performed under agitation on an orbital shaker. Membranes were then developed with the detection buffer following the manufacturer’s instructions. Briefly, arrays were scanned with ChemiDoc Imaging System (Bio-Rad), and spot signal densities were obtained using ImageLab software (Bio-Rad). The background was subtracted from the densitometry data, and the obtained values were normalized to the positive control spots for each membrane. A heatmap was generated using the log2-trasform densitometric quantification of each dot, using R package pheatmap (GNU Project). Euclidean distance was calculated using hclust clustering methods implemented in R software. Functional association network was created using the STRING database (ELIXIR Core Data Resources) selecting the “experiments” and “database” options.

Angiogenesis assay

The angiogenesis assay was performed as previously described [29, 85]. Briefly, Matrigel matrix growth factor reduced (BD Corning, United States, Arizona) was seeded in a 96 multiwell plate and allowed to solidify for 1 hour at 37 °C. Human umbilical vein endothelial cells (HUVECs) were cultured in endothelial growth medium (EGM2, Lonza), seeded at a density of 2.5x104 on top of the Matrigel layer, and cultured for 18 hours with CSC-conditioned media collected from the different treatments. As positive and negative controls, EGM-2 and DMEM 5 mm Glucose with 0.1%FBS were used, respectively. Images were taken under a fluorescence Nikon Eclipse Ti microscope (Nikon Corporation) with a 4X objective. Assay quantification, in terms of total tube length and number of loops, was performed with the Angiogenesis Analyzer Plugin of the ImageJ software (National Institutes of Health, Bethesda, MD).

Statistical analysis

Statistical analysis was performed by GraphPad Prism 8 software (GraphPad Software, San Diego, USA). All results are presented as mean value ± standard error of the mean. Significance of difference between two groups was determined by two-sided Student’s t-test. When 3 or more groups were intercompared, parametric or non-parametric (as appropriate) one-way ANOVA test, followed by Bonferroni correction or uncorrected Dunn’s test for multiple comparisons, were used, respectively. A value of P<0.05 was considered to be significant. Supplementary figures and tables Full scan western blots
  83 in total

Review 1.  Developmental origin and lineage plasticity of endogenous cardiac stem cells.

Authors:  Maria Paola Santini; Elvira Forte; Richard P Harvey; Jason C Kovacic
Journal:  Development       Date:  2016-04-15       Impact factor: 6.868

2.  The histopathologic evolution of myocardial infarction.

Authors:  M C Fishbein; D Maclean; P R Maroko
Journal:  Chest       Date:  1978-06       Impact factor: 9.410

3.  Trehalose-Induced Activation of Autophagy Improves Cardiac Remodeling After Myocardial Infarction.

Authors:  Sebastiano Sciarretta; Derek Yee; Narayani Nagarajan; Franca Bianchi; Toshiro Saito; Valentina Valenti; Mingming Tong; Dominic P Del Re; Carmine Vecchione; Leonardo Schirone; Maurizio Forte; Speranza Rubattu; Akihiro Shirakabe; V Subbarao Boppana; Massimo Volpe; Giacomo Frati; Peiyong Zhai; Junichi Sadoshima
Journal:  J Am Coll Cardiol       Date:  2018-05-08       Impact factor: 24.094

4.  Effects of stress hyperglycemia on acute myocardial infarction: role of inflammatory immune process in functional cardiac outcome.

Authors:  Raffaele Marfella; Mario Siniscalchi; Katherine Esposito; Ausilia Sellitto; Umberto De Fanis; Ciro Romano; Michele Portoghese; Silvio Siciliano; Francesco Nappo; Ferdinando Carlo Sasso; Nicola Mininni; Federico Cacciapuoti; Giacomo Lucivero; Riccardo Giunta; Mario Verza; Dario Giugliano
Journal:  Diabetes Care       Date:  2003-11       Impact factor: 19.112

5.  Gata4 directs development of cardiac-inducing endoderm from ES cells.

Authors:  Audrey Holtzinger; Gabriel E Rosenfeld; Todd Evans
Journal:  Dev Biol       Date:  2009-10-20       Impact factor: 3.582

6.  Intracoronary cardiosphere-derived cells for heart regeneration after myocardial infarction (CADUCEUS): a prospective, randomised phase 1 trial.

Authors:  Raj R Makkar; Rachel R Smith; Ke Cheng; Konstantinos Malliaras; Louise Ej Thomson; Daniel Berman; Lawrence Sc Czer; Linda Marbán; Adam Mendizabal; Peter V Johnston; Stuart D Russell; Karl H Schuleri; Albert C Lardo; Gary Gerstenblith; Eduardo Marbán
Journal:  Lancet       Date:  2012-02-14       Impact factor: 79.321

Review 7.  Hyperglycemia-induced cardiac contractile dysfunction in the diabetic heart.

Authors:  Raphael M Singh; Tahreem Waqar; Frank C Howarth; Ernest Adeghate; Keshore Bidasee; Jaipaul Singh
Journal:  Heart Fail Rev       Date:  2018-01       Impact factor: 4.214

8.  Guidelines for the use and interpretation of assays for monitoring autophagy (4th edition)1.

Authors:  Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong
Journal:  Autophagy       Date:  2021-02-08       Impact factor: 13.391

9.  Autophagy maintains the metabolism and function of young and old stem cells.

Authors:  Theodore T Ho; Matthew R Warr; Emmalee R Adelman; Olivia M Lansinger; Johanna Flach; Evgenia V Verovskaya; Maria E Figueroa; Emmanuelle Passegué
Journal:  Nature       Date:  2017-03-01       Impact factor: 49.962

10.  Validation of the cardiosphere method to culture cardiac progenitor cells from myocardial tissue.

Authors:  Darryl R Davis; Yiqiang Zhang; Rachel R Smith; Ke Cheng; John Terrovitis; Konstantinos Malliaras; Tao-Sheng Li; Anthony White; Raj Makkar; Eduardo Marbán
Journal:  PLoS One       Date:  2009-09-25       Impact factor: 3.240

View more
  1 in total

1.  Progressive stages of dysmetabolism are associated with impaired biological features of human cardiac stromal cells mediated by the oxidative state and autophagy.

Authors:  Francesca Pagano; Vittorio Picchio; Antonella Bordin; Elena Cavarretta; Cristina Nocella; Claudia Cozzolino; Erica Floris; Francesco Angelini; Alessia Sordano; Mariangela Peruzzi; Fabio Miraldi; Giuseppe Biondi-Zoccai; Elena De Falco; Roberto Carnevale; Sebastiano Sciarretta; Giacomo Frati; Isotta Chimenti
Journal:  J Pathol       Date:  2022-07-28       Impact factor: 9.883

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.