How many begomovirus copies are acquired and inoculated by its vector, whitefly (Bemisia tabaci) during feeding?

Begomoviruses are transmitted by whitefly (Bemisia tabaci Gennadius, Hemiptera: Aleyrodidae) in a persistent-circulative way. Once B. tabaci becomes viruliferous, it remains so throughout its life span. Not much is known about the copies of begomoviruses ingested and/or released by B. tabaci during the process of feeding. The present study reports the absolute quantification of two different begomoviruses viz. tomato leaf curl New Delhi virus (ToLCNDV, bipartite) and chilli leaf curl virus (ChiLCV, monopartite) at different exposure of active acquisition and inoculation feeding using a detached leaf assay. A million copies of both the begomoviruses were acquired by a single B. tabaci with only 5 min of active feeding and virus copy number increased in a logarithmic model with feeding exposure. Whereas, a single B. tabaci could inoculate 8.21E+09 and 4.19E+11 copies of ToLCNDV and ChiLCV, respectively in detached leaves by 5 min of active feeding. Virus copies in inoculated leaves increased with an increase in feeding duration. Comparative dynamics of these two begomoviruses indicated that B. tabaci adult acquired around 14-fold higher copies of ChiLCV than ToLCNDV 24 hrs post feeding. Whereas, the rate of inoculation of ToLCNDV by individual B. tabaci was significantly higher than ChiLCV. The study provides a better understanding of begomovirus acquisition and inoculation dynamics by individual B. tabaci and would facilitate research on virus-vector epidemiology and screening host resistance.

Introduction

The whitefly, Bemisia tabaci (Gennadius, Hemiptera: Aleyrodidae) is one of the world’s top 100 invasive species (IUCN, http://www.iucngisd.org/gisd/100_worst.php), which causes severe losses to more than 900 plant species [1, 2]. The considerable genetic diversity and varying abilities to interbreed have led to the belief that B. tabaci represents a cryptic species complex [3-6]. To date, 45 such cryptic species of B. tabaci are known [7]. Besides direct damage caused by feeding, B. tabaci transmits begomoviruses, carlaviruses, closteroviruses, criniviruses, ipomoviruses, nepoviruses, potyviruses, torradoviruses, and a rod-shaped DNA virus [8-10]. Begomoviruses, in general, are transmitted by B. tabaci in a persistent-circulative manner. To date, 445 species of begomoviruses are known (ICTV, 2020) [11]. Begomoviruses are single-stranded (ss) circular DNA viruses belong to the family Geminiviridae. Infected plants show yellow mosaic, vein yellowing, leaf curling, stunting, and vein thickening. Yield losses of 20–100% in economic crops are reported due to B. tabaci and begomoviruses [12]. Most of the begomoviruses are phloem-limited and are restricted to the vascular system except bean dwarf mosaic virus that invades mesophyll tissue [13]. Mouthparts of B. tabaci are modified to piercing the leaf tissue and reach the vascular system to suck plant sap. The maxillary stylets are held opposed and form the food and salivary canal. B. tabaci inserts its stylets in the vascular system of infected plants and ingests begomovirus particles. Transmission of tomato yellow leaf curl virus (TYLCV) by B. tabaci is widely studied [14]. TYLCV virions pass along the food canal and reach the digestive tract after 40 min of ingestion [15]. Once the virions enter the alimentary system of B. tabaci, it is received by receptors located at midgut of B. tabaci. It is thought that the virus crosses the filter chamber and the midgut barriers to enter the hemolymph after 90 min [15]. The virions are circulated through hemolymph in coated vesicles and translocated into the primary salivary glands where they can be detected 4–7 h after the onset of feeding [15]. The virions are egested with the saliva into the plant phloem during feeding and salivation. Several studies reported the diagnostics, epidemiology, host plant resistance, and transmission of B. tabaci-borne begomoviruses. Not much is studied about the copies of begomoviruses that are ingested during sucking phloem sap or egested with saliva by its vector, B. tabaci. The amount of TYLCV-DNA accumulated in its vector, B. tabaci was earlier estimated by quantitative chemiluminescent dot-blot assay [16]. Watermelon chlorotic stunt virus (WmCSV) and TYLCV-DNA have been quantified from group of poor and efficient transmitter strain of B. tabaci [17]. None of these studies quantified the virus dynamics in individual B. tabaci. The present study measures the uptake and release of one bipartite, tomato leaf curl New Delhi virus (ToLCNDV) and one monopartite, chilli leaf curl virus (ChiLCV) begomoviruses by individual B. tabaci using a detached leaf assay. ToLCNDV contains two similar-sized genomic components, DNA-A and DNA-B, each approximately 2.7 kb in size [18, 19]. ToLCNDV is responsible for significant yield losses in several crops under the Solanaceae and Cucurbitaceae families [20-22]. ChiLCV is monopartite and approximately 2.7 kb in size, has emerged as a serious threat to chilli production [23, 24]. The number of begomovirus copies acquired and transmitted by individual B. tabaci is important to shed light on the efficiency of virus transmission and useful in understanding the disease epidemiology.

Materials and methods

Insect vector

The initial population of B. tabaci was collected from a stock culture maintained at Advanced Centre for Plant Virology, Indian Agricultural Research Institute (IARI), New Delhi. A single adult female B. tabaci was released on eggplant (var. Navkiran, Mahyco) to establish a homogeneous population. The identity of the homogenous population was characterized by morphological keys [25] and sequencing mitochondrial cytochrome oxidase subunit I (mtCOI). The population was maintained under controlled environmental conditions at 28 ± 2° C, 60 ± 10% relative humidity, and 16 hrs light-8 hrs dark photoperiod. A representative sample of the population was tested in PCR to confirm its aviruliferous status. The freshly emerged adult females were collected using an aspirator for further experiments.

Host plant

Eggplant (var. Navkiran), tomato (var. S-22, Icon Seeds), and chilli (var. HPH-1041, Syngenta) were grown in plastic pots filled with soil rite mixture. The plants were maintained in a growth chamber under insect-proof conditions. Eggplant was used to maintain the homogenous population of B. tabaci. Tomato and chilli were used to maintain the pure culture of begomoviruses, acquisition, and inoculation by B. tabaci.

Virus isolates

The inoculums of ToLCNDV and ChiLCV have been collected from pure cultures maintained at Division of Plant Pathology, IARI, New Delhi. ChiLCV was maintained in chilli (var. HPH-1041) and ToLCNDV was maintained in tomato (var. S-22) plants by B. tabaci-inoculation. The identity of the begomoviruses was confirmed by PCR as described below. Both the begomoviruses were maintained under insect-proof conditions for further experiments.

DNA extraction from B. tabaci and host plants

Total DNA was extracted from B. tabaci adults, tomato, and chilli leaves using cetyltrimethylammonium bromide (CTAB) methods [26]. CTAB extraction buffer was prepared in a total volume of 1 ml containing 100 mM Tris-HCl pH 8.0, 1.4 M NaCl, 20 mM EDTA pH 8.0, 2% CTAB, and 2 μl β-mercaptoethanol. B. tabaci specimens were crushed in 100 μl of CTAB extraction buffer inside a microfuge tube using a homogenizer. The tomato and chilli leaves were crushed in 1 ml of extraction buffer using mortar pestles. The lysate was vortexed and incubated at 65°C for 30 min. An equal volume of chloroform: isoamyl alcohol (24:1) was added to the lysate and centrifuged at 16,000 x g for 15 min. The upper aqueous phase was transferred to a fresh microfuge tube. The DNA was precipitated by adding 0.7 volume of ice-cold isopropanol and kept at -20°C for 1 hr. The sample was centrifuged at 16,000 x g for 15 min and the supernatant was decanted gently. The pellet was gently washed with 100 μl of 70% ethanol. The ethanol was decanted and residual ethanol was removed by drying at room temperature. The pellet if any was dissolved in 20 μl sterile distilled water in the case of B. tabaci and 50 μl in the case of a leaf sample. The concentration and purity of DNA samples were determined in a spectrophotometer (NanoDrop One, Thermo Scientific, USA).

Characterization of B. tabaci and begomoviruses

B. tabaci was randomly collected from the homogeneous population and DNA was extracted as described above. A partial fragment of the mtCOI gene was amplified using primer pairs C1-J-2195 5′-TTGATTTTTTGGTCATCCAGAAGT-3′ and TL2-N-3014 5′-TCCAATGCACTAATCTGCCATATTA-3′ [27]. Begomovirus infection was tested by PCR with universal degenerate primers for begomoviruses (Begomo F: 5′-ACGCGTGCCGTGCTGCTGCCCCCATTGTCC-3′ and Begomo R: 5′-ACGCGTATGGGCTGYCGAAGTTSAGAC-3′) targeting DNA-A [28]. PCR was carried out in a 25 μl reaction mixture containing 1x reaction buffer, 4.0 mM MgCl2, 0.4 mM dNTPs, 0.625 U Taq DNA polymerase, 10 pmole of each forward and reverse primer, and DNA template (~50 ng for B. tabaci, ~100 ng for plants). The PCR was performed in a T100 Thermal Cycler (Bio-Rad). The reaction mixture with C1-J-2195 and TL2-N-3014 primers followed one cycle of initial denaturation at 94°C for 5 min followed by 35 cycles of 94°C for 30 s, 53°C for 30 s, 72°C for 1 min and a final extension at 72°C for 10 min. The PCR with Begomo F and Begomo R primers followed one cycle of initial denaturation at 94°C for 5 min followed by 35 cycles of 94°C for 30 s, 57°C for 45 s, 72°C for 1 min 30 s and a final extension of 10 min at 72°C. The PCR products were resolved on 1% agarose gel stained with GoodView (BR Biochem, India) and visualized in a gel documentation system (MasteroGen Inc, Taiwan) with 100 bp plus DNA ladder (Thermo Scientific). Purified PCR products were ligated to pGEM-T Easy Vector (Promega, UK) following the manufacturer’s protocol and transformed into DH5α E. coli cells [29]. Plasmid DNA was extracted using Wizard Plus SV Minipreps DNA Purification System (Promega) and sequenced. The sequences were processed by BioEdit and BLASTn was performed to check the species homology. Consensus sequences were submitted in the GenBank. As B. tabaci is considered as a complex of cryptic species, a Bayesian Inference phylogeny was undertaken using MrBayes 3.2 considering genetic divergence cutoff of 4% [30].

Acquisition and inoculation of begomoviruses by B. tabaci

Young B. tabaci adult females with a maximum age of 24 hrs were used for virus acquisition and inoculation. The aviruliferous adult females were collected using an aspirator. Insect breeding dishes (50 mm d, 15 mm h) with a mesh on lid were used for acquisition and inoculation of virus by B. tabaci. 5 ml of 0.9% agar-agar was poured in the bottom half of the insect breeding dish at about 50° tilt (Fig 1). Petioles of the apical symptomatic leaves of ToLCNDV and ChiLCV-infected 45-day old plants were inserted in the solidified agar-agar and used for virus acquisition by individual B. tabaci. The virus copies in source plants were also estimated. In case of inoculation, leaf of 45-day old virus-free tomato and chilli plants was used for virus inoculation by B. tabaci. Leaves of same size and age (approximately 6.2 square cm) were considered throughout the experiment. A single aviruliferous B. tabaci was released on the virus-infected leaf for acquisition of the virus. For virus inoculation, individual B. tabaci was released on ChiLCV- and ToLCNDV-infected leaves separately for 24 hrs of virus acquisition and shifted to virus-free leaves inside the insect breeding dishes. B. tabaci within the dishes were constantly monitored initially under a stereomicroscope to confirm if they started feeding on leaves. All the acquisition and inoculation sets were kept in dark at 28 ±2°C, and 60 ±10% relative humidity. B. tabaci adults were collected from acquisition and inoculation setups at 1 min, 5 min, 10 min, 20 min, 1 hr, 2 hrs, 6 hrs, 12 hrs, and 24 hrs post release. The setups where adults settled on leaf and started feeding, were only considered for quantification of virus titre. Separate sets were maintained for ToLCNDV and ChiLCV and replicated thrice.

Fig 1

Ingestion and egestion of ToLCNDV and ChiLCV by single B. tabaci using detached leaf assay.

Standardization of real-time PCR

Three pairs of real-time PCR primers each for ToLCNDV and ChiLCV were designed based on the coat protein (CP) sequences of the viruses (Table 1). All CP sequences of ToLCNDV and ChiLCV available in the NCBI were utilized for primer designing using software Primer 3 Input version 0.4.0. The major aspects such as primer length, amplicon size, GC contents, and intra-primer or inter-primer homology were taken into consideration while designing the primers. The site-specificity of the primers was verified by performing Primer-BLAST (www.ncbi.nlm.nih.gov). Conventional PCR was carried out in a 25 μl reaction mixture to validate the newly designed primers. Each reaction contained 1x reaction buffer, 4.0 mM MgCl2, 0.4 mM dNTPs, 0.625 U Taq DNA polymerase, 10 pmole of each forward and reverse primer, and DNA template (~50 ng for B. tabaci and ~100 ng for plants), and 8.5 μl of nuclease-free water. The PCR was performed in T100 Thermal Cycler (Bio-Rad) with one cycle of initial denaturation at 95°C for 5 min, 35 cycles of denaturation at 95°C for 30 s, annealing at temperature gradient 50–54°C for 30 s based on the melting temperature of the primer sets, and extension at 72°C for 40 s followed by a final extension at 72°C for 10 min. The PCR products were resolved on 2% agarose gel stained with GoodView and visualized in a gel documentation system with 100 bp plus DNA ladder. One primer pair each for ToLCNDV and ChilCV with the best amplification was considered for real-time PCR.

Table 1

List of primer pairs used in the study.

Forward primer			Reverse primer			Amplicon size (bp)	Target region	Reference
Primer name	Primer sequence (5’-3’)	Melting temperature (°C)	Primer name	Primer sequence (5’-3’)	Melting temperature (°C)
C1-J-2195	TTGATTTTTTGGTCATCCAGAAGT	52	TL2-N-3014	CCAATGCACTAATCTGCCATATTA	52	860	B. tabaci mtCOI	[27]
Begomo F:	ACGCGTGCCGTGCTGCTGCCCCCATTGTCC	71.2	Begomo R:	ACGCGTATGGGCTGYCGAAGTTSAGAC	63.1	2800	Begomovirus DNA A	[28]
AG149F	TGAACAGGCCCATGAACAG	55.3	AG150R	ACGGACAAGGAAAAACATCAC	53.5	290	ChiLCV coat protein	This study
			AG152R	CGGACAAGGAAAAACATCACAC	54.6	290
AG153F	ACAGGCCCATGAACAGGAAG	55.5	AG154R	CACGGACAAGGAAAAACATCAC	54.6	280
AG155F	GCCGATGAACAGAAAACCC	54.2	AG156R	TTTCACACAGAATCGCTTCC	53.1	200	ToLCNDV coat protein
			AG158R	TCACACAGAATCGCTTCCC	54.9	190
			AG160R	TCGTGCCGAGATTCAAAAG	53.0	100

Real-time PCR was performed in a 48-well Insta Q48m (Himedia, India) with 20 μl reaction volume consisted of a 10 μl 2x DyNAmo ColorFlash SYBR Green qPCR Mix (Thermo Scientific), 2 μl template DNA (~100 ng for plant and ~50 ng for B. tabaci), and 10 pmole of each forward and reverse primer. Thermal cycling was performed as initial denaturation at 95°C for 5 min, 30 cycles of 95°C for 30 s, 53°C for 30 s, and 72°C for 40 s. Since SYBR Green I dye binds non-specifically to any double-stranded DNA, dissociation or melting stage was carried out after every reaction to determine the specificity of the amplicons based on the melting curve. Each of the biological replicates had three technical replicates. A no-template control (NTC) and positive control were included in each assay. The CT values thus obtained were used to calculate the mean CT and standard error of mean (SEM) using the Microsoft Excel software.

Preparation of standard curve

For preparing a standard curve of ToLCNDV and ChiLCV, the PCR amplified product of ToLCNDV and ChiLCV using primer pairs AG155F-AG158R and AG149F-AG150R, respectively were ligated in pJET1.2 vector using CloneJET PCR Cloning Kit (Thermo Scientific) and transformed into DH5α E. coli cells. A ten-fold serial dilution of the linearized plasmid DNA from 5x102- 5x10-7 ng was subjected to real-time PCR. The real-time PCR was carried out in 20 μl reaction volume as described above taking serially diluted plasmid DNA as templates. To determine the assay reproducibility each dilution of the plasmid DNA used for constructing the standard curve of ToLCNDV and ChiLCV was replicated thrice. The standard curves for ToLCNDV and ChiLCV were prepared by plotting a linear regression curve with the mean CT values on Y-axis and log DNA dilution in ng on X-axis.

Quantification of begomovirus copies

To quantify the virus copies, ToLCNDV and ChiLCV-exposed B. tabaci and inoculated leaves were collected at different time exposure and DNA was extracted as described above. The absolute quantification of ToLCNDV and ChiLCV DNA ingested and egested by individual B. tabaci was carried out by fitting the mean CT values into corresponding standard curves. The virus titre calculated in ng by extrapolating the mean CT values in the standard curve was converted into the copy number using the formula N = (X ng * 6.0221x 1023 molecules/ mole)/ (n * 660 g/ mole * 1x109 ng/g), where N is the number of viral copies; X is the amount of amplicon in ng, and n is base pairs of recombinant plasmids. Based on the total volume of extracted DNA, the average copy numbers of ToLCNDV and ChiLCV in individual B. tabaci and inoculated leaves at different periods of feeding were calculated along with SEM. The log of copy number of viruses ingested and egested by individual B. tabaci was modeled using logarithmic function separately. A partial F-test was performed to test the difference between the rate of increase in copy number of ToLCNDV and ChiLCV.

Results

Characterization of B. tabaci

The homogeneous population of B. tabaci was characterized by both morphological features and sequencing. The adult B. tabaci had a yellowish body, red compound eyes, and two pairs of white wings that were covered with powdery wax. The wings were in “inverted V” orientation at rest. Initially the B. tabaci nymphs were translucent that became yellow to pale green at later stage of life cycle. The fourth instar nymph exhibited 7 pairs of setae at dorsum. PCR amplification of B. tabaci-mtCOI gene with C1-J-2195 and TL2-N-3014 primers showed an expected amplicon of ~860 bp on agarose gel. BLASTn analysis showed 99.99% homology with other B. tabaci sequences in NCBI. The sequence can be retrieved using the GenBank Accession No. MT920041. Bayesian Inference phylogeny considering genetic divergence cutoff of 4% revealed that the population belonged to cryptic species B. tabaci Asia II 1 (data not presented).

Characterization of the begomoviruses

PCR with ToLCNDV and ChiLCV-inoculated samples produced ~2.7 kb products. The bidirectional sequencing of the products could generate 1913 nt (GenBank Accession No. MW399221) and 1896 nt (GenBank Accession No. MW399222) sequences for ToLCNDV and ChiLCV, respectively. In BLASTn analysis, both the sequences showed 100% similarity with other ToLCNDV and ChiLCV DNA-A sequences available at NCBI.

Standardization of real-time PCR assay

All the six primer pairs showed a single specific amplicon without any cross-reactivity in both in silico and in vitro PCR analysis. In gradient PCR, all the primer pairs produced specific amplicon at 50 to 55°C annealing temperature. Based on the amplification in conventional PCR at annealing temperature of 53°C, primer pair, AG155F-AG158R for ToLCNDV and AG149F-AG150R for ChiLCV were selected for real-time PCR assay. Primer pair, AG155F-AG158R and AG149F-AG150R produced prominent bands of 190 and 290 bp, respectively. Both the primer pairs did not produce a secondary peak in the melting curve analysis in real-time PCR (S1 Fig). The specific melting temperature for both ToLCNDV and ChiLCV products was around 81°C. The standard curve of ToLCNDV and ChiLCV showed high amplification efficiency of 103.72% and 112.29% respectively indicating optimal conditions for absolute quantification. The standard curves showed coefficient of correlation (R2) of 0.9827 and 0.9950, respectively, and covered a linear range from 102−109 copies of viral DNA.

Quantification of begomovirus acquired by B. tabaci

The virus copies in the source leaves used for acquisition of ToLCNDV and ChiLCV by B. tabaci were 3.34E+17 and 2.94E+17, respectively. No viral load could be detected in individual B. tabaci up to 1 min of active acquisition feeding for both the begomoviruses. ToLCNDV and ChiLCV were detectable post 5 min of active feeding by B. tabaci. ToLCNDV and ChiLCV copy numbers ingested by single B. tabaci were 4.10E+09 and 2.10E+11, respectively post 5 min of feeding (S1 Table). The virus copies increased in B. tabaci with increased feeding exposure. A steep increase of ToLCNDV load in individual B. tabaci was observed 6 hrs onwards. ToLCNDV copy number in individual B. tabaci was 2.05E+12 at 6 hrs and reached a peak of 4.64E+14 copies 24 hrs post feeding. The rate of increase of ToLCNDV copies was fitted in a logarithmic model (R2 = 0.75) (Fig 2). Whereas, in case of ChiLCV, the virus copies started accumulating sharply post 2 hrs of acquisition feeding. The increase in ChiLCV copies in individual B. tabaci followed a logarithmic model (R2 = 0.68). The ChiLCV copies in individual B. tabaci were significantly higher than ToLCNDV throughout the feeding period. The ChiLCV copy numbers increased up to 6.40E+15 which was 14-fold higher than ToLCNDV at 24 hrs of feeding. The rate of virus ingestion by individual B. tabaci was significantly higher (partial F-test, p<0.001) in case of ChiLCV than ToLCNDV.

Fig 2

Dynamics of ToLCNDV and ChiLCV copies ingested (a) and egested (b) by individual B. tabaci. Feeding exposure is expressed in min on X-axis and log of virus copy number is plotted on Y-axis. ToLCNDV and ChiLCV copies were estimated at 1 min, 5 min, 10 min, 20 min, 1 hr, 2 hrs, 6 hrs, 12 hrs, and 24 hrs of feeding. The increase in virus copies is marked by maroon (ToLCNDV) and blue (ChiLCV) lines. The dotted lines indicate a best-fit logarithmic curved line to illustrate predicted increase of virus copies with time. R2 values and equations are mentioned on the graph.

Quantification of begomovirus egested by B. tabaci

The amount of virus egested by individual B. tabaci was quantified in detached leaves. None of the begomoviruses egested by a single B. tabaci could be detected at 1 min of active feeding. However, both the begomoviruses could be detected in real-time PCR 5 min onwards. ToLCNDV and ChiLCV copy numbers egested by individual B. tabaci in detached tomato and chilli leaves were 2.20E+10 and 2.10E+09, respectively 5 min post feeding (S1 Table). The virus copy number increased in detached leaves with increased feeding exposure of B. tabaci. The virus copies increased to 5.52E+12 and 6.02E+11, respectively for ToLCNDV and ChiLCV 2 hrs post inoculation feeding. B. tabaci released around 10-fold higher copies of ToLCNDV than ChiLCV up to 6 hrs of feeding. Copy number of both the viruses started increasing steeply post 6 hrs of feeding. ToLCNDV copy number was 4.19E+13 at 6 hrs and reached up to 9.80E+15 24 hrs post feeding. Whereas, individual B. tabaci egested 3.38E+12 copies of ChiLCV at 6 hrs and increased up to 8.31E+13 copies 24 hrs post feeding on detached leaf. The rate of increase in virus copies egested by individual B. tabaci followed a logarithmic model for both the viruses (R2 = 0.78, 0.75) (Fig 2). However, the rate of increase of ToLCNDV was significantly higher (partial F-test, p<0.001) than ChiLCV.

Discussion

B. tabaci vectors large number of plant viruses of the genera Begomovirus, Crinivirus, Carlavirus, Closterovirus, and Ipomovirus [31, 32]. The genetic material, shape of the virion, and the mode of transmission of these viruses are very different. Begomoviruses are small circular ssDNA viruses transmitted by B. tabaci in a persistent circulative way. B. tabaci ingests the begomovirus particles during feeding on phloem sap of infected plants. Virions pass through the food canal and enter the digestive tract. Midgut, especially the filter chamber is the site for begomovirus translocation. Virions are transported through the cytoplasm of filter chamber in vesicles that fuse with basal plasma membrane and released in the hemocoel. The interaction of begomovirus with B. tabaci has been the subject of many studies for the last fifty years [33]. During the entire process, the viral proteins need to interact with several midgut and primary salivary gland proteins [34]. Coat protein (CP) of the begomovirus interacts with the various insect tissues to ensure further translocation within B. tabaci until egestion. Several proteins in the midgut are known to bind with the begomovirus CP and influence the transmission. Heat shock protein 70, peptidyl-prolyl isomerases protein, peptidoglycan recognition protein genes regulate begomovirus transmission by B. tabaci [35-37]. CP of TYLCV interacts with a 63-kDa GroEL chaperone produced by endosymbiotic bacteria to protect the virus in hemolymph [38, 39]. The virions gradually accumulate in the primary salivary gland through receptor-like elements and egested with saliva during feeding.

The involvement of several receptors in interactions of B. tabaci and begomoviruses alters the transmission competence of different B. tabaci cryptic species and virus species combinations [34, 40–42]. B. tabaci MEAM1 was found to be a better transmitter of bhendi yellow vein mosaic virus in comparison to B. tabaci Asia 1 [43]. Cotton leaf curl Multan virus was reported to be successfully transmitted by B. tabaci Asia II 7, but MEAM1 and MED were unable to transmit the same [44]. The present study reports the absolute quantification of ToLCNDV and ChiLCV copies ingested and egested by B. tabaci cryptic species Asia II 1. B. tabaci Asia II 1 could acquire >109 copies of ToLCNDV and ChiLCV within 5 min of feeding. ChiLCV copies acquired by an individual B. tabaci were 51-fold higher than ToLCNDV at 5 min of active feeding. Previously it was reported that ChiLCV needs at least 10 min to 3 hrs of acquisition access period (AAP) for successful transmission [45]. However, the results of the present study indicate that B. tabaci could acquire millions of copies of ChiLCV by only 5 min of active feeding. The ingestion of virus copies increased with increase in feeding exposure. The ChiLCV copy number started increasing sharply post 2 hrs of feeding. The rate of increase followed a logarithmic model. Whereas, maximum increase of ToLCNDV copies in individual B. tabaci was 6 hrs post feeding. The difference may be due to the efficiency of the virus CP to interact with B. tabaci receptors to become circulative. However, Kollenberg et al. [17] suggest variation in virus uptake may be due to the variation in virus concentration in source plants. To overcome the variation in viral DNA in source plant, in the present study, the top leaf of plants of same physiological age were used. The viral copies in the source plants of ToLCNDV and ChiLCV were almost equal. No virus copy was detected in B. tabaci by real-time PCR immediately (1 min) after the virus exposure. We do not have sufficient evidence to say whether the virus titer at 1 min of feeding is too low to detect in real-time PCR or B. tabaci needs a buffer time to direct its stylets to phloem tissue where the virions are abundant. The minimum phloem contact threshold period of around 1.8 min for successful inoculation of TYLCV by B. tabaci in tomato plants [46] justifies no detection of virus copies immediately after the feeding started. A maximum amount of 0.5–1.6 ng of TYLCV DNA was found in B. tabaci using quantitative chemiluminescent dot blot assay [16]. Similar dynamics of virus accumulation in B. tabaci were described by Kollenberg et al. [17]. The copies of bipartite watermelon chlorotic stunt virus (WmCSV) were 10-times higher than monopartite, TYLCV in B. tabaci. After feeding of 1 hr, 7.6E+4 copies of WmCSV genome were calculated in B. tabaci. Copies of WmCSV increased up to 4.7E+7 during first 16 hrs of feeding by B. tabaci [17]. In contrast, the present results indicate that copy number of monopartite, ChiLCV were 186-fold higher than bipartite, ToLCNDV in B. tabaci 1 hr post feeding. We estimated 4.92E+10 copies of ToLCNDV and 9.16E+12 copies of ChiLCV ingested by B. tabaci post 1 hr of feeding. The difference in copy number with previous studies may be due to variation in virus species and vectoring efficiency of B. tabaci cryptic species. Besides, it is important to note that virus concentrations in all the previous studies were measured in a group of B. tabaci, not in individual flies. The present study, for the first time, provided precise estimation of begomovirus copies by testing individual B. tabaci in real-time PCR.

Egestion of the virus copies by B. tabaci was recorded at different time intervals of feeding. Unlike virus acquisition, copy number of ToLCNDV was higher than ChiLCV in individual flies. The rate of egestion of both the viruses by B. tabaci followed a logarithmic model. ToLCNDV copy number was 10-fold higher than the ChiLCV at 6 hrs of feeding. The higher copies of ToLCNDV indicates higher efficiency of B. tabaci Asia II 1 in releasing ToLCNDV as compared to ChiLCV. TYLCV, tomato yellow leaf curl China virus (TYLCCNV), tomato leaf curl Bangalore virus (ToLCBaV), papaya leaf curl China virus (PaLCuCNV), tomato leaf curl Taiwan virus (ToLCTWV), tomato yellow leaf curl Thailand virus (TYLCTHV), euphorbia yellow mosaic virus (EuMV), and tobacco curly shoot virus (TbCSV) are transmitted by different B. tabaci cryptic species at varying efficiencies [34, 40–42, 47–55]. A steady increase in the ToLCNDV copies was observed 6 hrs post feeding. However, we are not sure whether the estimation includes the replication of ToLCNDV in the detached leaves. The copies of ToLCNDV in detached leaf were higher than the copies acquired by B. tabaci in 24 hrs indicating replication of ToLCNDV in detached leaf. Replication initiator protein (Rep) and Replication enhancer proteins of TYLCV need to interact with host factor in order to create a cellular environment favorable for virus multiplication. It takes some time to recruit the other host factors and reprogramme the host cell cycle by Rep before the replication starts [56-58]. If this is the case, then the virus copies in the detached leaf during first few hours of feeding can be considered as the copies inoculated exclusively by B. tabaci which indicates around 10-fold higher egestion of ToLCNDV than ChiLCV. However, copies of ChiLCV in detached leaf 24 hrs post inoculation feeding was lesser than the copies B. tabaci acquired. Besides the low efficiency of B. tabaci Asia II 1 in inoculating ChiLCV, replication of ChiLCV in detached chilli leaf might also be sluggish than ToLCNDV in tomato leaf. Progressive displacement of tomato yellow leaf curl Sardinia virus by TYLCV due to higher transmission efficiency of TYLCV by B. tabaci MEAM1 came into light during tomato epidemics in Spain [59]. In Taiwan, MEAM1 was reported to transmit TYLCTHV virus more efficiently than ToLCTWV [54]. Coinfection of ToLCNDV and ChiLCV is often reported in solanaceous hosts. The synergistic or antagonistic interactions of ToLCNDV and ChiLCV will be worthy of future research to shed light on symptom expression, replication, and cell to cell movement of these two begomoviruses.

In conclusion, the present study, for first time, reports the copies of begomoviruses acquired and/or inoculated by individual B. tabaci and describes the comparative dynamics of ToLCNDV and ChiLCV. Moreover, the assay system developed in this study will be helpful for rapid screening of host resistance in large scale by quantifying virus copies in detached leaves by single whitefly inoculation.

Copies of ToLCNDV and ChiLCV ingested and egested by individual B. tabaci at different feeding exposure.

(DOCX)

Click here for additional data file.

Melt curves of ToLCNDV (a) and ChiLCV (b) amplicons in real-time PCR analysis indicated specificity of the reactions. The specific melting temperature for both ToLCNDV and ChiLCV products was around 81°C. Standard curves show a linear relationship between log DNA concentrations in ng on X-axis and CT values on Y-axis for ToLCNDV (c) and ChiLCV (d). Each concentration was replicated thrice. The equation of the straight line and the coefficient of correlation (R2) are mentioned on the graph.

(DOCX)

Click here for additional data file.

10 Jun 2021

PONE-D-21-15811

How many begomovirus copies are acquired and inoculated by its vector, whitefly (Bemisia tabaci) during feeding?

PLOS ONE

Dear Dr. Ghosh,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Jul 25 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Rajarshi Gaur

Academic Editor

PLOS ONE

Journal Requirements:

1) Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

2) Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

3)  Thank you for stating the following in the Acknowledgments Section of your manuscript:

[The authors acknowledge the support received from IARI, New Delhi.]

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

[The author(s) received no specific funding for this work]

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

Reviewer #3: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: N/A

Reviewer #3: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Roy et al. describes in this manuscript the quantification of the ingestion and egestion by Bemisia tabaci of two begomovirus species. The authors first identify the specific biotype of B. tabaci by PCR and sequence analysis of the mtCOI gene. They then design a experimental setup that allowed them to sample B. tabaci individuals that acquire begomoviruses, Tomato leaf curl New Delhi virus or Chilli leaf curl virus, by feeding on tomato and chili leaves, respectively. Virus egestion over time is also determined. Both viruses are quantified by qPCR in individual insects.

The authors determine that the dynamics of ingestion and egestion of the two viruses are differential. In the case of ToLCNDV, the dynamic curve of ToLCNDV ingestion follows a 3er order polynomial curve, which could indicate a saturation of the virus binding sites in the insect feeding apparatus. In the egestion of this virus and in the ingestion and egestion of ChLV, the dynamics obey a 2nd order polynomial equation.

The novelty of this study lies in the quantification of the viruses in individual insects and the identification of distinct dynamics of the ingestion and release of two viruses by B. tabaci.

In my opinion, these are interesting results that deserve publication, but first it is necessary to correct some aspects of the presentation and intrepretation of the results.

Minor comments

Figures 1 and 2 and Table 1 may go better in Supplementary material. Table 2 is graphically represented in Figure 3, so it is redundant, and is therefore either deleted or included in the Supplementary material.

Major comments

In Figure 3 the curves are not well distinguishable due to the type of representation. For a better visualization, the axis of the virus titers should be in logarithmic scale. I attach some figures of how they should be. Data points should be not connected with lines and should be plotted including the standard deviations of the means. On the other hand, any number of points can be connected to a polynomial equation, but this does not help its mechanistic interpretation. Since ingestion involves adsorption to a surface/protein (virion binding sites), it should be analyzed according to adsorption models such as the Langmuir, Freundlich or Langmuir-Freundlich isotherm models, just to cite some of the most common (e.g. see: 10.1016/j.jconhyd.2011.12.001). Once the type of isotherm that best fits the data (higher R2 value) has been obtained, the curve would be included in the same figure where the real data are represented. In this way, the ingestions (binding) and releases of both viruses could be interpreted mechanistically.

Reviewer #2: It is a good study to determine the number of virions acquired and transmitted by B.tabaci to infect plants with the two begomoviruses used in the study.

The MS needs minor revision to address some questions raised in the attached copy of the MS

Reviewer #3: It is a good piece of work which provided the information about the copy number acquired and egested by a single whitefly. Well laid out experiments brought out this authentic information and this findings support the earlier theory that a single whitefly can efficiently transmit the virus to a susceptible host which in turn can be a source of inoculam for fast spreading in the field.

Why there is a sudden fluctuation in copy number in case of ToLCNDV between 10 min to 6h of aquisition as well as in case of ChiLCV during 10 min to 12 hrs of aquisition?

whether virus propagation taken place with in the body and copy number increase occurred or not during the time point between aquistion and egestion. If information available on this may be added in the manuscript

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Anupam Varma

Reviewer #3: Yes: Makeshkumar T

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: review.pdf

Click here for additional data file.

Submitted filename: PLOS One B.tabaci transmission article comments Final.docx

Click here for additional data file.

6 Aug 2021

Response to reviewers’ comments:

We are thankful to the Reviewers and Academic Editor for critically going through the MS and suggesting substantial improvements. All the suggestions made by the reviewers have been incorporated into the revised MS. Our response to each comment is shown below. The changes made in the manuscript are indicated in red colour in the text. We trust that our revisions will make this MS acceptable for publication in the journal PLOS One.

Reviewer #1: Roy et al. describes in this manuscript the quantification of the ingestion and egestion by Bemisia tabaci of two begomovirus species. The authors first identify the specific biotype of B. tabaci by PCR and sequence analysis of the mtCOI gene. They then design a experimental setup that allowed them to sample B. tabaci individuals that acquire begomoviruses, Tomato leaf curl New Delhi virus or Chilli leaf curl virus, by feeding on tomato and chili leaves, respectively. Virus egestion over time is also determined. Both viruses are quantified by qPCR in individual insects.

The authors determine that the dynamics of ingestion and egestion of the two viruses are differential. In the case of ToLCNDV, the dynamic curve of ToLCNDV ingestion follows a 3er order polynomial curve, which could indicate a saturation of the virus binding sites in the insect feeding apparatus. In the egestion of this virus and in the ingestion and egestion of ChLV, the dynamics obey a 2nd order polynomial equation.

The novelty of this study lies in the quantification of the viruses in individual insects and the identification of distinct dynamics of the ingestion and release of two viruses by B. tabaci.

In my opinion, these are interesting results that deserve publication, but first it is necessary to correct some aspects of the presentation and interpretation of the results.

Minor comments

Comment 1: Figures 1 and 2 and Table 1 may go better in Supplementary material. Table 2 is graphically represented in Figure 3, so it is redundant, and is therefore either deleted or included in the Supplementary material.

Response: Figure 1 and 2 has been merged with Fig 3 as a single figure. Table 2 is graphically represented in Figure 3, so it has been revised as Supplementary material.

Table 1 contains primer sequences that have been designed and validated in this study. We prefer to keep this along with the main ms.

Major comments

Comment 2: In Figure 3 the curves are not well distinguishable due to the type of representation. For a better visualization, the axis of the virus titers should be in logarithmic scale. I attach some figures of how they should be. Data points should be not connected with lines and should be plotted including the standard deviations of the means. On the other hand, any number of points can be connected to a polynomial equation, but this does not help its mechanistic interpretation. Since ingestion involves adsorption to a surface/protein (virion binding sites), it should be analyzed according to adsorption models such as the Langmuir, Freundlich or Langmuir-Freundlich isotherm models, just to cite some of the most common (e.g. see: 10.1016/j.jconhyd.2011.12.001). Once the type of isotherm that best fits the data (higher R2 value) has been obtained, the curve would be included in the same figure where the real data are represented. In this way, the ingestions (binding) and releases of both viruses could be interpreted mechanistically.

Response: We agreed with the reviewer’s suggestion and have gone through the suggested literatures. However, the Langmuir, Freundlich or Langmuir-Freundlich isotherm models are adoptable for quantity of a gas adsorbed into a solid surface. In our case, we have virus quantity as one factor and another factor is time. Although the virus quantity adsorbed on the surface of the receptor, receptor surface area is not known in our study. Hence, the model could not be fitted in our data set. The time points of the present study could not be transformed in the model parameter.

Reviewer #2: It is a good study to determine the number of virions acquired and transmitted by B.tabaci to infect plants with the two begomoviruses used in the study.

The MS needs minor revision to address some questions raised in the attached copy of the MS

Comment: Introduction needs to be rewritten to give more information about the transmission of Begomoviruses by whiteflies.

Response. Necessary information has been added as suggested.

Comment: Please check and correct, Criniviruses, Ipomoviruses, and torradoviruses are shown to be transmitted by B. tabaci.

Response: included in the revised ms.

Comment: These references are not good here!!!

Response: Appropriate references have been cited in the revised ms.

Comment: Check and use the correct number

Response: revised as per latest ICTV checklist

Comment: Number not kinetics? Perhaps you want to say “The number of begomovirus particles acquired and transmitted by individual B. tabaci is important to shed light on the efficiency of virus transmission and useful in understanding the disease epidemiology.” Please check an correct.

Response: Revised as suggested

Comment: You have used similar conditions for the acquisition and inoculation of the viruses. Therefore the two paragraphs can be combined easily mentioning that for aquisition infected leaves for used and for inoculation healthy leaves were used

Response: merged as suggested

Comment: How was the uniformity in size and weight of the leaves was maintained?

Response: Leaves of uniform shape and size were considered throughout the experiment. Mentioned in revised ms.

Comment: Why not give actual calculated number instead of the formula as in the abstract you are talking about a million copies!!!

Response: This is not a formula. Because superscripted exponents like 107 cannot always be conveniently displayed, the letter E (or e) is often used to represent "times ten raised to the power of" (which would be written as "× 10n").

Comment: What was the difference in the number of copies in tomato and chili plants used for acquisition?

Response: The virus copies in source plants were almost equal. Now mentioned in revised ms.

Comment: This needs explanation!!!

Response: included in discussion (line 282-291)

Comment: Did it match with the virus found in the whiteflies at different acquisition times?

Response: Virus copies increased with exposure in both acquisition and inoculation. However, the trend in increase was significantly different. Now, mentioned in discussion of revised ms.

Comment: How did you compensate the multiplication of the viruses in the inoculated leaves?

Response: the multiplication of the virus in detached leaves cannot be compensate in the current methods. This has been mentioned in discussion (line 300-310).

Comment: Did you test the leaves for virus titre after one minute inoculation feed at different time intervals to determine the minimum number of particles required for causing infection

Response: We agree with the reviewer’s suggestion. This would be an interesting study to understand the number of particles required to cause infection. However, this was beyond the scope of the current study. We will try to address this suggestion in our future studies.

Comment: Change to ‘vectors’

Response: changed

Comment: Change to a large number of viruses. There is no sanctity of the number 100!!! Even tomato is affected by nearly 100 species of begomoviruses.

Response: Changed

Comment: Authors should check the whole MS and be consistent. Compare this with the statement in the introduction.

Response: revised accordingly throughout the ms

Comment: You may use virions at other places too, but make it uniform.

Response: mentioned as virions in all places as suggested

Comment: Needs checking in the light of comments given earlier

Response: revised accordingly

Comment: Do you mean to say a million copies are required to cause infection?Please check and give convincing evidence.

Response: Revised as suggested

Comment: This is important, you need to check and confirm.

Response: Yes, we agree with the reviewers. Confirming the phloem contact time needs further in detail experiments and specialized instruments that is not feasible at this moment.

Comment: This may vary from virus-host combinations. Just quoting one reference may not be correct. Moreover, this is not relevant here.

Response: deleted in revised version

Comment: Interesting this should have prompted testing at two minutes!!!

Response: This may vary with host-virus-vector combinations. In the present experiment, we have tested at 1 min and 5 min.

Comment: Needs checking; see earlier comment. Please give actual calculated number

Response: It is the actual number. ‘E+10’ means 1010

Comment: Needs checking?

Response: The polynomial model has been removed as suggested by reviewer 1

Comment: Is it first time? What about WmCSV?

Response: The copy number of WmCSV was estimated in group of whitefly. The present study is the first to estimate the virus copies in individual whitefly

Comment: How?

Response: expanded in revised ms.

Reviewer #3:

It is a good piece of work which provided the information about the copy number acquired and egested by a single whitefly. Well laid out experiments brought out this authentic information and this findings support the earlier theory that a single whitefly can efficiently transmit the virus to a susceptible host which in turn can be a source of inoculam for fast spreading in the field.

Why there is a sudden fluctuation in copy number in case of ToLCNDV between 10 min to 6h of aquisition as well as in case of ChiLCV during 10 min to 12 hrs of aquisition? whether virus propagation taken place with in the body and copy number increase occurred or not during the time point between aquistion and egestion. If information available on this may be added in the manuscript

Response: This is not a sudden increase if you consider the duration of the virus exposure. The copies increased in individual whitefly with increase in acquisition time. The exposure to virus source for 6 to 12 hrs is the reason for increase in virus titre.

Replication of TYLCV in whitefly has been reported. We have tested the same phenomenon for predominant begomovirus species in India in a different study. There was no evidence of replication of ToLCNDV and ChiLCV in whitefly.

Submitted filename: Response to reviewers.docx

Click here for additional data file.

23 Sep 2021

PONE-D-21-15811R1How many begomovirus copies are acquired and inoculated by its vector, whitefly (Bemisia tabaci) during feeding?PLOS ONE

Dear Dr. Ghosh,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Nov 07 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Rajarshi Gaur

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #4: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #4: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #4: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #4: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #4: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Figure 1 has not been modified as suggested: Mean virus copies in the Y-axis should be in logarithmic scale for better visualization. Besides, figure 1c, 1e and 1f should be apart as e.g. figure 2, as they deal with different matters to those in figs. 1a and 1b. Nevertheless, I better think that Figs. 1c, 1e and 1f could be in Supplementary material.

To understand mechanistically the binding of viral particles and their egestion, the adsorption models outlined in my previous comments might still be useful, see Powell et al., 2000. Investigating the Effect of Carbon Shape on Virus Adsorption. https://doi.org/10.1021/es991097w. However, it is true that it is difficult to estimate the binding surfaces on the insect feeding apparatus, which might be too speculative. Therefore, I agree with the authors that their models of acquisition and egestion with time are good enough.

Reviewer #4: This study from Roy et al describes a novel method for quantification of acquisition & inoculation ToLCNDV and ChiLCV by Bemisia tabaci through detached leaf assay using real-time PCR. Overall, the experiments are well conceptualized and are of good scientific interest for future research on virus-vector epidemiology. The revised version of submitted manuscript has included major comments addressed from the three reviewers therefore, I recommend accepting the manuscript for publication. However, there are minor suggestions which should be incorporated in the final version.

1- The primers in Table-1 should be cross-checked as the sequence for AG153F and AG154R cannot be exact same therefore should be corrected. Also, the AG151F and AG153F are also similar, therefore please cross-confirm and apply corrections.

2- I would highly recommend the authors to provide a flow diagram or pictoral schematic template drawing for the entire protocol of ingestion and egestion by B. tabaci using detached leaf assay for better demonstration in the manuscript.

3-Please include error bars wherever applicable in the graphical data plots.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Leonardo Velasco

Reviewer #4: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: Review comments-09.22.21.docx

Click here for additional data file.

2 Oct 2021

The authors are thankful to the Editor and reviewers for critically going htrough the manuscript and suggesting substantial improvement. All the suggestions made by the reviewers have been incorporated in the revised manuscript (R2). Our response to each comment is shown below. The changes made in the manuscript are indicated in red in the text. We trust that our revisions will make this MS acceptable for publication in Plos One.

Reviewer #1: Figure 1 has not been modified as suggested: Mean virus copies in the Y-axis should be in logarithmic scale for better visualization. Besides, figure 1c, 1e and 1f should be apart as e.g. figure 2, as they deal with different matters to those in figs. 1a and 1b. Nevertheless, I better think that Figs. 1c, 1e and 1f could be in Supplementary material.

Response: Mean virus copies have been transformed in log scale as suggested. Fig. 1c-f have been revised as supplementary materials.

To understand mechanistically the binding of viral particles and their egestion, the adsorption models outlined in my previous comments might still be useful, see Powell et al., 2000. Investigating the Effect of Carbon Shape on Virus Adsorption. https://doi.org/10.1021/es991097w. However, it is true that it is difficult to estimate the binding surfaces on the insect feeding apparatus, which might be too speculative. Therefore, I agree with the authors that their models of acquisition and egestion with time are good enough.

Response: Thank you. In accordance with the previous comment, the model has also been changed to a logarithmic model as the polynomial model did not fit in the revised figure after transformation of mean copy number into log scale.

Reviewer #4: This study from Roy et al describes a novel method for quantification of acquisition & inoculation ToLCNDV and ChiLCV by Bemisia tabaci through detached leaf assay using real-time PCR. Overall, the experiments are well conceptualized and are of good scientific interest for future research on virus-vector epidemiology. The revised version of submitted manuscript has included major comments addressed from the three reviewers therefore, I recommend accepting the manuscript for publication. However, there are minor suggestions which should be incorporated in the final version.

1- The primers in Table-1 should be cross-checked as the sequence for AG153F and AG154R cannot be exact same therefore should be corrected. Also, the AG151F and AG153F are also similar, therefore please cross-confirm and apply corrections.

Response: Corrected in the revised ms.

2- I would highly recommend the authors provide a flow diagram or pictoral schematic template drawing for the entire protocol of ingestion and egestion by B. tabaci using detached leaf assay for better demonstration in the manuscript.

Response: A pictorial diagram (Fig 1) has been provided as suggested.

3-Please include error bars wherever applicable in the graphical data plots.

Response: The figure has been revised in light of the comments made by Reviewer 1. SEm values are included in Supplementary Table 1.

Submitted filename: response to reviewers.docx

Click here for additional data file.

11 Oct 2021

How many begomovirus copies are acquired and inoculated by its vector, whitefly (Bemisia tabaci) during feeding?

PONE-D-21-15811R2

Dear Dr. Ghosh,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Rajarshi Gaur

Academic Editor

PLOS ONE