The whitefly, B.tabaci is a major pest of agricultural crops which transmits begomovirus in a species-specific manner. Yellow vein mosaic disease (YVMD) and okra leaf curl disease (OLCD) caused by distinct begomovirus are a major limitation to production of okra in India. In this framework the present investigation reports, for the first time, comparative study of begomovirus species viz. yellow vein mosaic virus (YVMV) and okra enation leaf curl virus (OELCuV) ingested and egested by two cryptic species (Asia I and Asia II 5) of B.tabaci at different time interval using detached leaf assay. A gradual increase of both virus copies were observed with increased feeding exposure in Asia I and Asia II 5. Both the genetic groups of whitefly could acquire the viruses within just 5 minutes of active feeding however, a significant amount of variation was noted in virus uptake by the both. At 24 hours of active feeding Asia II 5 acquired more of YVMV whereas, Asia I ingested more OELCuV. Similarly, the genetic group acquiring higher titre of virus egested higher amount during inoculation period. On the whole, it can be presumed that Asia I is a more effective transmitter of OELCuV whereas, Asia II 5 of YVMV further suggesting increased risk of virus pandemics (both YVMV and OELCuV) in regions where Asia I and Asia II 5 is dominant.
The whitefly, B.tabaci is a major pest of agricultural crops which transmits begomovirus in a species-specific manner. Yellow vein mosaic disease (YVMD) and okra leaf curl disease (OLCD) caused by distinct begomovirus are a major limitation to production of okra in India. In this framework the present investigation reports, for the first time, comparative study of begomovirus species viz. yellow vein mosaic virus (YVMV) and okra enation leaf curl virus (OELCuV) ingested and egested by two cryptic species (Asia I and Asia II 5) of B.tabaci at different time interval using detached leaf assay. A gradual increase of both virus copies were observed with increased feeding exposure in Asia I and Asia II 5. Both the genetic groups of whitefly could acquire the viruses within just 5 minutes of active feeding however, a significant amount of variation was noted in virus uptake by the both. At 24 hours of active feeding Asia II 5 acquired more of YVMV whereas, Asia I ingested more OELCuV. Similarly, the genetic group acquiring higher titre of virus egested higher amount during inoculation period. On the whole, it can be presumed that Asia I is a more effective transmitter of OELCuV whereas, Asia II 5 of YVMV further suggesting increased risk of virus pandemics (both YVMV and OELCuV) in regions where Asia I and Asia II 5 is dominant.
The whitefly, Bemisia tabaci, an economically important agricultural pest that causes huge damage to crops worldwide both directly and as a vector of nearly 120 geminivirus, which includes Begomovirus, Crinivirus, Closterovirus etc. [1]. B.tabaci is listed among the top 100 dreadful alien invasive species [2]. The global distribution of this species ranges from tropical, subtropical, and temperate regions [3]. B.tabaci is considered to be a highly variable species complex having their own genetic characteristics which differed in virus transmission ability, host plant preferences, fecundity and even insecticide resistance [3]. The interactions between plants, whitefly and begomoviruses have been drawing attention of researches for the last five decades [4]. Based on genome organization, host diversity and vector specificity, the members in the family Geminiviridae were earlier classified into four genera: Mastrevirus, Curtovirus, Topocuvirus and Begomovirus [5]. According to the recent report of International Committee on Taxonomy of Viruses (ICTV), the Geminiviridae family constitutes of nine genera embracing >360 species. Moreover, recent metagenomic studies have led to the establishment of five new genera under the family Geminiviridae (Citlodavirus, Maldovirus, Mulcrilevirus, Opunvirus, and Topilevirus [6]. Viruses in the genera Becurtovirus, Capulavirus, Curtovirus, Eragrovirus, Grablovirus, Mastrevirus, Topocuvirus and Turncurtovirus have monopartite genomes, whereas those in the genus Begomovirus have mono- or bipartite genomes [7].Begomovirus, transmitted exclusively by whiteflies in a persistent- circulative manner has emerged as a serious threat to the production of many vegetable crops [8, 9]. Plants infected with begomovirus exhibit typical symptoms like leaf curling, vein yellowing, yellow mosaic, stunting and vein thickening. The whitefly ingests these begomovirus by injecting its stylet in the vascular tissue [10]. Post ingestion the virus particles are translocated through the digestive system of the vector into the haemolymph. Subsequently the virus gets stored in the salivary glands from where it is egested into the phloem. Transmission of begomovirus like tomato yellow leaf curl virus (TYLCV), chilli leaf curl virus (ChiLCV) have been well documented in crops like tomato, chilli, pumpkin etc. However, not much emphasis is laid on yellow vein mosaic virus (YVMV) and okra enation leaf curl virus (OELCuV) both monopartite virus and a major threat to okra cultivation in India [11-14]. So far ten cryptic species of the B.tabaci complex have been recorded in India. The B.tabaci fauna distributed across the Indian subcontinent with Asia I and Asia II 5 predominantly occurring in eastern provinces [15]. Studies reveal that the prevalence of different genetic groups of B.tabaci adds to the complexity as transmission efficacy of the virus is different for different genetic group/ strain [16].While there are researches highlighting the epidemiology and transmission of these begomovirus by B.tabaci species complex, the number of copies ingested or egested by individual whitefly has not been studied yet. In this light the present study was designed to measure the viral copies (YVMV and OELCuV) acquired and inoculated by Asia I and Asia II 5 whitefly using leaf detach assay. The findings will have significant implications in better understanding of the virus epidemiology while providing a comparative idea regarding the virus-vector relationship of two genetic groups of whitefly.
Materials and methods
Insect vector
Cultures of two different cryptic species (Asia I and Asia II 5) of B. tabaci complex were initially collected from two localities of Bengal province and maintained on eggplant (var. Samrat) for establishing a uniform population. For identification, the homogenous population was characterized by using mitochondrial cytochrome oxidase subunit I (mt-COI). The population was kept in regulated environmental conditions at 26 ± 2˚ C, 70 ± 10% RH, and 16 hrs light/8 hrs dark photoperiod in Molecular biology laboratory, Directorate of Research, BCKV and considered as stock culture. The purity of each culture was carefully maintained and further confirmed by sequencing of 5–10 whitefly individuals of both genetic group using mt-COI gene at every 15 days interval. During the course of experiment the whitefly populations were repetitively tested in PCR for confirmation of its aviruliferous status. The newly emerged adult females were collected by using an aspirator for further experiments.
Virus isolates
The pure culture of both YVMV and OELCuV isolates has been maintained separately at molecular biology laboratory, BCKV. Both the begomovirus were maintained in separate okra plants (var. MONA 002) by B. tabaci-inoculation in two different insect proof cages. Begomoviruses maintained in separate cages were confirmed by using YVMV and OELCuV gene specific primer. Cross check of the inoculated plants were done during the course of experimentation to avoid any mixed infection.
Identification of B. tabaci and begomoviruses
Extraction of DNA from the samples (both whitefly and inoculated okra plant) was conducted with the help of Genomic DNA Isolation Kit (Sigma-Aldrich, St Louis, USA). DNA samples were checked for its purity and concentration using Nano Drop 1000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) and the eluted product was stored at −80°for further use. Molecular identification of both homogeneous whitefly population and begomoviruses were done by using specific primer (mt-COI gene for whitefly and coat protein for Begomoviruses) listed in Table 1.
Table 1
List of primer pairs used in the study.
Primer name
Primer sequence (5’-3’)
Melting temperature (˚C)
Primer name
Primer sequence (5’-3’)
Amplicon size (bp)
Target region
C1-J- 2195
TTGATTTTTTGGTCATCCAGAAGT
54˚C
TL2-N -3014
CCAATGCACTAATCTGCCATATTA
840 bp
mt-COI
BYVMV (CP) F
TTTCGGATGTTACGCGTGGA
59˚C
BYVMV (CP) R
TGCTAGCATGGGTACAAGCC
800bp
BYVMV Coat protein
OELCuV (CP) F
ATCGTCATTTCTACCCCCGC
59˚C
OELCuV (CP) R
CCTCCTGTAACTGTCGCCTG
800bp
OELCuV Coat protein
BYVMV(CP) RT-F
GCAACTTTTGTCGCAGGATT
59˚C
BYVMV(CP) RT-R
ATAGGCCTGTTTGTCCATGC
120bp
BYVMV Coat protein
OELCuV (CP) RT-F
GCACCCCCTACGATTTCCAG
56˚C
OELCuV (CP) RT-R
ACAAGCATACTGTCCTCCTG
80 bp
OELCuV Coat protein
Each PCR reaction contained 2μL DNA(~40 ng for whitefly and ~100 ng for Okra plants), Taq DNA polymerase (3U/μL) (Bioline, USA), 2.5μL Taq buffer (10X) (Bioline, USA), 1μL dNTPs (2.5mM) (New England Biolab), 3μL MgCl2(15mM) (Bioline, USA), 1μL Forward Primer (10mM), 1μL Reverse Primer(10mM) and sterile water to make up total volume of 25μL. The reaction involved denaturation at 94°C for 30s and annealing at different temperatures (54°C for whitefly characterization, 59°C for YVMV and OELCuV) for a time period of 30 s with 35 number of cycles. Extension was carried out at 72°C for 40 s with the final extension for 5 min at 72°C. Each PCR products were resolved on 1% agarose gel and visualized in a gel documentation system. PCR products were further purified using gel elution and purification kit (HiPurATM PCR Product and Gel Purification Combo Kit). Purified PCR products were cloned with the help of pGEM T-easy Vector and transformed into DH5α E. coli cells (Promega, Madison, USA) [17]. Plasmid DNA was isolated using Wizard Plus SV Minipreps DNA Purification System (Promega) and then sent for Sanger dideoxy sequencing. Furthermore, the sequences were processed by using BioEdit and BLASTn followed by submission to the NCBI database. To identify the different genetic groups of whitefly a phylogenetic tree was built with the help of maximum likelihood method (Kimura 2-parameter model) having 1000 bootstraps replications [18].
Acquisition and inoculation of begomoviruses by B. tabaci
Individual adult female of B. tabaci with a maximum age of 24 hrs was used for virus acquisition and inoculation. Insect breeding dish (65 mm d, 10 mm h) was used and 5 ml of 1% agar-agar was poured in the bottom half. Apical symptomatic leaves of YVMV and OELCuV (50-day old plants) were collected and petioles were inserted in the solidified agar-agar for virus acquisition by individual B. tabaci. Simultaneously, the virus copy number present in source plants itself were also estimated. For inoculation, leaf of 50-day old virus-free okra plant (var. MONA 002) was used for virus inoculation by both the genetic group of B. tabaci. To maintain homogeneity leaves of same size and age (approximately 10 square cm) were considered throughout the experiment. A single aviruliferous whitefly, of each cryptic species (Asia I and Asia II 5) were released parallelly on the virus infected leaves for acquisition of the virus. For virus inoculation, individual B. tabaci of different groups was released separately on YVMV and OELCuV infected leaves for 24 hrs to virus acquisition and further shifted to virus-free leaves inside the insect breeding dishes. Constant monitoring within the dishes was done to ascertain whether B. tabaci started feeding on leaves. Both the acquisition and inoculation sets were kept in dark (26 ±2˚C, and 70 ±10% relative humidity) and B. tabaci adults were collected from both setups at an interval of 1 min, 5 min, 15 min, 1 hr, 2 hrs, 6 hrs, 12 hrs, and 24 hrs after release. The experiment setup were maintained separately for YVMV and OELCuV isolates with three replications (S1 Fig).
Standardization of real-time PCR
Real-time PCR primers for YVMV and OELCuV were designed based on the coat protein (CP) sequences of the viruses (Table 1). Prior to final set up in real-time PCR a conventional PCR was performed to validate the newly designed primers. The PCR program was carried out in a total volume of 25 μl, containing 2 μl of template DNA (~40 ng for B. tabaci and ~100 ng for plants), 12.5 μl of PCR master mix, 8.5 μl of molecular-grade water, and 1 μl each of forward and reverse primer. The PCR was performed in Veriti 96-well Thermal Cycler (Applied Biosystems) with one cycle of initial denaturation at 95˚C for 3 min, 40 cycles of denaturation at 95˚C for 40 s, annealing at 56˚C for OELCuV and 59˚C for YVMV for 30 sec. Extension was carried out at 72˚C for 40 s followed by a final extension at 72˚C for 10 min. The PCR products were resolved on 1% agarose gel and visualized in a gel documentation system. Real-time PCR was performed in using the Agilent Technologies Stratagene Mx3000P Sequence Detection System with 20 μl reaction volume consisted of a 10 μl 2x SYBR Green qPCR Master Mix (Thermo Scientific), 2 μl template DNA (~100 ng for plant and ~40 ng for B. tabaci), and 1 μl (10 pmol) of each forward and reverse primer. The CT values (from three biological replicates) obtained were used for calculating the mean CT and standard error of mean (SEM) with the aid of Microsoft Excel software.
Preparation of standard curve
Total DNA was isolated from the test plant samples using plant DNA extraction kit (Thermo Fisher Scientific). The quantity and quality of the DNA was determined by Nano Drop 1000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA). For absolute quantification of the virus (YVMV and OELCuV), a standard curve was generated using partial coat protein gene of about 120bp and 80bp size respectively. The PCR amplified product of YVMV and OELCuV were cloned with pJET1.2 vector using JET PCR Cloning Kit (Thermo Scientific) and transformed into DH5α E. coli cells. A ten-fold serial dilution of the linearized plasmid DNA was used for real-time PCR. The real-time PCR was performed in 20 μl reaction volume considering serially diluted plasmid DNA as templates. The serial dilution of the plasmid DNA were used for constructing two different standard curve each of YVMV and OELCuV.
Quantification of begomovirus copies
For quantification, B. tabaci cryptic species (exposed to YVMV and OELCuV) and inoculated leaves were collected at different exposure period and DNA was extracted as described above. The mean CT values were fitted into their corresponding standard curves for absolute quantification of YVMV and OELCuV using the formula given by Krieg [19].
Data analysis
Absolute quantification of YVMV and OELCuV in test samples (B. tabaci cryptic species and inoculated leaves) at different periods of feeding was calculated by operating the default setup of MxPro qPCR software on Agilent Technologies Stratagene Mx3000P Sequence Detection System. The log of virus copy number ingested and egested by individual B. tabaci cryptic species was modelled using logarithmic function separately in Excel.
Results
Characterization of cryptic species of B. tabaci
Several DNA-based techniques have been exploited for proper identification of B. tabaci cryptic species [20, 21]. Nonetheless, sequence analysis of mitochondrial cytochrome oxidase I (mt-COI) gene have been most widely accepted [22-25]. In the current study running culture of two different homogenous population of B.tabaci were identified by using the primer pair (C1-J-2195 F/ L2-N-3014 R) of the universal mt-COI gene. Based on the previously known sequences in the GenBank database, a phylogenetic tree was constructed by using maximum likelihood phylogram (Fig 1). The phylogenetic analysis of the determined COI sequences assured that the populations belonged to two different cryptic species Asia I and Asia II 5. The sequence can be retrieved using the GenBank Accession No. MZ973007, MZ973008 for Asia I and MZ772932, MZ772927 for Asia II 5.
Fig 1
Phylogenetic tree of B. tabaci cryptic species identified based on cytochrome oxidase subunit I (COI) sequences.
The samples from the study are indicated by bold text in the tree; all other sequences were obtained from the GenBank database. Pink and blue coloured shade represent sequences of Asia I and Asia II 5 respectively, whereas, yellow shade represent the other cryptic species of B.tabaci. Bemisia afer sequences (green shade) was taken as an out-group.
Phylogenetic tree of B. tabaci cryptic species identified based on cytochrome oxidase subunit I (COI) sequences.
The samples from the study are indicated by bold text in the tree; all other sequences were obtained from the GenBank database. Pink and blue coloured shade represent sequences of Asia I and Asia II 5 respectively, whereas, yellow shade represent the other cryptic species of B.tabaci. Bemisia afer sequences (green shade) was taken as an out-group.
Characterization of the begomoviruses
PCR with YVMV and OELCuV -inoculated samples produced ~800 bp products. The sequencing results of the products could generate 770 nt (Accession No. OL743532) and 780 nt (Accession No. OL743533) sequences for YVMV and OELCuV, respectively. From BLASTn analysis, we obtained 100% similarity with other YVMV and OELCuV coat protein sequences available in NCBI.
Standard curve
A relative quantification method could not be used because of the absence of any control group; hence, absolute quantification was considered to be the best way to compare the viral load against different treatments. To estimate the Begomovirus (YVMV and OELCuV) copy number acquired and egested by individual whitefly, Ct values were generalized to a calibration curve obtained from amplifying serial dilutions of plasmid standards using qPCR. The resultant Ct values were plotted against the known copy numbers of the standard sample. The standard curve covered a linear range of five different orders of magnitude. Primer pair, BYVMV (CP) RT-F and BYVMV (CP) RT-R; OELCuV (CP) RT-F and OELCuV (CP) RT-R produced prominent bands of 120 and 80 bp for YVMV and OELCuV, respectively. Both the primer pairs did not produce any secondary peak in the melting curve analysis in real-time PCR (Figs 2 & 3). The specific melting temperature for YVMV and OELCuV products were around 78˚C and 84˚C respectively. The standard curve for both the viruses showed an ideal high amplification efficiency of 110.4% and 105.3% respectively representing the ideal conditions for absolute quantification. The correlation coefficient (R2) of both the standard curve was noted to 0.998, signifying that this assay could be used to quantify target DNA virus (both acquired and egested) by individual whitefly.
Fig 2
Real-time PCR analysis of YVMV indicate the specificity of the reactions (A) Thermal profile (B) PCR amplification plots (C) dissociation curve and (D) standard curves of serially diluted linearized plasmids obtained using SYBR® Green chemistry. The specific melting temperature for YVMV products was around 78°C. Standard curves show a linear relationship between initial viral copy number per microliter on X-axis and Ct values on Y-axis. Each concentration was replicated twice. The equation of the straight line and the coefficient of correlation (R2) are mentioned on the graph.
Fig 3
Real-time PCR analysis of OELCuV indicate the specificity of the reactions (A) Thermal profile (B) PCR amplification plots (C) dissociation curve and (D) standard curves of serially diluted linearized plasmids obtained using SYBR® Green chemistry. The specific melting temperature for YVMV products was around 84°C. Standard curves show a linear relationship between initial viral copy number per microliter on X-axis and Ct values on Y-axis. Each concentration was replicated twice. The equation of the straight line and the coefficient of correlation (R2) are mentioned on the graph.
Real-time PCR analysis of YVMV indicate the specificity of the reactions (A) Thermal profile (B) PCR amplification plots (C) dissociation curve and (D) standard curves of serially diluted linearized plasmids obtained using SYBR® Green chemistry. The specific melting temperature for YVMV products was around 78°C. Standard curves show a linear relationship between initial viral copy number per microliter on X-axis and Ct values on Y-axis. Each concentration was replicated twice. The equation of the straight line and the coefficient of correlation (R2) are mentioned on the graph.Real-time PCR analysis of OELCuV indicate the specificity of the reactions (A) Thermal profile (B) PCR amplification plots (C) dissociation curve and (D) standard curves of serially diluted linearized plasmids obtained using SYBR® Green chemistry. The specific melting temperature for YVMV products was around 84°C. Standard curves show a linear relationship between initial viral copy number per microliter on X-axis and Ct values on Y-axis. Each concentration was replicated twice. The equation of the straight line and the coefficient of correlation (R2) are mentioned on the graph.
Comparison of begomovirus titre acquired by Asia I and Asia II 5
The absolute quantification (qPCR) method was used to detect copies of the YVMV and OELCuV acquired by individual whitefly sample (Asia I and Asia II 5 genetic group) from the source leaves at different feeding periods. Subsequently, both the cryptic species of B.tabaci were classified into positive (viruliferous) or negative (non-viruliferous) according to the detectable targeted gene (coat protein for YVMV and OELCuV) levels. The viral copy numbers present in both the cryptic species were represented as log10 converted values. The virus copies in the source leaves used for acquisition of YVMV and OELCuV by B. tabaci was measured to be 5.98 and 5.93 copies per microliter respectively. A total of 8 feeding periods starting from 1 min upto 24 hr were tested for both the cryptic species of B.tabaci. No viral load could be detected after 1 min of active feeding and considered as qPCR negative, whereas the remaining 7 time points were qPCR-positive. After 1 hr of active feeding titre level of both YVMV and OELCuV were estimated to be 2.44 and 3.06 copies per microliter respectively in case of Asia I group, whereas for the same amount of time, Asia II 5 contained 2.30 and 2.80 copies per microliter, of both the viruses respectively (Table 2). From this result it is evident that Asia I genetic group of B.tabaci acquired more titre of both the viruses when compared to that of Asia II 5 during the initial feeding period. A steep increase of both virus copies were observed with increased feeding exposure in the two genetic groups of whitefly. Amount of YVMV titre in Asia I group was estimated to be 4.00 copies per microliter at 12 hrs followed by a peak of 4.49 copies per microliter after 24 hrs of feeding (Fig 4A and 4B). On the contrary, in Asia II 5, maximum titre of YVMV was noted after 24 hrs of feeding, with 5.12 copies per microliter (1.14-fold times higher as compared to Asia I genetic group). In the case of OELCuV, the virus copies accumulating in Asia I group was always higher than Asia II 5 throughout the feeding period. Maximum titre of OELCuV was noted after 24 hrs of continuous feeding, with 5.14 copies per microliter, which was 1.05-times higher as compared to Asia II 5 genetic group (4.74 copies per microliter after 24 hrs.).
Table 2
Copies of YVMV and OELCV ingested by individual B. tabaci (Asia I and Asia II 5) genetic group at different feeding exposure.
Feeding exposure
Mean (log10 YVMV copies μl-1)
Mean (log10 OELCV copies μl-1)
Asia I
Asia II 5
Asia I
Asia II 5
1 min
/
/
/
/
5 min
2.05±0.08,a
2.13±0.02,a
2.32±0.10,a
2.19±0.25,a
15 min
2.25±0.09,a
2.19±0.21,a
2.77±0.06,b
2.37±0.05,a
1 hr
2.44±0.10,b
2.30±0.06,b
3.06±0.15,b
2.80±0.13,b
2 hrs
2.78±0.10,b
3.19±0.15,c
3.74±0.15,c
2.98±0.06,b
6 hrs
3.97±0.05,c
3.85±0.18,d
4.04±0.08,d
3.51±0.09,c
12hrs
4.00±0.10,c
4.38±0.05,e
4.15±0.01,d
3.78±0.15,c
24hrs
4.49±0.16,d
5.12±0.09,f
5.14±0.11,e
4.74±0.07,d
Fig 4
Dynamics of YVMV and OELCuV copies ingested (A and B) and egested (C and D) by individual Asia I and Asia II 5 genetic group of B. tabaci. Acquisition/ Inoculation feeding time is expressed on X-axis and log of virus copy number is plotted on Y-axis. YVMV and OELCuV copies were estimated at 1 min, 5 min, 15 min, 1 hr, 2 hrs, 6 hrs, 12 hrs, and 24 hrs of feeding. The different letters indicate statistically significant differences between the treatments. The bars represent the standard error of mean (± SEM).
Dynamics of YVMV and OELCuV copies ingested (A and B) and egested (C and D) by individual Asia I and Asia II 5 genetic group of B. tabaci. Acquisition/ Inoculation feeding time is expressed on X-axis and log of virus copy number is plotted on Y-axis. YVMV and OELCuV copies were estimated at 1 min, 5 min, 15 min, 1 hr, 2 hrs, 6 hrs, 12 hrs, and 24 hrs of feeding. The different letters indicate statistically significant differences between the treatments. The bars represent the standard error of mean (± SEM).
Comparison of begomovirus titre egested by Asia I and Asia II 5
Inoculation of Begomovirus by each of the whitefly was quantified in detached okra leaves. No begomoviruses titre was quantified by both the genetic group after 1 min of active feeding and were consider as qPCR negative. However, both the viruses could be detected in real-time PCR after 5 min in both the cryptic species egested okra leaves. After 5 min of continuous feeding YVMV copy numbers egested by individual Asia I and Asia II 5 groups were 2.08 and 2.11 copies per microliter, respectively in detached okra leaves (Table 3). The virus copy number increased in the leaves with increased feeding exposure. The virus copies increased to 2.28 and 2.24 copies per microliter, respectively for both Asia I and Asia II 5 at 1hr post feeding (Fig 4C). So, it is clear that after initial phases of egestion Asia I group of B.tabaci inoculated more titre of YVMV as compared to Asia II 5. However, the difference in titre was non-significant. Alternatively, in case of Asia II 5 maximum YVMV titre in detached okra leaves was noted 24 hrs post feeding, with 4.71 copies per microliter, around 1.21-fold higher as compared with Asia I (3.89 copies per microliter) genetic group.
Table 3
Copies of YVMV and OELCV egested by individual B. tabaci (Asia I and Asia II 5) genetic group at different feeding exposure.
Feeding exposure
Mean (log10 YVMV copies μl-1)
Mean (log10 OELCV copies μl-1)
Asia I
Asia II 5
Asia I
Asia II 5
1 min
/
/
/
/
5 min
2.08±0.26,a
2.11±0.07,a
2.14±0.11,a
2.01±0.10,a
15 min
2.17±0.17,a
2.14±0.17,b
2.17±0.05,ab
2.12±0.18,a
1 hr
2.28±0.17,b
2.24±0.11,b
2.51±0.18,b
2.18±0.10,b
2 hrs
2.45±0.14,b
3.03±0.10,c
3.33±0.10,c
2.48±0.02,bc
6 hrs
3.31±0.10,c
3.56±0.20,d
3.80±0.12,cd
2.94±0.14,cd
12hrs
3.72±0.14,c
3.80±0.16,d
4.09±0.17,d
3.13±0.04,d
24hrs
3.89±0.19,c
4.71±0.08,e
4.61±0.27,e
4.27±0.02,e
Similarly, after 5 min of constant feeding OELCuV copy numbers egested by individual Asia I and Asia II 5 groups in detached okra leaves were 2.14 and 2.01 copies per microliter, respectively (Table 3). The virus copies increased to 2.51 and 2.18 copies per microliter, for both Asia I and Asia II 5 respectively at 1hr post feeding. Hence, there are similarities with that of YVMV i.e. after initial phases of egestion Asia I group of B.tabaci inoculate more titre of OELCuV than Asia II 5. The viral load reached its highest level after 24 hrs of feeding in case of Asia I genetic group, with 4.61 copies per microliter, i.e. 1.07-fold higher as compared with Asia II 5 (4.27 copies per microliter) genetic group (Fig 4D).
Discussion
B.tabaci is one of most dreadful pests which serves as a vector to large no. of plant viruses in the genera Begomovirus, Carlavirus, Ipomovirus and Closterovirus [8]. Amongst them Begomovirus are a major threat to cultivation of crops in most tropical and subtropical regions of the world [26]. Begomovirus have either one (monopartite, DNA-A-like) or two (bipartite, DNA-A and DNA-B) circular ssDNA molecules of nearly 2800 nucleotides each. Each of these molecules is encapsulated by geminate particles of 22 nm* 38nm size assembled from the coat protein (CP) [10]. Some diseases namely, Yellow vein mosaic disease (YVMD), okra enation leaf curl disease (OELCD) and okra leaf curl disease (OLCD), caused by distinct begomovirus leads to menace in okra cultivation in India [12–14, 27].B.tabaci ingests the Begomoviruses particles while feeding on the phloem sap of infected plants using stylets. The virions after passing the food canal ultimately reaches the midgut of its vector where the translocation of the begomovirus takes place through the filter chamber. Subsequently the virions are released into haemolymph from where they translocate into the salivary glands until further egestion. This spectacular interaction of begomovirus with B.tabaci has drawn worldwide attention since the past five decades [10].Interestingly, transmission of begomovirus by whiteflies are reported to be species/strain specific i.e. transmission of a particular begomovirus occurs with different level of efficacy or specificity for each different species or strain [16]. For example, transmission of tomato yellow leaf curl china virus (TYLCCNV) in tomato and tobacco is transmitted by MEAM I and Asia II 3 cryptic species of B.tabaci but not Asia II I or MED [28, 29]. In this context, the present experiment deals with the comparative study of virus titre (YVMV and OELCuV) ingested and egested by B.tabaci Asia I and Asia II 5 at different time interval. Significant amount of variation was noted in virus uptake by both the genetic groups of whitefly. We did not detect any virus titre in whitefly samples immediately (1 min) after the virus exposure. Very low level of the virus titre at 1 minute of feeding which could not be detected by rt-PCR could be a possible reason. Also, the need of buffer time by B.tabaci to direct its stylet in the phloem tissue may justify no detection of virus copies immediately after feeding begins [30]. Previous studies using conventional PCR based technology suggests Asia I requires a minimum of 20 minutes of acquisition access period (AAP) to acquire virus (YVMV) [31] however, what we observed from our study is that B.tabaci Asia I could acquire YVMV just after 5 minutes of feeding.The results also revealed that Asia I genetic group of B.tabaci acquired more titre of both the viruses in comparison to Asia II 5 in the initial phases of active feeding. Subsequently, after 24 hours of continuous feeding Asia II 5 acquired more of YVMV whereas, Asia I ingested more OELCuV. As, ability of virus transmission by whitefly species is positively associated with the virus titre in their body [16] it would not be wrong to state that Asia I could be a more efficient transmitter for OELCuV and Asia II 5 for YVMV on okra plants. Variation noted in virus uptake may be due to the variation of virus titre in the source plant itself [32]. To eliminate this variation in viral DNA in source plant we collected top leaves of same physiological age from both the plants. Viral copy number in the source plants of YVMV and OELCuV differed non-significantly. However, the exact molecular mechanism resulting in the differing ability of Asia I and Asia II 5 to acquire begomovirus still remains unclear and calls for future investigations.Furthermore, egestion of virus copies by both the genetic groups were recorded at different time interval of feeding. Similar to virus acquisition, Asia II 5 inoculated higher titre of YVMV whereas Asia I inoculated higher titre of OELCuV at 24hr feeding exposure. Hence, it can be argued that the genetic group acquiring higher titre of virus egested higher amount during inoculation period. Another noteworthy fact is that copies of YVMV and OELCuV in detached leaves were less than the copies acquired by B.tabaci Asia I and Asia II 5 in 24 hrs. An explanation that could indeed rationalize this observation is that no further replication of both the begomovirus occurs in the detached leaves. Adding to this can be the inability of B.tabaci to inoculate exact amount of virus into the plant as the number of virions accumulating into the appropriate salivary components after circulation/replication might not be the same.Acquisition and transmission of begomovirus by B.tabaci has been a major area of research throughout the world. However, most of the study has been conducted using conventional PCR technology, radioactive and non-radioactive probes. This present study utilizes absolute quantification method for determining the actual viral load acquired and inoculated by the two such genetic groups of whitefly, predominant in India. Moreover, results of the current investigation emphasises the comparative virus-vector relationship of two genetic groups of whitefly which will provide assistance in monitoring, rapid screening of resistant varieties and further controlling the diseases caused by these virus.
Ingestion and egestion process of YVMV and OELCuV by single B.tabaci (both Asia I and Asia II 5) using detached leaf assay.
(DOCX)Click here for additional data file.4 Feb 2022
PONE-D-21-40408
Copy number variation of two begomovirus acquired and inoculated by different cryptic species of whitefly, Bemisia tabaci in Okra
PLOS ONE
Dear Dr. Tarafdar,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.
Please submit your revised manuscript by Mar 21 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.We look forward to receiving your revised manuscript.Kind regards,Rajarshi GaurAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions
Comments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: PartlyReviewer #2: Yes********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: YesReviewer #2: Yes********** 3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: YesReviewer #2: Yes********** 4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: YesReviewer #2: No********** 5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: This study reports the variations in begomoviral acquisition and transmission by Asia I and Asia II 5 species of whiteflies. Real time PCR method is used at periodic intervals to quantify viral loads during ingestion and egestion by whiteflies. Significant variations are observed in virus uptake and transmission by both species for yellow vein mosaic & okra leaf curl virus. These variations indicate Asia I is better transmitter for OELCuV and Asia II 5 for YUMV which can significantly affect the virus pandemics. Overall, the manuscript is clearly written, data is clearly represented and results are explained well. However, I have few major questions which should be addressed before consideration for submission.1- The authors did not mention about the sample size for example the number of whiteflies used for ingestion assay as well as for egestion assay. Please include these details for sample size for each timepoint in methods section.2- There is no information about the sex ratio of the number whiteflies used for ingestion and egestion assay. As there are reports stating females feed and inoculate more over male whiteflies therefore considered better transmitters over males. If male to female ratios is not kept consistent then it can significantly affect the observations. Including this relevant information will add more vigor to the present observations.3- Did authors check the expression of any endogenous genes to normalize basal levels?4- Please explain term inoculation period which is used throughout the manuscript.5- The authors have focused on acquisition and egestion of the virus but did not discuss about retention by whiteflies. Was there any data or observation made about retention of the virus?6- Since there is significant amount of variation observed in virus uptake. Did authors perform any quantification by real time PCR to normalize the initial amounts of viruses used for feeding?7- The sequences for the accession numbers OL743532 & OL743533 are not found in NCBI GenBank. Please update.8- In figure 4 D data point for 15 min has large deviation than others. Please explain.9- Did authors tried any other method of virus detection like western blot to add strength to this real time data?Reviewer #2: the article might be of interest to a broad audience who might want an introduction to the management on crop improvement. I have enjoyed reading the entire manuscript except at a few places with typo errors and some sentences are very long and not appropriate. I advise authors to read again and correct them wherever necessary.********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: NoReviewer #2: Yes: Ritesh Mishra[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.Submitted filename: 22.docxClick here for additional data file.Submitted filename: Review comments for Copy number variation of two begomovirus.docxClick here for additional data file.14 Feb 2022Reviewer #1:This study reports the variations in begomoviral acquisition and transmission by Asia I and Asia II 5 species of whiteflies. Real time PCR method is used at periodic intervals to quantify viral loads during ingestion and egestion by whiteflies. Significant variations are observed in virus uptake and transmission by both species for yellow vein mosaic & okra leaf curl virus. These variations indicate Asia I is better transmitter for OELCuV and Asia II 5 for YUMV which can significantly affect the virus pandemics. Overall, the manuscript is clearly written, data is clearly represented and results are explained well. However, I have few major questions which should be addressed before consideration for submission.Comment 1: The authors did not mention about the sample size for example the number of whiteflies used for ingestion assay as well as for egestion assay. Please include these details for sample size for each timepoint in methods section.Response: Thank you for your valuable comments. We have taken individual whitefly sample of the both the genetic groups for quantification of YVMV and OELCuV. The use of individual whitefly sample for this study has been mentioned in line no. 122, 126 and 132 under material method section. For better understanding we have included a pictorial schematic template for the entire process of ingestion and egestion by both the genetic groups of B.tabaci as supplementary file (S1 Fig).Comment 2: There is no information about the sex ratio of the number whiteflies used for ingestion and egestion assay. As there are reports stating females feed and inoculate more over male whiteflies therefore considered better transmitters over males. If male to female ratios is not kept consistent then it can significantly affect the observations. Including this relevant information will add more vigor to the present observations.Response: Thank you for your valuable comments. We have used a single whitefly adult female for studying the ingestion and egestion assay. This is mentioned is line no. 122.Comment 3: Did authors check the expression of any endogenous genes to normalize basal levels?Response: Thank you for your valuable comments. However, I would like to add that by running RT-PCR for the virus we can determine the viral load. The earlier cycle threshold will indicate more virus copies were present in the initial sample and caused more severe infection. For example, if we have 3 patients samples and one healthy control. We get Ct values: 8, 10, 30 and 0 (no signal) for control. These results will clearly indicate that patient 1 (with CT value 8 has the most severe infection) as the sample was amplified to be detectable only after 8 cycle of amplification meaning very high initial copy number, patient 2 with CT value 15 has a mild infection and the last patient have very few copies of the virus that was amplified only after 30 cycles. If we further run PCR products on the gel we might even see the difference if they are explicit. i.e. the first patient band would be brighter (which indicates qualitative PCR). However, RT-PCR allows us to distinguish very subtle changes. Accordingly, we think it will not be very helpful to use any housekeeping gene when working with the virus material so we can operate directly with the CT values. There are few techniques where we can convert CT values to the viral copy numbers, this was determined in the literature for most known viruses usually by building the linear or log curve of the known copy numbers and projecting the CT values to the curve. However, it is to be mentioned that for relative gene expression / relative quantification we could use any endogenous control like actin, EF etc.Comment 4. Please explain term inoculation period which is used throughout the manuscript.Response: Thank you for your valuable comments. We would like to mention that the time period wherein the virus is egested with the saliva into the plant phloem by whitefly is referred to as inoculation period in the manuscript.Comment 5. The authors have focused on acquisition and egestion of the virus but did not discuss about retention by whiteflies. Was there any data or observation made about retention of the virus?Response: Thank you so much for your valuable comments. YVMV and OELCuV are typical persistent, non-propagative begomovirus. There are certain reports of TYLCV replication in whitefly however, no evidence have been found regarding the replication of YVMV and OELCuV occurring in whitefly. Hence only the acquisition and egestion of the virus has been focused in this study. However, we would like to add that we are currently studying the same phenomenon for these begomoviruses but we did not find any evidence of replication occurring in whitefly.Comment 6. Since there is significant amount of variation observed in virus uptake. Did authors perform any quantification by real time PCR to normalize the initial amounts of viruses used for feeding?Response: Thank you so much for your valuable comments. To overcome the variation in viral DNA in source plant, the top leaf of plants of same physiological age were used. The viral copies in the source plants of YVMV and OELCuV were also quantified in real time PCR which resulted almost equal values. This has been mentioned in line no. 129.Comment 7. The sequences for the accession numbers OL743532 & OL743533 are not found in NCBI GenBank. Please update.Response: Thank you so much for your valuable comments. We have updated the accession numbers as suggested and now it is available in NCBI.Comment 8. In figure 4 D data point for 15 min has large deviation than others. Please explain.Response: We appreciate the reviewer’s critical observation of Fig 4D as the figure data (SEM) were wrongly pasted from excel. In Fig 4D the SEM-values of Ct means were mistakenly plotted which shows huge variability at the time frame. The graphs for Fig 4D has been replotted with correct values and incorporated in the revised manuscript.Comment 9. Did authors tried any other method of virus detection like western blot to add strength to this real time data?Response: We agree with the reviewer’s suggestion. This would be an interesting study. However, this was beyond the scope of the current study. We will try to address this suggestion in our future studies.Reviewer #2: The article might be of interest to a broad audience who might want an introduction to the management on crop improvement. I have enjoyed reading the entire manuscript except at a few places with typo errors and some sentences are very long and not appropriate. I advise authors to read again and correct them wherever necessary.Response: Thank you so much for your valuable comments. We have re-read the entire manuscript and made the necessary changes accordingly. We have revised the manuscript and tried to improve it as much as possible.Submitted filename: Response to reviwers.docxClick here for additional data file.14 Mar 2022Copy number variation of two begomovirus acquired and inoculated by different cryptic species of whitefly, Bemisia tabaci in OkraPONE-D-21-40408R1Dear Dr. Tarafdar,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,Rajarshi GaurAcademic EditorPLOS ONE
Comments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressedReviewer #2: All comments have been addressed********** 2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: YesReviewer #2: Yes********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: YesReviewer #2: N/A********** 4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: YesReviewer #2: Yes********** 5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: YesReviewer #2: No********** 6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The revised manuscript version is significantly improved and addressed major concerns raised from the reviewers.Reviewer #2: Dear AuthorsThanks for the corrections as suggested but again I will advise to read again carefully and correct them wherever necessary.********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: NoReviewer #2: No17 Mar 2022PONE-D-21-40408R1Copy number variation of two begomovirus acquired and inoculated by different cryptic species of whitefly, Bemisia tabaci in OkraDear Dr. Tarafdar:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofProfessor Rajarshi GaurAcademic EditorPLOS ONE
Authors: Muhammad Z Ahmed; Paul J De Barro; Jaco M Greeff; Shun-Xiang Ren; Muhammad Naveed; Bao-Li Qiu Journal: Pest Manag Sci Date: 2010-12-14 Impact factor: 4.845