Literature DB >> 35363796

Formation of recombinant bifunctional fusion protein: A newer approach to combine the activities of two enzymes in a single protein.

Patel Nilpa1, Kapadia Chintan1, R Z Sayyed2,3, Hesham El Enshasy4,5,6, Hala El Adawi6, Alaa Alhazmi7,8, Atiah H Almalki9,10, Shafiul Haque11,12.   

Abstract

The tissue of insects, pests, and fungi has a chitin layer followed by protein in the cell membrane. The complete biodegradation of chitin and protein-present in the waste requires the action of two enzymes, namely chitinase, and protease. Combining chitinase and protease in a single protein/enzyme will serve as a bifunctional enzyme that can efficiently degrade the chitin and protein-rich biomass. The present study was aimed to fuse these two enzymes to produce a single protein and study the kinetics of the recombinant fusion protein. A chitinase and alkaline protease genes were isolated, cloned, and expressed successfully as a fusion product in heterologous host Escherichia coli. The two native genes were successfully fused in E.coli by using flexible glycine-serine (G4S)2 linker (GGGGS, GS linker). The recombinant fusion protein in E.coli showed hydrolyzed chitin and protein on chitin and bovine serum albumin agar plates confirming the successful cloning and expression of chitinase and protease enzymes in a single fusion protein. The common pUC18-T7 mini vector with the ompA signal sequence helps the extracellular expression of fusion protein efficiently. The native gel electrophoresis revealed a molecular mass of purified protein as 92.0 kDa. The fusion protein's maximal chitinase and protease activity occurred at pH 5.0 and 8.0 and 30 0C, respectively resembling the individual enzymes'. In the kinetic studies of the fusion protein, it was observed that the presence of metal ions such as Cu2+, Na2+, and Ca2+; significantly enhanced the enzyme activities while organic solvents oxidants and chemicals have drastically affected the activities of both the enzymes in the fusion protein. No such fusion protein has been produced in a heterologous host yet. The reports on fusion protein with biomass-degrading capacity are also scarce. This is probably the first report of a bifunctional chitinase/protease expressed in E. coli.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35363796      PMCID: PMC8975109          DOI: 10.1371/journal.pone.0265969

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

Chitin is the most abundant, water-insoluble homopolymer of N-acetyl D-glucosamine (GlcNAc) just next to cellulose and lignin [1]. It is present in most invertebrates, the cuticle of nematodes, the cell wall of filamentous fungi, and the cuticle of arthropods [2]. Chitin, being a natural product, is continuously synthesized and degraded in the natural environment through chitinase. Chitinases (EC 3.2.1.14) are hydrolytic enzymes that cleave glycosidic bonds of chitin to produce GlcNAc and N-acetyl chitooligosaccharides (COSs) [3, 4]. Chitinase has received much commercial attention recently due to the increased demand for its reaction products such as GlcNAc and COSs in food industries and ethanol production and its application as a biocontrol agent against phytopathogenic fungi [5, 6]. Various microorganisms secrete different families of chitinases [7, 8], however, bacterial chitinase is the best source of chitinase, as it is easily regulated, its production is easily scaled up, it is produced extracellularly and in large quantities in shorter time. The microbes produce multiple chitinases for the complete degradation of chitin into monomers. Bacterial chitinase gradually cleaves chitin and probably generates a better end product than individual enzymes [9]. The use of cloned bacterial chitinase has been reported in a few bacterial genera [3, 10–19]. Proteases (E.C.3.4.21) are the hydrolytic enzymes that cleave peptide bonds and thus release amino acids and /or short-chain oligopeptides. Proteases have become industrially significant enzymes, acquiring about 60% share of the global enzyme market, accounting for about $ 2.21 billion in value. They are widely used in agriculture, pharmaceuticals, food processing, detergent, leather processing, etc. [20, 21]. Proteases have been produced by plants, animals, fungi, and bacteria [22-24]. However, microbial protease is preferred over plant or animal sources due to their higher activity ease in genetic modification, ample availability, convenient processing, and safe and cost-effective production, besides high stability and ability to function over the broader pH and temperature range [25]. Cloning the protease gene and its expression in E. coli has been reported in a few bacterial genera [26-32]. Among the different bacterial sp. Bacillus sp. has been more frequently studied and used to synthesize diverse and industrially important protease, as it produces the enzymes extracellularly, thus offers ease in the extraction and recovery, and the fermentation process is conveniently regulated [33]. Enzymes from wild strains have a narrow range of working temperature and pH, less stability, and more sensitivity to metal ions, solvents, detergents, oxidants, feed-back inhibitions, etc. Gene cloning of commercially important enzymes in the fast-growing host that also gives better expression, easy recovery and purification, higher enzyme yield, and aid into the desired features to the enzyme has been the goal of making industrially valuable enzymes. The co-expression strategies have the limitation of low transformation efficiency and inconvenient screening during co-expression. Constructing a bifunctional/trifunctional gene could be an effective approach [34-39]. Although there are reports on the cloning of Chitinases and proteases; there are no reports on the cloning of two individual enzymes to produce a single fusion protein that possesses chitinase and protease activities. Thus, there is a need to produce a single fusion protein that exhibits two enzymes useful in the biodegradation of chitin and protein-rich wastes. The present study aimed at cloning, expression, and biochemical characterization of a single fusion gene product so that a single protein will have multifunctional activities.

Materials and methods

Bacterial strains, vector, chemical reagents, and culture conditions

The Bacillus circulans strain MTCC 7906 (Accession No.JN645176.1) for alkaline protease and Serratia marcescens strain GPS5 (Accession No.KX579968.1) for chitinase D and E. coli BL21 (DE3); an expression host was cultured overnight in LB broth at 30°C. These bacterial cultures and the extracellular expression vector pUC18T-mini-Tn7T-Tp-gfpmut3 were procured from the SLS research Pvt. Ltd. India. 5-Bromo-4-chloro-indolyl-β—galactopyranoside (X-Gal), isopropyl thiogalactoside (IPTG), and antibiotics (ampicillin and gentamycin) were procured from Merck (Germany) and used for the selection of transformed clones. All other chemical reagents were purchased from SLS Research Pvt. Ltd., India

Cloning of chitinase and protease genes

The genomic DNA of B.circulans strain MTCC 7906 and S.marcescens GPS5 was isolated from the overnight grown cultures of these organisms [40], and purity of the separated DNA was confirmed by agarose gel electrophoresis. PCR amplified the gene encoding chitinase and protease from genomic DNA with the primers mentioned in Table 1. The laboratory designed these primers to remove a deduced signal sequence so that protein can be targeted to the extracellular site using the ompA signal sequence [41]. The rrnB transcription termination sequence was used to termination the transcription process. The amplified fragments were checked on the agarose gel electrophoresis for their expected band size. The sense and antisense strands of the linker (GGGGSGGGGS) were annealed by placing 10 ng each in PCR tubes and incubated under a PCR machine with a touchdown cycle from 95°C to 25°C with a gradual decrease of 5°C for every 5 min and incubated further at 25°C. The chitinase gene amplicon, protease gene amplicon, and linker were added to the PCR mixture. The overlapping primer was used to amplify the entire sequence as a long consensus [42] (Table 1). The amplified PCR products were analyzed through 1.5% agarose gel electrophoresis prepared in 1x TBE buffer and run for 20 min. at 7V/cm. The size of the amplified DNA fragments was determined on agarose gel by comparing with the 100+500 bp DNA ladder and photographed under the Bio-Rad Gel documentation system. Three constructs, namely (i) protease, (ii) chitinase, and (iii) chitinase fused with protease, were constructed by using flexible glycine–serine peptide linker (GGGGS, (G4S)2) [43]. The amplified and purified fragments were inserted into the vector pUC18 mini-Tn7T purchased from add gene, USA. The fusion sequence was treated with KpnI (GGTACC) restriction enzyme to create 3’overhang. The BamHI site (GGATCC), lac UV5 promoter, shine-Dalgarno sequence, ompA (Signal Sequence for secretion), and spacer sequences were synthesized as a separate unit (Table 1; sequence No. 10). The regulatory sequence along with BamHI at the 5’ end was ligated with the fusion product. The same sequence was treated with the mentioned restriction enzyme to create a 5’ cohesive end and mixed with the linear vector pUC18miniTn7 in the ratio of 1:5 (Vector: Insert) (Fig 1).
Table 1

The list of the primers used in the present study.

PrimerNucleotide sequence
FPChi 5’- ATG GCC TAT CTC TCC GTC GGC T -3’
RPChi5’- GGTACCTTAATGGTGATGGTGATGGTGCCG TTT CTC GCC TTT TAT GTT CAG CGA -3’(KpnI RE) (Stop) (HIS TAG)
FPP 5’- ATG GTT GGG TAC TCT ATG GTA CAA ATG GTG A -3’
RPP 5’- CAG AAA ATT CCG TTC CCG GCC AA -3’
RPP with overhang 5’- GGTACCTTAATGGTGATGGTGATGGTGCAG AAA ATT CCG TTC CCG GCC AA -3’ (KpnI RE) (Stop) (HIS TAG)
Linker sequence 5’GGCGGCGGCGGCAGCGGCGGCGGCGGCAGC-3’
Complementary Linker sequence 5’-GCTGCCGCCGCCGCCGCTGCCGCCGCCGCC-3’
FPP 5’GCGGCGGCGGCAGCGGCGGCGGCGGCAGCATGGTTGGGTACTCTATGGT-3’ Overhang at 5’ end of Protease gene
RPChi 5’-CTGCCGCCGCCGCCCCGTTTCTCGCCT-3’ Overhang to the 5’ Protease gene
BamHI -M10K10 lacuv5-promoter -SD-ompA-Spacer 5’GGATCCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTAGGAGGATGGAAACCCTGTATAGCCTGTATAGCACCCATCGCGCGCTGGCGATTCTGGAAGCGCTGGCGATTCTGGAAGCGCTGGCGGTGGCGCTGGCGCTGGCGCTGGAAGCGCTGGCGGGCCTGTATCCGCATGAAGCGCTGGCGACCCATCGCGTGGCGCTGGCGCTGGCGGGCATTAACGCGCTGGCGGGCGGCGGCGGCAGCGGCGGCGGCGGCAGC-3’

*FPC:- Forward primer for cellulase, RPC:- Reverse primer for cellulase, FPChi:- Forward primer for chitinase, RPChi:- Reverse primer for chitinase, FPP:- Forward primer for protease, RPP:- Reverse primer for protease, SD:- Shine-Dalgarno sequence, ompA:- Signal sequence for E. coli.

Fig 1

The map of pUC18-T7 mini vector with E.Coli rrnB transcription termination.

Lac promoter (Blue color), Lac UV 5 Promoter (Blue color), Lac Operator (Blue color), Fusion Gene (purple color), rrnB T1 terminator (Color less), Ampicillin Resistant gene AmpR and pMB1 origin of replication.

The map of pUC18-T7 mini vector with E.Coli rrnB transcription termination.

Lac promoter (Blue color), Lac UV 5 Promoter (Blue color), Lac Operator (Blue color), Fusion Gene (purple color), rrnB T1 terminator (Color less), Ampicillin Resistant gene AmpR and pMB1 origin of replication. *FPC:- Forward primer for cellulase, RPC:- Reverse primer for cellulase, FPChi:- Forward primer for chitinase, RPChi:- Reverse primer for chitinase, FPP:- Forward primer for protease, RPP:- Reverse primer for protease, SD:- Shine-Dalgarno sequence, ompA:- Signal sequence for E. coli. The chemically competent E. coli BL21 (DE3) were mixed with the recombinant plasmids and transformed using the heat shock method [44]. The transformants were grown on an LB plate containing ampicillin and gentamycin (100 μg/mL each) at 30°C for 24 h and observed for the appearance of growth of transformants. The transformed cells were then picked from the plates and incubated in the antibiotic-containing LB broth at 30°C for 24 h and used for further study.

Estimation of enzyme activities of the different constructs

Estimation of chitinase and protease activity was performed on basal agar plates containing (g/L) K2HPO4; 0.3, KH2PO4; 0.7, MgSO4; 0.5, FeSO4; 0.01, MnCl2; 0.001, ZnSO4; 0.001, and yeast extract; 5.0 separately amended with 1% azo-casein and 1% colloidal chitin. The transformed cells having fusion protein were grown on these plates at 30°C for 72 h. Following the incubation, the chitin agar plate was stained with 0.1% congo red and observed for the zone of chitin hydrolysis. Azocasein plate was observed for the zone of casein (protein) hydrolysis around the bacterial colonies.

Induction and purification of enzymes

E. coli BL21 (DE3) transformed with the corresponding expression vector was grown overnight at 30°C in LB supplemented with antibiotics. The next day, 100 μL of each culture broth was inoculated in 10 mL of fresh LB medium supplemented with antibiotics (ampicillin and gentamycin @100 μg/mL) and incubated at 30°C for 45 min., followed by the addition of 400 μM/mL of IPTG and further incubation at 30°C for 2 h to get 108 numbers of cells/mL of culture. The one mL of each culture was transferred to their respective substrates containing LB broth. The induction of enzymes was carried out by providing 200 μM/mL IPTG, and then the cells were allowed to grow further at 30°C for 72 h. The broths were centrifuged at 10,000 rpm for 10 min. and the supernatants were dialyzed against Tris buffer (pH 7.5) to remove media ingredients. Enzymes were purified using Ni-Nitrilotriacetic acid agarose column for His tagged dialyzed proteins (Takara Bio Inc., USA). The columns were equilibrated with equilibration buffer (50 mM sodium phosphate, 300 mM sodium chloride, 20 mM imidazole; pH 7.4) followed by washing with His60 Ni wash buffer (50 mM sodium phosphate, 300 mM sodium chloride, 40 mM imidazole; pH 7.4) and incubated at 30°C for 5–7 min. To this tube, 10–20 mL of dialyzed clear protein was added and eluted with 15 mL elution buffer (50 mM sodium phosphate, 300 mM sodium chloride, 300 mM imidazole; pH 7.4). The eluted proteins were collected and assayed for chitinase and protease activities.

Chitinase assay

Chitinase activity was estimated according to the method of Lee et al. [45]. The reaction mixture consisting of different volumes of enzyme solution (60 μL, 300 μL, and 500 μL for crude, dialyzed, and purified respectively) and 4 mL (1% w/v) of colloidal chitin (prepared from shrimp shells in 100 mM sodium acetate buffer (pH 5.5) was incubated at 30°C for 60 min. The reducing sugars were estimated analyze by the Somogyi–Nelson method [46], using GlcNAc as the standard. One unit (U) of chitinase activity was defined as the amount of enzyme that liberated one μM of GlcNAc per minute per mL under the assay conditions. According to Lowry et al. [47], the amount of available proteins was measured, using bovine serum albumin (100–1000 μg/mL) as the standard.

Protease assay

Protease activity was measured according to the method of Aretz et al. [48]. The reaction mixture consisting of different volumes of enzyme solution (60 μL, 300 μL, and 500 μL for crude, dialyzed, and purified respectively), 5 mL substrate (1% casein) was incubated at 30°C for 10 min and followed by adding 5 mL of 100 mM Trichloroacetic acid (TCA) and mixed thoroughly. The solutions were filtered through Whatman filter paper and checked for color development due to the release of tyrosine. The amount of tyrosine from the filtrate was measured according to the Lowry method [47], and the amount of tyrosine was calculated from the standard curve of tyrosine (100–1000 μg/mL). One unit of protease was defined as the amount of enzyme that liberates 1μg tyrosine mL/min from casein [49].

Polyacrylamide gel electrophoresis (PAGE)

Proteins were resolved on the 12.5% continuous gel system [49]. The Tris-glycine buffer system at pH 8.8 was used to determine purity and molecular weight. The predetermined molecular weight markers of 44.3 KDa, 66.4 KDa, 97.2KDa, 116 KDa, and 200 KDa protein mixtures were loaded in the marker lane while the purified proteins were added to the gel in different wells. In individual wells, the uniduced and induced Ni-NTA purified protein was loaded along with crude protein from E.coli without insert. The gel was allowed to run in Tris-glycine buffer at 30 mA constant current for 2.5 h. After electrophoresis, the gel was stained with Coomassie Brilliant Blue R-250, and the molecular weight of the separated proteins was determined by comparing them with molecular weight standards.

Characterization of the purified proteins

Effect of pH and temperature on enzyme activity

The effect of pH on protease, chitinase, and fusion protein activities was recorded in various buffers of varying pH in the range of 5.0–9.0. The buffers used were sodium acetate buffer (pH 5.0 and 6.0), phosphate buffer (pH 7.0), and Tris–HCl buffer (pH 8.0 and 9.0). The 70 μL purified proteins were separately incubated in the respective buffers at 30°C for 30 min, and the pH stability and residual enzyme activities were measured as described earlier. The effect of temperature on the activity of purified proteins was measured at different temperatures in the range from 20°C to 50°C. The purified proteins were separately incubated in phosphate buffer (pH 7) at various temperatures for 30 min, and the thermal stability and residual enzyme activities were measured as described earlier.

Effect of metal ions, detergent, and organic solvent on enzyme activity

The effect of metal ions on enzyme activity was analyzed using varying concentrations (1 to 100 mM) of metal ions like Co2+, Zn2+, Ca2+, Mg2+, Na2+, Cu2+, and Fe2+. The respective concentrations of these metal ions were separately added into each reaction mixture, followed by the addition of the purified protein 70 μL/enzyme. The stability and activities of these enzymes were measured as described earlier. Enzyme activities were measured as described earlier. The effects of various detergents (β-Mercaptoethanol, Ethylene diamine tetra acetic acid, Sodium dodecyl sulfate, Tween 20) and organic solvents (glycerol, acetone, ethanol, methanol, butanol, and isopropanol) on the stability and activities of purified enzymes was studied by separately adding two concentration (1% and 5%) of these detergents and solvents into the reaction mixture followed by adding 70 μL purified protein [50, 51]. The enzyme activities in the absence of metal ions, detergents, and solvents were considered 100%. The percentage relative activity of enzymes was measured by dividing chemical influenced activity by enzyme activity without adding chemicals [51].

Statistical analysis

All the experiments were carried out in five replicates, and the average of five replicates was analyzed using the Student’s t-test, and the values of p≤0.05 were considered statistically significant using SPSS Statistics for Windows, version x. 0 (SPSS Inc., Chicago, Ill., USA) [52].

Results

Vector construction for fusion gene with the linker

The molecular size of an amplified fragment of protease and chitinase, as evident from agarose gel electrophoresis (Fig 2A and 2B), was 1.3 kb and 1.2 kb, respectively. The comparison of fragment size and gene sequences was done with their respective sequences in the database, which confirmed the molecular weight and the size of gene sequences. The regulatory sequence of 300 bases and the BamH1 restriction site at 5’end was ligated with individual genes. The overlapping PCR containing (G4S) 2linker was used to get a single polynucleotide sequence with a bicistron of 2.9 Kb (Fig 2B). The bicistron (Fused gene product) and monocistron (Single gene) were treated with BamH1 and KpnI to get sequences ready for ligation into the vector. The vector pUC18- Tn7 mini was double digested with BamHI and KpnI (Fig 2C) and incubated with individual genes and fusion product for the ligation. The orientation and accuracy of ligation were confirmed by restriction digestion with respective enzymes (Fig 2C).
Fig 2

(A) Agarose gel electrophoresis of protease and chitinase gene amplicon. Lane 1 corresponds to ladder, and Lane 2 and 4 indicate the presence of the protease gene (1.3 kb) and chitinase gene (1.2 kb), respectively; (B) Lane 1 represents DNA ladder, lane 2 to 5 represents overlapping PCR product of 2.9 kb; (C) The pUC18miniTn7FusionX Clone confirmation, Lane1- ladder, Lane 2- Unknown, Lane 3- pUC18miniTn7FusionX linearised for cloning, Lane 4- pUC18 MiniTn7 FusionX digested with BamHI and KpnI showing the insert release of 2.9 kb.

(A) Agarose gel electrophoresis of protease and chitinase gene amplicon. Lane 1 corresponds to ladder, and Lane 2 and 4 indicate the presence of the protease gene (1.3 kb) and chitinase gene (1.2 kb), respectively; (B) Lane 1 represents DNA ladder, lane 2 to 5 represents overlapping PCR product of 2.9 kb; (C) The pUC18miniTn7FusionX Clone confirmation, Lane1- ladder, Lane 2- Unknown, Lane 3- pUC18miniTn7FusionX linearised for cloning, Lane 4- pUC18 MiniTn7 FusionX digested with BamHI and KpnI showing the insert release of 2.9 kb.

Estimation of enzyme activities of different constructs

The zone of hydrolysis of casein was observed on the azocasien agar plate around the bacterial colonies (Fig 3A) and while the addition of 0.1% congo red on the chitin agar plate showed the zone of hydrolysis of chitin (Fig 3B).
Fig 3

(A and B) Activity assay of recombinant bacteria having different constructs. A = PRI—Protease, FP- Protease activity in the fusion construct. B = CHI-chitinase, FCH-chitinase activity in fusion construct.

(A and B) Activity assay of recombinant bacteria having different constructs. A = PRI—Protease, FP- Protease activity in the fusion construct. B = CHI-chitinase, FCH-chitinase activity in fusion construct.

Protein gel electrophoresis

The recombinant fusion protein on native PAGE revealed 92 KDa, distinct protein bands, suggesting that the enzyme is a monomer and intact (Fig 4). The fusion protein was mixed with the control protein of known molecular weight, and in both lanes, it showed the band’s presence at the same place. The unknown protein was added with the protein of interest to confirm protein stability.
Fig 4

Native PAGE of fusion proteins expressed by E.coli.

Lane 1- Protein marker (44.3 KDa, 66.4 KDa, 97.2KDa, 116 KDa, and 200 KDa), Lane 2- Sample purified using Ni-NTA column without IPTG induction; Lane 3-Sample purified using Ni-NTA column with IPTG induction; Lane 4- Crude protein without insert. Proteins were resolved on the 12.5% PAGE with standard molecular weight markers. The gel was allowed to run in Tris-glycine buffer at 30 mA constant current for 2.5 h followed by staining with Coomassie Brilliant Blue R-250. The molecular weight of the separated proteins was determined by comparing them with molecular weight standards.

Native PAGE of fusion proteins expressed by E.coli.

Lane 1- Protein marker (44.3 KDa, 66.4 KDa, 97.2KDa, 116 KDa, and 200 KDa), Lane 2- Sample purified using Ni-NTA column without IPTG induction; Lane 3-Sample purified using Ni-NTA column with IPTG induction; Lane 4- Crude protein without insert. Proteins were resolved on the 12.5% PAGE with standard molecular weight markers. The gel was allowed to run in Tris-glycine buffer at 30 mA constant current for 2.5 h followed by staining with Coomassie Brilliant Blue R-250. The molecular weight of the separated proteins was determined by comparing them with molecular weight standards.

Expression and purification of proteins

Estimation of crude chitinase activity and protease activity of the recombinant expressing fusion protein revealed 1.05 folds and 1.27 folds (Table 2) increase over the individual constructs of these enzymes. Ni-NTA purified protein in the recombinant expressing fusion protein exhibited a 1.60 fold and 6.87 fold increases in the activities of chitinase and protease, respectively.
Table 2

The activity of recombinant proteins expressed in E.coli.

EnzymeStageUnit (μM/mL/min)Total volume (mL)Total activity (Unit/mL)Specific activity (Unit/mg)Fold purification
Protease ConstructCrude2.53100253.114.711.0
Ni-NTA column3.581553.713.870.94
Protease of fusion ConstructCrude3.21100321.418.691.0
Ni-NTA column5.721585.822.171.18
Chitinase ConstructCrude0.031002.90.171.0
Ni-NTA column0.16152.40.623.68
Chitinase of fusion ConstructCrude0.031003.10.181.0
Ni-NTA column1.10151.50.382.11

Characterization of purified protein

The effect of pH and temperature on enzyme activity

The activities of recombinant proteins were stable at different pH in a different buffer. The purified fusion protein’s optimal chitinase and protease activities were observed at pH 5.0 and 8.0, respectively (Fig 5A). Whereas the optimum temperature for the activity of purified fusion protein was found to be 30°C for both the enzyme of fusion proteins (Fig 5B). The pH and temperature optima of the fusion protein were similar to the individual proteins.
Fig 5

Activities of the purified proteins at pH 5–9 Values are the average of five replicates and significant at P<0.05 (A); Activities of the purified proteins at 20–50°C. Values are the average of five replicates and significant at P<0.05 (B).

Activities of the purified proteins at pH 5–9 Values are the average of five replicates and significant at P<0.05 (A); Activities of the purified proteins at 20–50°C. Values are the average of five replicates and significant at P<0.05 (B).

Effect of metal ions, detergents, and organic solvents on enzyme activity

The presence of Na2+, Ca2+ and Cu2+ at 5 mM, and 10 mM concentrations significantly enhanced the protease activity. Metal ions such as Fe2+, Mg2+, and Zn2+ also improved the enzyme activities (Fig 6A). However, Na2+ at 5mM concentration showed enhanced chitinase activity compared to the other cations (Fig 6B). The presence of organic solvents drastically affected chitinase and protease activity in the purified fusion protein. The concentration of 1% acetone and butanol caused 40% inhibition in chitinase activity. A higher concentration (5%) of acetone drastically affected the activities of both enzymes (Fig 6C). Thus, the organic solvents showed negative impacts on the activities of both the enzyme. The purified chitinase retained 80% activity and 65% activity from its uninoculated control at 1% SDS and 5% SDS. There was a noticeable reduction in the activity of protease at both concentrations of EDTA. The addition of 2-mercaptoethanol, Tween 20 and EDTA (1%) caused a more than 50% reduction in the activity of both enzymes (Fig 6D).
Fig 6

The effect of various metal ions (5–10 mM) on the activity of the protease and chitinase.

Values are the average of five replicates and significant at P<0.05 (A). The effect of various metal ions (5 mM and 10 mM) on the activity of chitinase. (B). Effect of denaturing agents and organic solvents at 1% and 5% on protease activity C). Effect of denaturing agents and organic solvents (1% and 5% of each) on chitinase activity (D).

The effect of various metal ions (5–10 mM) on the activity of the protease and chitinase.

Values are the average of five replicates and significant at P<0.05 (A). The effect of various metal ions (5 mM and 10 mM) on the activity of chitinase. (B). Effect of denaturing agents and organic solvents at 1% and 5% on protease activity C). Effect of denaturing agents and organic solvents (1% and 5% of each) on chitinase activity (D).

Discussion

The fragment size and gene sequences of an amplified fragment of protease and chitinase with their respective sequences in the database confirmed the molecular weight and the size of gene sequences. The map is showing the transcription termination signal, fusion gene construct and ampicillin resistant gene. The regulatory sequence of 300 bases and the BamH1 restriction site at 5’end was ligated with individual genes. The formation of the fusion product indicated the successful ligation of individual chitinase and protease genes to form a fusion protein. The gel band of 2.9 kb size further confirmed the presence of the fusion gene sequence in the correct orientation. Growth of transformant E. coli BL21 (DE3) on chitin and casein agar plates indicated that three constructs were successfully transformed into it. Formation of the zone of hydrolysis of casein on azocasien agar plate and chitin on chitin agar plate surrounding the transformant E.coli indicated the successful expressions of chitinase and protease. The over expression of recombinant protein under IPTG induction at low temperature increases stability and solubility. Incubation period between 48–72 h yields maximum protein. The 48 h incubated samples achieved sufficient microbial concentration and low concentration of IPTG for longer time will gives better protein yield. This will lead to proper folded and biologically active protein production with least inclusion bodies formation. The presence of fusion protein of 92 kDa on native PAGE suggested that the bifunctional enzyme is a monomer and intact. The present study results agree with the molecular weight of 44.4 KDa for SmChiD chitinase reported in Serratia marcescens [53] and 46 kDa for alkaline protease reported in Bacillus circulans [27]. Thus, the PAGE analysis confirms the respective size protein expressed. Mixing the fusion protein with control protein of known molecular weight followed by electrophoresis showed the band’s presence at the same place, i.e., 92 kDa indicated that a product with higher molecular weight could be efficiently expressed without any change in its activity. Sometimes, heterogonous expression of higher molecular weight proteins leads to truncated protein expression. Protein with lower molecular mass increases the stability during the post-translation stage. Various bacterial chitinase from a wide range of bacteria is possessed lower molecular mass [3, 7, 13]. The purified chitinase of B. licheniformis and S. maltophila have been reported to have molecular weights 71 kDa and 70.5 kDa, respectively [54, 55]. Increased activities of chitinase (1.60 fold) and protease (1.10 fold) in the recombinant E. coli BL21 (DE3) expressing fusion protein indicated improved activities of both enzymes in fusion construct showed enhanced activity towards the substrate. No confirmation changes occurred during the fusion of the individual proteins [56]. The thick outer membrane and limited secretion signals restrict the expression of heterogonous proteins in E.coli. However, the ompA signal sequence was successfully employed in the present study to target protein to the extracellular site. ompA sequence has been efficiently utilized to secretion exoglucanase of C. fimi from E. coli [57]. Improved enzyme activities following the cloning of genes have been reported by several scientists [58, 59]. The SmChiD can break down colloidal chitin in a time-dependent manner with a very low rate and produce DP2 as a significant end product [53, 58]. The chitinase used in the present study belongs to the endo acting class; it generated both reducing and non-reducing ends. The chitinase-C and N-acetyl hexosaminidase of S. coelicolor has been reported to give 90% pure GlcNAc from crab shell chitin after 8 h incubation [59]. The ChiA, ChiB, and ChiC of S. marcescens act synergistically to break chitin proficiently and give GlcNAc a major product [58, 60]. The Chi D used in the present study of S. marcescens is, an endo enzyme that produces non-reducing and reducing ends. The complete lysis of insoluble chitin requires the activity of multiple enzymes and a longer incubation time to get GlcNAc [59]. The present study reports 1 h incubation period for complete degradation of chitin into GlcNAc vis-à-vis 4 h incubation reported earlier. However, a longer incubation time will serve the purpose of breakdown complex chitin into its monomers. The stability of activities of recombinant proteins over the range of pH and temperature optima indicated that chitinase and protease activity of fusion protein is more stable, remain more active, and retain the activities over the range of pH and temperature as compared to their counterparts [27, 53]. Other scientists have reported similar pH optima of recombinant chitinase for PbChi70 of Paenibacillus barengoltzii and M. timonae, respectively [13, 61]. The mesophilic temperature optima for protease and chitinase may be due to the mesophilic nature of the producing organisms. The results are in agreement with the work reported for chitinase of Stenotrophomonas maltophilia [55], Bacillus licheniformis N1 [62], and Thermoanaerobacter tengcongensis [63]. The serine alkaline protease Alp from Acinetobacter sp. IHB B 5011 (MN12) was cloned and expressed in E. coli BL21 (DE3) using the N-terminal signal sequence [25]. Similarly, a serine protease from Bacillus sp.WRD-2 was cloned and expressed into E.coli [64]. Improved enzyme activities in the presence of Na2+, Ca2+ and Cu2+, and Zn2+ are due to the requirement of metal ions for optimum enzyme activities. Enhanced activities protease and chitinase in the presence of Ca2+ ions indicated the requirement of this metal ion for the activities of these enzymes as EDTA chelate divalent cations. Similar observations have been reported in alkaliphilic Bacillus pumilus MCAS8 [65] and Caldicoprobacter guelmensis [66]. The inhibition of enzyme activities in the presence of solvents and chemicals is due to the denaturation of proteins by these solvents and chemicals. An et al. [64] reported inhibition of intracellular serine protease of Bacillus sp. WRD-2 in the presence of organic solvents. The inhibitory effect of organic solvents on recombinant alkaline protease and subtilisin was observed by scientists [67, 68]. Similarly, a reduction in alkaline protease activity from Bacillus cereus in the presence of isopropanol, methanol, ethanol, and butanol was reported [69]. The glycine-serine linker is flexible and helps in the proper folding of the enzymes. The fusion of three catalytic domains with a (G4S) 3 flexible linker showed trifunctional cellulase activity in Saccharomyces cerevisiae [43]. They found the higher activity of fusion protein as compared to individual clones. There was a successful fusion of B. subtilis expansin EXLX1 and Clostridium thermocellum endoglucanase CelD genes with a linker of different lengths and observed the highest enzyme activities in the fusion protein [70]. The fusion of two enzymes brings the active site together, and the product of one enzyme-catalyzed reaction will be immediately utilized as a substrate for the other. These strategies will be helpful for the biotransformation of various raw materials by generating a fusion of enzymes from different pathways. In the present studies, an active bifunctional protein was constructed, which presented the activities of chitinase and protease, respectively, through specific substrate analysis. E.coli has been the host of choice for cloning and heterologous expression of a wide range of proteins. Due to its well-studied genetics, faster growth rate, ability to grow on cost-effective media, safety, ample availability of vectors, ease in extracellular production using signal sequences, and convenient in the extraction of the product, E.coli is preferred over the other hosts. The fusion and Co-expression of endoglucanase and beta-glucosidase were successfully carried out in E.coli [36]. Several other reports indicating fusion and co-expression of proteins belong to endoglucanase and β-glucosidase for hydrolyzing sugarcane bagasse [38]. Thus chitinase and protease can be successfully fused and expressed in E.coli without changing their catalytic activities, properties, and kinetics. However, more studies on kinetics, molecular aspects, and protein characterization are required to claim the success of fusion protein.

Conclusion

Heterologous expression of the fusion protein is successfully carried out by using a pUC18-T7 mini vector with an ompA signal sequence. The bicistronic vector expresses fusion protein using glycine-serine linker as a single peptide appears to be a feasible and cost-effective approach of combining two enzymes in a single protein. A single fusion protein exhibiting the activities of two enzymes can effectively degrade the complex substrates made up of chitin and protein. Improved activities of these enzymes in fusion protein offer higher biodegradation rates than the biodegradation by a single enzyme. Moreover, the biodegradation of chitin mediated by fusion protein holds merits in terms of safety, higher productivity, and the formation of a good number of monomers. Cloning of genes of two enzymes in the fast-growing host that also gives better co-expression, higher enzyme yield, and improved activities compared to individual enzymes will have more and broader applications. This report is the first report on a single fusion protein that has chitinase and protease activities. However, further studies on enzyme kinetics, molecular studies on genes involved, and studies on protein structure may further enhance the activities, yield, and stability of fusion under diverse physicochemical conditions. (JPG) Click here for additional data file. (JPG) Click here for additional data file. (JPG) Click here for additional data file. (JPG) Click here for additional data file. (PDF) Click here for additional data file. 26 Jan 2022
PONE-D-21-39132
Formation of Recombinant Bifunctional Fusion Protein: A Newer Approach to Combine The Activities of Two Enzymes in A Single Protein
PLOS ONE Dear Dr. Sayyed , Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Mar 12.2022. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Rahul Datta Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf. 2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. 3. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please ensure that your ethics statement is included in your manuscript, as the ethics statement entered into the online submission form will not be published alongside your manuscript. Additional Editor Comments: The manuscript reports some interesting results but presents some flaws as indicated by the reviewers. I believe that the presentation can certainly be improved. The article some potential, so I recommend major revision for the article. Authors must reply at the questions raised by reviewers that will largely improve the manuscript. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: 1) Line 39 - The complete biodegradation of chitin-protein-containing waste requires the action of….. Rephrase as - The complete biodegradation of chitin and protein-present in the waste requires the action of 2) Line 43-44 – alkaline protease – why italics 3) Line 49- the - why italics 4) Cu+2, Na+2, and Ca+2- should be revised as Cu2+, Na2+, and Ca2+ 5) Line 64 – add spacing before [1] 6) Line 71- Phytopathogens – phytopathogens 7) Line 77- [3,10,19,11-18] - [3,10-18]. 8) Line 128 – 129 - use proper symbol 9) Line 134 – add space before bp 10) Line 155 – add space after before μg/ml 11) Use proper symbols of ml consistently as mL g/l as g/L, μg/ml as μg/mL, µM/ml as µM/mL, ml/min as mL/min etc 12) Line 189-replace and with was 13) Line 196 – method of [48]? 14) Line 211 – E.Coli ? 15) Line 229 - Co+ , Zn+ , Ca+ , Mg+ , Na+ , Cu+ , Fe+ - ?? 16) Line (β-Mercaptoethanol, Ethylene diamine tetra acetic acid, Sodium dodecyl sulfate – use consistent lower/upper case 17) Line 242-244- Mention the name of statistical software 18) Line 251 – the? 19) Line 307 – Add space before oC 20) Line 330 5mM – add space before mM 21) Legend of Fig 6 – use proper upper/lower cases 22) Line 345 – ampicillin resistant gene (Fig 6)….delete (Fig 6) 23) Line 354-355 - One can take anywhere between 48-72 h incubates samples to get maximum protein is not clear 24) Line 373-the omp ? 25) Line 383 - S. marcescensis -? 26) Line 386- 1 hour – 1 h 27) Line 397 Add space before [63] 28) Line 403- Ca2+ - ? 29) Line an – why italics? Reviewer #2: Formation of Recombinant Bifunctional Fusion Protein: A Newer Approach to Combine by Patel et al. deals with the fusion of two protein genes to form a single fusion protein having activities of two enzymes. This paper deals with the fusion of two enzymes namely; chitinase and protease to form a single fusion protein having the activity of these two enzymes. The authors have checked the activities of chitinase and protease in a single fusion protein. The paper is well written. Abstract summarizes the objectives, significance and outcome of the study Introduction is relevant Methodologies are scientific and sufficiently described Results are well written Discussion is up to the mark However, I would recommend accepting the paper after minor revision. Comments: Line 43-44 – alkaline protease – why italics Cu+2, Na+2, and Ca+2- should be revised as Cu2+, Na2+, and Ca2+ Line 128 – 129 - use proper symbol Units are not properly mentioned example - mL g/l, μg/ml, µM/ml, ml/min etc Line 196 – cite the name of reference Write proper names of microorganisms Example Line 211 – E.Coli and Line 383 - S. marcescensis Symbols of metal ions are not properly written example - Line 229 Line 242-244- Name of statistical software is missing Discussion part should not have the mention of result - Line 345 – (Fig 6) Line 354-355 – rephrase Line 403- Ca2+ - ? ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. Submitted filename: PONE.pdf Click here for additional data file. 6 Feb 2022 Response to Reviewers' comments Reviewer 1# 1) Line 39 - The complete biodegradation of chitin-protein-containing waste requires the action of….. Rephrase as - The complete biodegradation of chitin and protein-present in the waste requires the action of Response:- Line has been edited 2) Line 43-44 – alkaline protease – why italics Response:- Italics has been removed 3) Line 49- the- why italics Response:-Italics has been removed 4) Cu+2, Na+2, and Ca+2- should be revised as Cu2+, Na2+, and Ca2+ Response:- Corrected as per the suggestions 5) Line 64 – add spacing before [1] Response:- Added 6) Line 71- Phytopathogens – Phytopathogens Response:-The fungus is phytopathogenic thus they tend to cause disease. 7) Line 77- [3,10,19,11-18] - [3,10-18]. Response:- Corrected 8) Line 128 – 129 - use proper symbol Response:- 0C has been written properly 9) Line 134 – add space before bp Response:- Space has been added 10) Line 155 – add space after before μg/ml Response :- Corrected 11) Use proper symbols of ml consistently as mL g/l as g/L, μg/ml as μg/mL, µM/ml as µM/mL, ml/min as mL/min etc Response:- The corrections made in entire MS. 12) Line 189- replace and with was Response:- corrected 13) Line 196 – method of [48]? Response:- It was Aretz 1989 ..corrected 14) Line 211 – E.Coli ? Response:- The protein was expressed in E.Coli thus control with and without induction was taken. 15) Line 229 - Co+ , Zn+ , Ca+ , Mg+ , Na+ , Cu+ , Fe+ - ?? Response :- Corrected as per the suggestions 16) Line (β-Mercaptoethanol, Ethylene diamine tetra acetic acid, Sodium dodecyl sulfate – use consistent lower/upper case Response:- Corrected 17) Line 242-244- Mention the name of statistical software Response:- SPSS was used for this. 18) Line 251 – the? Response:- Corrected 19) Line 307 – Add space before oC Response:- Corrected 20) Line 330 5mM – add space before mM Response:- Corrected 21) Legend of Fig 6 – use proper upper/lower cases Response:- Corrected 22) Line 345 – ampicillin resistant gene (Fig 6)….delete (Fig 6) Response:- figure 6 has been deleted 23) Line 354-355 - One can take anywhere between 48-72 h incubates samples to get maximum protein is not clear Response:- Lower IPTG concentration for longer time give little expression yet soluble protein in the solution thus least chances of protein aggregates or inclusion bodies for mation. 24) Line 373- the omp? Response: - Corrected 25) Line 383 - S. marcescensis -? Response:- corrected S. marcescens 26) Line 386- 1 hour – 1 h Response:- Corrected 27) Line 397 Add space before [63] Response:- Corrected 28) Line 403- Ca2+ - ? Response:- Corrected 29) Line an – why italics? Response:- Corrected Reviewer 2# 1) Line 43-44 – alkaline protease – why italics Response:- Corrected 2) Cu+2, Na+2, and Ca+2- should be revised as Cu2+, Na2+, and Ca2+ Response:- Corrected 3) Line 128 – 129 - use proper symbol Response:- Corrected 4) Units are not properly mentioned example - mL g/l, μg/ml, µM/ml, ml/min etc Response:- Corrected 5) Line 196 – cite the name of reference Response:- Corrected 6) Write proper names of microorganisms Example Line 211 – E.Coli and Line 383 - S. marcescens is Response:- E.coli 7) Symbols of metal ions are not properly written example - Line 229 Response:- Corrected as per Cu2+, Na2+, and Ca2+ 8) Line 242-244- Name of statistical software is missing Response:- SPSS 9) Discussion part should not have the mention of result - Line 345 – (Fig 6) Response :- Line and map has been deleted 10) Line 354-355 – rephrase Response : Rephrased as :- Incubation period between 48-72 h yields maximum protein. The 48 h incubated samples achieved sufficient microbial concentration and low concentration of IPTG for longer time will gives better protein yield. This will lead to proper folded and biologically active protein production with least inclusion bodies formation. 11) Line 403- Ca2+ - ? Response:- Corrected as Ca2+ Submitted filename: Response to Reviewers.docx Click here for additional data file. 3 Mar 2022
PONE-D-21-39132R1
Formation of Recombinant Bifunctional Fusion Protein: A Newer Approach to Combine The Activities of Two Enzymes in A Single Protein
PLOS ONE Dear Dr. Riyazali Zafarali Sayyed , Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Apr 17 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Rahul Datta Academic Editor PLOS ONE Journal Requirements: Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. Additional Editor Comments (if provided): The error bar in the figure is not explained it seems it correspond to the SD which does not make any sense, that is merely for decorative purpose. I highly recommend using a 95% confidence interval instead of a Standard deviation, in the error bar.
5 Mar 2022 Response to Editor’s note# The error bar in the figure is not explained it seems it correspond to the SD which does not make any sense, that is merely for decorative purpose. I highly recommend using a 95% confidence interval instead of a Standard deviation, in the error bar. Response: The error bars indicate standard deviation. Corrections have been made in Fig 5 and 6 Submitted filename: Response to Reviewers.docx Click here for additional data file. 11 Mar 2022 Formation of Recombinant Bifunctional Fusion Protein: A Newer Approach to Combine The Activities of Two Enzymes in A Single Protein PONE-D-21-39132R2 Dear Dr. Sayyed, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Rahul Datta Academic Editor PLOS ONE 23 Mar 2022 PONE-D-21-39132R2 Formation of Recombinant Bifunctional Fusion Protein: A Newer Approach to Combine The Activities of Two Enzymes in A Single Protein Dear Dr. Sayyed: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Rahul Datta Academic Editor PLOS ONE
  57 in total

1.  Optimizing the expression of a Heterologous chitinase: A study of different promoters.

Authors:  Abigail F da Silva; Belén García-Fraga; Jacobo López-Seijas; Carmen Sieiro
Journal:  Bioengineered       Date:  2016-11-28       Impact factor: 3.269

2.  Characterization of thermostable serine alkaline protease from an alkaliphilic strain Bacillus pumilus MCAS8 and its applications.

Authors:  Renganathan Jayakumar; Shanmugam Jayashree; Balumuri Annapurna; Sundaram Seshadri
Journal:  Appl Biochem Biotechnol       Date:  2012-10-18       Impact factor: 2.926

3.  Proteolytic enzymes from recombinant Streptomyces lividans TK24.

Authors:  W Aretz; K P Koller; G Riess
Journal:  FEMS Microbiol Lett       Date:  1989-11       Impact factor: 2.742

4.  Cloning, purification, and characterization of chitinase from Bacillus sp. DAU101.

Authors:  Yong-Seok Lee; In-Hye Park; Ju-Soon Yoo; Soo-Yeol Chung; Young-Choon Lee; Young-Su Cho; Soon-Cheol Ahn; Cheol-Min Kim; Yong-Lark Choi
Journal:  Bioresour Technol       Date:  2006-11-14       Impact factor: 9.642

Review 5.  Bacterial alkaline proteases: molecular approaches and industrial applications.

Authors:  R Gupta; Q K Beg; P Lorenz
Journal:  Appl Microbiol Biotechnol       Date:  2002-04-20       Impact factor: 4.813

6.  Combining chitinase C and N-acetylhexosaminidase from Streptomyces coelicolor A3(2) provides an efficient way to synthesize N-acetylglucosamine from crystalline chitin.

Authors:  Nhung Nguyen-Thi; Nicolas Doucet
Journal:  J Biotechnol       Date:  2016-01-06       Impact factor: 3.307

Review 7.  Detergent alkaline proteases: enzymatic properties, genes, and crystal structures.

Authors:  Katsuhisa Saeki; Katsuya Ozaki; Tohru Kobayashi; Susumu Ito
Journal:  J Biosci Bioeng       Date:  2007-06       Impact factor: 2.894

8.  Exploring specific primers targeted against different genes for a multiplex PCR for detection of Listeria monocytogenes.

Authors:  Ashwani Kumar; Sunita Grover; Virender Kumar Batish
Journal:  3 Biotech       Date:  2014-05-21       Impact factor: 2.406

9.  Catalytic efficiency of chitinase-D on insoluble chitinous substrates was improved by fusing auxiliary domains.

Authors:  Jogi Madhuprakash; Nour Eddine El Gueddari; Bruno M Moerschbacher; Appa Rao Podile
Journal:  PLoS One       Date:  2015-01-23       Impact factor: 3.240

10.  Characterization of a cold-active esterase from Serratia sp. and improvement of thermostability by directed evolution.

Authors:  Huang Jiang; Shaowei Zhang; Haofeng Gao; Nan Hu
Journal:  BMC Biotechnol       Date:  2016-01-22       Impact factor: 2.563

View more
  2 in total

1.  Evaluation of Plant Growth-Promoting and Salinity Ameliorating Potential of Halophilic Bacteria Isolated From Saline Soil.

Authors:  Chintan Kapadia; Nafisa Patel; Ankita Rana; Harihar Vaidya; Saleh Alfarraj; Mohammad Javed Ansari; Abdul Gafur; Peter Poczai; R Z Sayyed
Journal:  Front Plant Sci       Date:  2022-07-15       Impact factor: 6.627

2.  Retraction: Formation of recombinant bifunctional fusion protein: A newer approach to combine the activities of two enzymes in a single protein.

Authors: 
Journal:  PLoS One       Date:  2022-08-31       Impact factor: 3.752

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.