Cortical softening elicits zygotic contractility during mouse preimplantation development.

Actomyosin contractility is a major engine of preimplantation morphogenesis, which starts at the 8-cell stage during mouse embryonic development. Contractility becomes first visible with the appearance of periodic cortical waves of contraction (PeCoWaCo), which travel around blastomeres in an oscillatory fashion. How contractility of the mouse embryo becomes active remains unknown. We have taken advantage of PeCoWaCo to study the awakening of contractility during preimplantation development. We find that PeCoWaCo become detectable in most embryos only after the second cleavage and gradually increase their oscillation frequency with each successive cleavage. To test the influence of cell size reduction during cleavage divisions, we use cell fusion and fragmentation to manipulate cell size across a 20- to 60-μm range. We find that the stepwise reduction in cell size caused by cleavage divisions does not explain the presence of PeCoWaCo or their accelerating rhythm. Instead, we discover that blastomeres gradually decrease their surface tensions until the 8-cell stage and that artificially softening cells enhances PeCoWaCo prematurely. We further identify the programmed down-regulation of the formin Fmnl3 as a required event to soften the cortex and expose PeCoWaCo. Therefore, during cleavage stages, cortical softening, mediated by Fmnl3 down-regulation, awakens zygotic contractility before preimplantation morphogenesis.

Introduction

During embryonic development, the shape of animal cells and tissues largely relies on the contractility of the actomyosin cortex [1-3]. The actomyosin cortex is a submicron thin layer of cross-linked actin filaments, which are put under tension by nonmuscle myosin II motors [4]. Tethered to the plasma membrane, the actomyosin cortex is a prime determinant of the stresses at the surface of animal cells [4,5]. Contractile stresses of the actomyosin cortex mediate crucial cellular processes such as the ingression of the cleavage furrow during cytokinesis [6-8], the advance of cells’ back during migration [9,10], or the retraction of blebs [11,12]. At the tissue scale, spatiotemporal changes in actomyosin contractility drive apical constriction [13,14] or the remodeling of cell–cell contacts [15,16]. Although tissue remodeling takes place on timescales from tens of minutes to hours or days, the action of the actomyosin cortex is manifest on shorter timescales of tens of seconds [1,3,17]. In fact, actomyosin is often found to act via pulses of contraction during morphogenetic processes among different animal species from nematodes to human cells [13,14,18-25]. A pulse of actomyosin begins with the polymerization of actin filaments and the sliding of myosin minifilaments until maximal contraction of the local network within about 30 seconds [13,26,27]. Then, the actin cytoskeleton disassembles, and myosin is inactivated, which relaxes the local network for another 30 seconds [28-30]. These cycles of contractions and relaxations are governed by the turnover of the Rho GTPase and its effectors, which are well-characterized regulators of actomyosin contractility [19,29,31]. Indeed, the Rho pathway controls both the activity of myosin motors via their phosphorylation and the turnover of actin filaments via formins [5,19,26,29]. In instances where a sufficient number of pulses occur, pulses of contraction display a clear periodicity. The oscillation period of pulsed contractions ranges from 60 seconds to 200 seconds [14,18,19,22]. The period appears fairly defined for cells of a given tissue but can vary between tissues of the same species. What determines the oscillation period of contraction is poorly understood, although the Rho pathway may be expected to influence it [19,29,30]. Finally, periodic contractions can propagate into traveling waves. Such periodic cortical waves of contraction (PeCoWaCo) were observed in cell culture, starfish, and frog oocytes as well as in mouse preimplantation embryos [19,22,32,33]. In starfish and frog oocytes, mesmerizing Turing patterns of Rho activation with a period of 80 seconds and a wavelength of 20 μm appear in a cell cycle–dependent manner [19,34]. Interestingly, experimental deformation of starfish oocytes revealed that Rho activation wave front may be coupled to the local curvature of the cell surface [35], which was proposed to serve as a mechanism for cells to sense their shape [34]. In mouse embryos, PeCoWaCo with a period of 80 seconds were observed at the onset of blastocyst morphogenesis [22,36]. What controls the propagation velocity, amplitude, and period of these waves is unclear, and the potential role of such evolutionarily conserved phenomenon remains a mystery.

During mouse preimplantation development, PeCoWaCo become visible before compaction [22], the first morphogenetic movements leading to the formation of the blastocyst [3,37,38]. During the second morphogenetic movement, prominent PeCoWaCo are displayed in prospective inner cells before their internalization [36]. In contrast, cells remaining at the surface of the embryo display PeCoWaCo of lower amplitude due to the presence of a domain of apical material that inhibits the activity of myosin [36]. Then, during the formation of the blastocoel, high temporal resolution time-lapse hint at the presence of PeCoWaCo as microlumens coarsen into a single lumen [39]. Therefore, PeCoWaCo appear throughout the entire process of blastocyst formation [3]. However, little is known about what initiates and regulates PeCoWaCo. The analysis of maternal zygotic mutants suggests that PeCoWaCo in mouse blastomeres result primarily from the action of the nonmuscle myosin heavy chain IIA (encoded by Myh9) rather than IIB (encoded by Myh10) [40]. Dissociation of mouse blastomeres shows that PeCoWaCo are cell autonomous since they persist in single cells [22]. Interestingly, although removing cell–cell contacts free up a large surface for the contractile waves to propagate, the oscillation period seems robust to the manipulation [22]. Similarly, when cells form an apical domain taking up a large portion of the cell surface, the oscillation period does not seem to be different from cells in which the wave can propagate on the entire cell surface [36]. This raises the question of how robust PeCoWaCo are to geometrical parameters, especially in light of recent observations in starfish oocytes [34,35]. This question becomes particularly relevant when considering that, during preimplantation development, cleavage divisions halve cell volume with each round of cytokinesis [41,42].

In this study, we investigate how the contractility of the cleavage stages emerges before initiating blastocyst morphogenesis. We take advantage of the slow development of the mouse embryo to study thousands of pulsed contractions and of the robustness of the mouse embryo to size manipulation to explore the geometrical regulation of PeCoWaCo. We discover that the initiation, maintenance, or oscillatory properties of PeCoWaCo do not depend on cell size. Instead, we discover a gradual softening of blastomeres with each successive cleavage, which exposes PeCoWaCo. This softening results in part from the reorganization of the actin cortex due to the down-regulation of the formin Fmnl3 during the first cleavage stages. Together, this study reveals how preimplantation contractility is robust to the geometrical changes of the cleavage stages during which the zygotic contractility awakens.

Results

PeCoWaCo during cleavage stages

PeCoWaCo have been observed at the 8-, 16-cell, and blastocyst stages. To know when PeCoWaCo first appear, we imaged embryos during the cleavage stages and performed Particle Image Velocimetry (PIV) and Fourier analyses (Fig 1A–1C, S1 Movie). We note that PeCoWaCo pause during mitosis (S2 Movie), similarly to pulsed contractions in fly neuroblasts [24], and we have therefore excluded from our analysis embryos during mitosis. This analysis reveals that PeCoWaCo are detectable in fewer than half of zygote and 2-cell stage embryos and become visible in most embryos from the 4-cell stage onward (Fig 1D, S1A–S1F Fig, S1 Table, S1 Data). Furthermore, PeCoWaCo only display large amplitude from the 4-cell stage onward (Fig 1B and 1C). Interestingly, the period of oscillations of the detected PeCoWaCo shows a gradual decrease from 150 seconds to 80 seconds between the zygote and 8-cell stages (Fig 1E, S1 Table, S1 Data). The acceleration of PeCoWaCo rhythm could simply result from the stepwise changes in cell size after cleavage divisions. Indeed, we reasoned that if the contractile waves travel at constant velocity, the period will scale with cell size and shape. This is further supported by the fact that PeCoWaCo are detected at the same rate and with the same oscillation period during the early or late halves of the 2-, 4-, and 8-cell stages (S1G and S1H Fig, S2 Table, S1 Data). Therefore, we set to investigate the relationship between cell size and periodic contractions.

Fig 1

Analysis of PeCoWaCo during cleavage stages.

(A) Representative images of a short-term time-lapse overlaid with a subset of velocity vectors from PIV analysis during cleavage stages (S1 Movie). Magenta for positive and green for negative Y directed movement. Scale bar, 20 μm. (B) Velocity over time for a representative velocity vector of each embryo shown in A. (C) Mean power spectrum resulting from Fourier transform of PIV analysis of zygote (gray, n = 13), 2-cell (blue, n = 18), 4-cell (orange, n = 31), and 8-cell (green, n = 21) stages embryos showing detectable oscillations. Data show as mean ± SEM (S1 Table). (D) Proportion of zygote (gray, n = 27), 2-cell (blue, n = 52), 4-cell (orange, n = 39), and 8-cell stage (green, n = 34) embryos showing detectable oscillations after Fourier transform of PIV analysis. Light gray shows nonoscillating embryos. Error bars show SEM. Chi-squared p-values comparing different stages are indicated (S1 Table, S1 Data). (E) Oscillation period of zygote (gray, n = 13), 2-cell (blue, n = 18), 4-cell (orange, n = 31), and 8-cell (green, n = 21) stages embryos. Larger circles show median values. Student t test p-values are indicated (S1 Table, S1 Data). PeCoWaCo, periodic cortical waves of contraction; PIV, Particle Image Velocimetry.

Cell size is not critical for the initiation or maintenance of PeCoWaCo

First, to test whether the initiation of PeCoWaCo in most 4-cell stage embryos depends on the transition from the 2- to 4-cell stage blastomere size, we prevented cytokinesis. Using transient exposure to Vx-680 to inhibit the activity of Aurora kinases triggering chromosome separation, we specifically blocked the 2- to 4-cell stage cytokinesis without compromising the next cleavage to the 8-cell stage (Fig 2A and 2B, S3 Movie). This causes embryos to reach the 4-cell stage with blastomeres the size of 2-cell stage blastomeres. At the 4-cell stage, we detect PeCoWaCo in most embryos whether they have 4- or 2-cell stage size blastomeres (Fig 2C, S3 Table, S1 Data). Furthermore, the period of oscillation is identical to 4-cell stage embryos in both control and drug-treated conditions (Fig 2D, S3 Table, S1 Data). Importantly, we do not measure any change in cell surface tension when treating embryos with Vx-680 indicating that the treatment does not seem to impact the overall mechanics of the actomyosin cortex (S2 Fig, S4 Table, S1 Data). This suggests that 4-cell stage blastomere size is not required to initiate PeCoWaCo in the majority of embryos.

Fig 2

Initiation of PeCoWaCo is independent of cell size.

(A) Schematic diagram of PeCoWaCo analysis after blocking the second cleavage division with 2.5 μM Vx680. (B) Representative images of DMSO and Vx-680 treated embryos overlaid with a subset of velocity vectors from PIV analysis (S3 Movie). Scale bar, 20 μm. (C, D) Proportion (C) of embryos showing detectable oscillations and their detected period (D, DMSO n = 20 and Vx-680 n = 12). Chi-squared (C) and Student t test (D) p-values comparing 2 conditions are indicated (S3 Table, S1 Data). Error bars show SEM. Light gray shows nonoscillating embryos. Larger circles show median values. (E) Schematic diagram of PeCoWaCo analysis after fragmentation of 2-cell stage blastomeres. (F) Representative images of mechanical control, fragmented cell, and enucleated fragments overlaid with a subset of velocity vectors from PIV analysis (S4 Movie). Scale bar, 20 μm. (G, H) Proportion (G) of cells showing detectable oscillations and their detected period (H) in mechanical controls (n = 14), fragmented cells (n = 14), and enucleated fragments (n = 14). Error bars show SEM. Chi-squared (G) and Student t test (H) p-values comparing 2 conditions are indicated (S3 Table, S1 Data). Light gray shows nonoscillating cells. PeCoWaCo, periodic cortical waves of contraction; PIV, Particle Image Velocimetry.

Then, we tested whether PeCoWaCo could be triggered prematurely by artificially reducing 2-cell stage blastomeres to the size of a 4-cell stage blastomere. To reduce cell size, we treated dissociated 2-cell stage blastomeres with the actin cytoskeleton inhibitor Cytochalasin D before deforming them repeatedly into a narrow pipette (Fig 2E and 2F, S4 Movie). By adapting the number of aspirations of softened blastomeres, we could carefully fragment blastomeres while keeping their sister cell mechanically stressed but intact. Importantly, we measured identical surface tensions in intact and fragmented cells indicating that fragmentation does not seem to impact the overall mechanics of the actomyosin cortex (S2 Fig, S4 Table, S1 Data). While the fragmented cell was reduced to the size of a 4-cell stage blastomere, both fragmented and manipulated cells eventually succeeded in dividing to the 4-cell stage. After waiting 1 hour for cells to recover from this procedure, we examined for the presence of PeCoWaCo over the subsequent 10 hours. PeCoWaCo were detected in similar proportions in either control or fragmented cells (Fig 2G, S3 Movie, S3 Table, S1 Data). Also, the period of detected PeCoWaCo was unchanged (Fig 2H, S3 Table, S1 Data). This suggests that 4-cell stage blastomere size is not sufficient to trigger PeCoWaCo in the majority of embryos.

Cell size does not influence the properties of PeCoWaCo

The transition from 2- to 4-cell stage blastomere size is neither required nor sufficient to initiate PeCoWaCo. Nevertheless, the decrease in period of PeCoWaCo remarkably scales with the stepwise decrease in blastomere size (Fig 1E). Given a constant propagation velocity, PeCoWaCo may reduce their period according to the reduced distance to travel around smaller cells. To test whether cell size determines PeCoWaCo oscillation period, we set out to manipulate cell size over a broad range. For this, we used 16-cell stage blastomeres, which consistently display PeCoWaCo [36] and whose intermediate size permits broad size manipulation (Fig 3A–3D). By fusing varying numbers of 16-cell stage blastomeres, we built cells equivalent in size to 8-, 4-, and 2-cell stage blastomeres (Fig 3E–3G, S5 Movie, S5 Table, S1 Data) with undistinguishable surface tensions (S3A Fig, S6 Table, S1 Data). In addition, by fragmenting 16-cell stage blastomeres, we made smaller cells equivalent to 32-cell stage blastomeres (Fig 3H–3J, S6 Movie, S5 Table, S1 Data) [42]. Together, we could image 16-cell stage blastomeres with sizes ranging from 10 μm to 30 μm in radius (Fig 3K and 3L, S3B Fig). Finally, to identify how the period may scale with cell size by adjusting the velocity of the contractile wave, we segmented the outline of cells to compute the local curvature, which, unlike PIV analysis, allows us to track contractile waves and determine their velocity in addition to their period (Fig 3A–3D, see S4 Fig for comparisons between PIV and curvature analysis, S7 Movie) [22,36]. We find that fused and fragmented 16-cell stage blastomeres show the same period, regardless of their size (Fig 3F, 3I and 3K, S5 Table, S1 Data). This could be explained if the wave velocity would scale with cell size. However, we find that the wave velocity remains constant regardless of cell size (Fig 3E, 3J and 3L, S5 Table, S1 Data). Therefore, both the oscillation period and wave velocity are properties of PeCoWaCo that are robust to changes in cell size and associated curvature.

Fig 3

Period and velocity of PeCoWaCo are stable across a broad range of cell sizes.

(A, B) Surface deformation tracking for period detection and velocity measurements. Isolated 16-cell stage blastomere originating from mTmG embryos with the local curvature fitted around it (A). Arrowheads indicate the PeCoWaCo. White scale bar, 10 μm. (B) Kymograph of curvature changes observed in the cell shown in (A). The period between consecutive waves and their velocity are indicated. Colored scale bar indicates curvature. (C, D) Period (C) and velocity (D) of PeCoWaCo in 38 isolated 16-cell stage blastomeres. Large circles show median. (E) Schematic diagram of fusion of 16-cell stage blastomeres. (F, G) Oscillation period (F) and wave velocity (G) of fused blastomeres. 8 × 1/16th (blue, n = 11), 4 × 1/16th (orange, n = 22), and 2 × 1/16th (green, n = 18) fused blastomeres are shown. Large circles show median (S5 Movie, S5 Table, S1 Data). (H) Schematic diagram of fragmentation of 16-cell stage blastomeres. (I, J) Oscillation period (I) and wave velocity (J) of fragmented blastomeres. Control (black, n = 6), fragmented cell (magenta, n = 8), and enucleated fragment (pink, n = 4) are shown (S6 Movie, S5 Table, S1 Data). (K, L) Oscillation period (K) and wave velocity (L) for size-manipulated 16-cell stage blastomeres. Larger circles show median values. Student t test p-values are indicated (S5 Table, S1 Data). CytD, Cytochalasin D; PeCoWaCo, periodic cortical waves of contraction.

Fusion of cells causes blastomeres to contain multiple nuclei, while cell fragmentation creates enucleated fragments. Interestingly, enucleated fragments continued oscillating with the same period and showing identical propagation velocities as the nucleus-containing fragments (Fig 3I). These measurements indicate that PeCoWaCo are robust to the absence or presence of single or multiple nuclei and their associated functions.

Together, using fusion and fragmentation of cells, we find that PeCoWaCo oscillation properties are robust to a large range of size perturbations. Therefore, other mechanisms must be at play to regulate periodic contractions during preimplantation development.

Cortical maturation during cleavage stages

Despite the apparent relationship between cell size and PeCoWaCo during preimplantation development, our experimental manipulations of cell size reveal that PeCoWaCo are not influenced by cell size. PeCoWaCo result from the activity of the actomyosin cortex, which could become stronger during cleavage stages and make PeCoWaCo more prominent as previously observed during the 16-cell stage [36]. Since actomyosin contractility generates a significant portion of the surface tension of animal cells, this would translate in a gradual increase in surface tension. To investigate this, we set to measure the surface tension of cells as a readout of contractility during cleavage stages using micropipette aspiration. Contrary to our expectations, we find that surface tension gradually decreases from the zygote to 8-cell stage (Fig 4A–4C, S7 Table, S1 Data) and noticeably mirrors the behavior of the period of PeCoWaCo during cleavage stages (Fig 1E). Therefore, PeCoWaCo unlikely result simply from increased contractility. Instead, the tension of blastomeres at the zygote and 2-cell stages may be too high for PeCoWaCo to become visible in most embryos. To reduce the tension of the cortex, we used low concentrations (100 nM) of the actin polymerization inhibitor Latrunculin A (Fig 4D and 4E, S7 Table, S1 Data) [32]. Softening the cortex of 2-cell stage embryos increased the proportions of embryos displaying PeCoWaCo (Fig 4F, S8 Movie, S7 Table, S1 Data). This suggests that PeCoWaCo become more visible thanks to the gradual softening of the cortex of blastomeres during cleavage stages. Moreover, low concentrations of Latrunculin A decreased the oscillation period of PeCoWaCo down to approximately 100 seconds, as compared to approximately 150 seconds for the DMSO control embryos (Fig 4G, S7 Table, S1 Data). This suggests that modifications of the polymerization rate of the actin cytoskeleton could be responsible for the increase in PeCoWaCo frequency observed during cleavage stages.

Fig 4

Cortical softening elicits PeCoWaCo.

(A) Representative images of tension measurements at the zygote, 2-, 4-, and 8-cell stages. Scale bar, 20 μm. (B) Schematic diagram of the surface tension measurements. Using the Young–Laplace equation, the surface tension γ can be calculated from the critical pressure Pc applied by a micropipette of radius Rp onto a cell of radius of curvature Rc. (C) Surface tension of blastomeres throughout cleavage stages. Zygote (gray, n = 60), 2-cell (blue, n = 86), 4-cell (orange, n = 55), and early 8-cell (green, n = 28) stages are shown. Student t test p-values are indicated (S7 Table, S1 Data). (D) Representative images of Control and 100 nM Latrunculin A treated embryos overlaid with a subset of velocity vectors from PIV analysis (S8 Movie). Scale bar, 20 μm. (E) Surface tension of embryos treated with DMSO (n = 35) or 100 nM Latrunculin A (n = 32). Student t test p-value is indicated (S7 Table, S1 Data). Larger circles show median values. (F, G) Proportion (F) of embryos showing detectable oscillations and their detected period (G) of DMSO treated (n = 27) and 100 nM Latrunculin A treated (n = 27) 2-cell stage embryos. Error bars show SEM. Chi-squared (F) and Student t test (G) p-values comparing 2 conditions are indicated (S7 Table, S1 Data). Light gray shows nonoscillating embryos. Larger circles show median values. (H) Representative images of embryos expressing GFP or GFP-Fmnl3 overlaid with a subset of velocity vectors from PIV analysis (S10 Movie). Scale bar, 20 μm. (I, J) Proportion (B) of embryos showing detectable oscillations and their detected period (C) in embryos expressing GFP (n = 11) or GFP-Fmnl3 (n = 8) at the early and late 4-cell stage. Error bars show SEM. Chi-squared (B) and Student t test (C) p-values comparing 2 conditions are indicated (S7 Table, S1 Data). Light gray shows nonoscillating embryos. (K) Surface tension of embryos expressing GFP (n = 11) or GFP-Fmnl3 (n = 13) measured during the early phase of the 4-cell stage. Student t test p-value is indicated (S7 Table, S1 Data). Larger circles show median values. PeCoWaCo, periodic cortical waves of contraction; PIV, Particle Image Velocimetry.

To investigate the changes responsible for blastomere softening during cleavage stages, we first looked into changes in cortical organization. Using super resolution microscopy on phalloidin-stained embryos, we measured the thickness of the actomyosin cortex, which has been reported to change with surface tension [43]. Using line scans orthogonal to the cell surface, we measured a width at half maximum of approximately 500 nm at the zygote stage (S5A–S5C Fig, S8 Table, S1 Data). This width increased during the 2-cell stage and fell back to its initial levels at the 4- and 8-cell stages (S5A–S5C Fig, S8 Table, S1 Data), suggesting cortical remodeling at the time of PeCoWaCo initiation.

To investigate the molecular changes responsible for blastomere softening during cleavage stages, we took advantage of available single-cell RNA sequencing and proteomic data [44]. We noted that several regulators of actin polymerization such as formins and actin related proteins (arps) decrease in their mRNA levels (S5D and S5E Fig). This is not necessarily the case for their protein levels (S5F and S5G Fig). This led us to investigate the formin Fmnl3, whose expression levels decay both at the mRNA and protein levels during cleavage stages (S5 Fig). Immunostaining of Fmnl3 finds it primarily at cell–cell contacts with levels seemingly decreasing during cleavage stages (S5H Fig). To test whether sustained expression of Fmnl3 would be sufficient to delay the appearance of PeCoWaCo, we injected embryos with mRNA encoding GFP-Fmnl3. Injection in a single blastomeres of 2-cell stage embryos resulted in visible overexpression of Fmnl3 at the 4-cell stage as observed using immunostaining (S6 Fig). Importantly, 4-cell stage blastomeres expressing GFP-Fmnl3 did not display PeCoWaCo like their uninjected counterparts (S6 Fig, S9 Movie). Consistently with mosaic sustained expression of GFP-Fmnl3, fewer embryos overexpressing GFP-Fmnl3 in all blastomeres showed PeCoWaCo as compared to those injected with GFP (Fig 4H–4J, S10 Movie, S7 Table, S1 Data). Interestingly, this effect is clearly present during the first half of the 4-cell stage embryos, but GFP-Fmnl3 expressing embryos recover almost to the levels of GFP expressing embryos by the second half of the 4-cell stage (Fig 4I and 4J, S7 Table, S1 Data). Over long-term development, embryos expressing GFP-Fmnl3 compacted normally and formed blastocysts (S11 Movie). Together, this indicates that overexpressing Fmnl3 has a specific but transient effect. In fly embryos, the effect of Fmnl overexpression was proposed to dampen oscillation by stiffening the cortex [26]. To test the effect of Fmnl3 overexpression on the mechanical properties of cleavage stage mouse embryos, we measured their surface tension. Indeed, we measured surface tensions twice higher for embryos expressing GFP-Fmnl3 than for those expressing GFP alone (Fig 4K, S7 Table, S1 Data). We conclude that Fmnl3 down-regulation during cleavage stages is required for the softening of the cortex, which elicits the appearance of PeCoWaCo.

Together, these experiments using the pulsatile nature of cell contractility reveal the unsuspected maturation of the cortex of blastomeres during the cleavage stages of mouse embryonic development.

Discussion

During cleavage stages, blastomeres halve their size with successive divisions. Besides the increased number of blastomeres, there is no change in the architecture of the mouse embryo until the 8-cell stage with compaction. We find that this impression of stillness is only true on a timescale of hours since, on the timescale of seconds, blastomeres display signs of actomyosin contractility. During the first 2 days after fertilization, contractility seems to mature by displaying more frequent and visible pulses. We further find that pulsed contractions do not rely on the successive reductions in cell size but rather on the gradual decrease in surface tension of the blastomeres. Therefore, during cleavage stages, cortical softening awakens zygotic contractility before preimplantation morphogenesis.

Previous studies on the cytoskeleton of the early mouse embryo revealed that both the microtubule and intermediate filament networks mature during cleavage stages. Keratin intermediate filaments appear at the onset of blastocyst morphogenesis [45] and become preferentially inherited by prospective trophectoderm (TE) cells [46]. The microtubule network is initially organized without centrioles around microtubule bridges connecting sister cells [47,48]. The spindle of early cleavages also organizes without centrioles similarly to during meiosis [47,49]. As centrioles form de novo, cells progressively transition from meiosis-like to mitosis-like divisions [47]. We find that the actomyosin cortex also matures during cleavage stages by decreasing its oscillation period (Fig 1E) and its surface tension (Fig 4C). Interestingly, this decrease in cortical tension seems to be in continuation with the maturation of the oocyte. Indeed, the surface tension of mouse oocytes decreases during their successive maturation stages [50]. The softening of the oocyte cortex is associated with architectural rearrangements that are important for the cortical movement of the meiotic spindle [51,52]. Therefore, similarly to the microtubule network, the zygotic actomyosin cortex awakens progressively from an egg-like state.

The maturation of zygotic contractility may be influenced by the activation of the zygotic genome occurring partly at the late zygote stage and mainly during the 2-cell stage [53,54]. Recent studies in frog and mouse propose that reducing cell size could accelerate zygotic genome activation (ZGA) [55,56]. We find that manipulating cell size is neither sufficient to trigger PeCoWaCo prematurely in most embryos nor required to initiate or maintain them in a timely fashion with the expected oscillation period of the corresponding cleavage stage (Figs 2 and 3). Instead, we find that the surface of blastomeres in the cleavage stages is initially too tense to allow for PeCoWaCo to be clearly displayed (Fig 4). We identify Fmnl3 down-regulation as an essential step in the reduction of blastomeres surface tension during cleavage stages (Fig 4). Taking place at the 2-cell stage, the contribution of the ZGA to zygotic contractility activation is unclear since Fmnl3 down-regulation begins after the zygote stage both at the mRNA and protein levels [44].

The effect of mechanical constraints on pulsed contractions is reminiscent of recent reports in fly embryos in which Fmnl-mediated densification of a persisting actin cytoskeleton dampens pulsed contractions [26]. In addition, the influence of mechanical constrains can also come from external structures. For example, in starfish oocytes, removing an elastic jelly surrounding the egg softens them and renders contractile waves more pronounced [35]. Interestingly, the changes in surface curvature caused by cortical waves of contraction may influence the signaling and cytoskeletal machinery controlling the wave [35,57]. Such mechanochemical feedback has been proposed to regulate the period of contractions via the advection of regulators of actomyosin contractility [29]. As a result, the curvature of cells and tissues is suspected to regulate contractile waves [35,58]. Using cell fragmentation and fusion, we have manipulated the curvature of the surface over which PeCoWaCo travel (Fig 3). From radii ranging between 10 μm and 30 μm, we find no change in the period or traveling velocity of PeCoWaCo (Fig 3). This indicates that, in the mouse embryo, the actomyosin apparatus is robust to the changes in curvature taking place during preimplantation development. Therefore, the cleavage divisions per se are unlikely regulators of preimplantation contractility. The robustness of PeCoWaCo to changes of radii ranging from 10 μm to 30 μm is puzzling since neither the oscillation period nor the wave velocity seem affected (Fig 3K and 3L). One explanation would be that the number of waves present simultaneously changes with the size of the cells. Using our 2D approach, we could not systematically analyze this parameter. Nevertheless, we did note that some portions of the fused blastomeres did not display PeCoWaCo. These may be corresponding to apical domains, which do not show prominent PeCoWaCo [36]. Therefore, the relationship between the total area of the cell and the “available” or “excitable” area for PeCoWaCo may not be straightforward [19]. In the context of the embryo, in addition to the apical domain, cell–cell contacts also down-regulate actomyosin contractility and do not show prominent contractions [22]. As cell–cell contacts grow during compaction and apical domains expand [59,60], the available excitable cortical area for PeCoWaCo eventually vanishes [3].

Together, our study uncovers the maturation of the actomyosin cortex, which softens and speeds up the rhythm of contractions during the cleavage stages of the mouse embryo. Interestingly, zebrafish embryos also soften during their cleavage stages, enabling doming, the first morphogenetic movement in zebrafish [61]. It will be important to investigate whether cell and tissue softening during cleavage stages is conserved in other animals.

Methods

Embryo work

Recovery and culture

All animal work is performed in the animal facility at the Institut Curie, with permission by the institutional veterinarian overseeing the operation (APAFIS #11054–2017082914226001). The animal facilities are operated according to international animal welfare rules.

Embryos are isolated from superovulated female mice mated with male mice. Superovulation of female mice is induced by intraperitoneal injection of 5 international units (IU) pregnant mare serum gonadotropin (PMSG, Ceva (CEVA Santé animale, Libourne, France), SYNCRO-PART), followed by intraperitoneal injection of 5 IU human chorionic gonadotropin (hCG, MSD Animal Health, Walton UK, Chorulon) 44 to 48 hours later. Embryos are recovered at E0.5 by dissecting in 37°C FHM (LifeGlobal, Guildford, USA, ZEHP-050 or Millipore, Darmstadt, Germany, MR-122-D) from the oviduct the ampula, from which embryos are cleared with a brief (5 to 10 seconds) exposure to 37°C hyaluronidase (Sigma, Saint Louis, USA, H4272).

Embryos are recovered at E1.5 or E2.5 by flushing oviducts from plugged females with 37°C FHM using a modified syringe (Acufirm, 1400 LL 23).

Embryos are handled using an aspirator tube (Sigma, A5177-5EA) equipped with a glass pipette pulled from glass micropipettes (Blaubrand intraMark or Warner Instruments, Holliston, MA, USA).

Embryos are placed in KSOM (LifeGlobal, ZEKS-050 or Millipore, MR-107-D) or FHM supplemented with 0.1% BSA (Sigma, A3311) in 10 μL droplets covered in mineral oil (Sigma, M8410 or Acros Organics) unless stated otherwise. Embryos are cultured in an incubator with a humidified atmosphere supplemented with 5% CO2 at 37°C.

To remove the zona pellucida (ZP), embryos are incubated for 45 to 60 seconds in pronase (Sigma, P8811).

For imaging, embryos are placed in 5- or 10-cm glass bottom dishes (MatTek, Ashland, MA, USA).

Only embryos surviving the experiments were analyzed. Survival is assessed by continuation of cell division as normal when embryos are placed in optimal culture conditions.

Mouse lines

Mice are used from 5 weeks old on. (C57BL/6xC3H) F1 hybrid strain is used for wild-type (WT). To visualize plasma membranes, mTmG (Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo) is used [62].

Isolation of blastomeres

ZP-free 2-cell or 4-cell stages embryos are aspirated multiple times (typically between 3 and 5 times) through a smoothened glass pipette (narrower than the embryo but broader than individual cells) until dissociation of cells.

For 8- and 16-cell stage embryos, they are placed into EDTA containing Ca2+ free KSOM [63] for 8 to 10 minutes before dissociation. Cells are then washed with KSOM for 1 hour before experiment.

Chemical reagents and treatments

Vx-680 (Tocris Bioscience, Bristol, UK, 5907) 50 mM DMSO stock was diluted to 2.5 μM in KSOM. To prevent mitosis, 2-cell stage embryos are cultured in 2.5 μM Vx-680 for 3 hours shortly prior to the second cleavage and then washed in KSOM. Subsequent divisions were observed in 12/20 of the cases.

Cytochalasin D (Sigma, C2618-200UL) 10 mM DMSO stock is diluted to 10 μM in KSOM. To fragment cells, isolated 2- or 16-cell stage blastomeres were treated with Cytochalasin D for 20 minutes before being gently aspirated into a smoothened glass pipette of diameter about 30 or 5 to 10 μm, respectively [59]. Moreover, 2 to 3 repeated aspirations are typically sufficient to clip cells into to 2 large fragments, one containing the nucleus and one without. Cells that did not fragment after 2 aspirations are used as control. For 2-cell stage fragmentation, nucleated fragments divisions were observed in 9/15 of the cases. Enucleated fragments started to deform extensively 6 hours after fragmentation, making it difficult to measure PeCoWaCo and surface tension.

GenomONE-CF FZ SeV-E cell fusion kit (Cosmo Bio, Tokyo, Japan, ISK-CF-001-EX) is used to fuse blastomeres [40]. HVJ envelope is resuspended following manufacturer’s instructions and diluted in FHM for use. To fuse blastomeres of embryos at the 16-cell stage, embryos are incubated in 1:50 HVJ envelope for 15 minutes at 37°C followed by washes in KSOM.

Latrunculin A (Tocris Bioscience, ref 3973) 10 mM DMSO stock is diluted to 100 nM in KSOM. To soften cells, 2-cell stage embryos are imaged in medium containing Latrunculin A covered with mineral oil for 2 hours.

Fmnl3 cDNA isolation, cloning, and in vitro mRNA synthesis

To isolate cDNA of Fmnl3, we performed total RNA extraction from a pool of 50 zygotes using the PicoPure RNA Isolation Kit (Thermo Fisher Scientific, Walthan, MA, USA, KIT0204). DNase treatment is performed during the extraction, using RNase-Free DNase Set (QIAGEN, Hilden, Germany, 79254). Subsequently, a cDNA library is synthesized with oligo(dT) (Thermo Fisher Scientific, 18418012) using the Super-Script III Reverse Transcriptase kit (Thermo Fisher Scientific, 18080044) on all the extracted RNA, according to manufacturer’s instructions. As a final step, a fragment of 3,084 bp corresponding to Fmnl3 isoform 202 (MGI:109569) is specifically isolated from the cDNA library, by PCR amplification with forward (fw) and reverse (rv) primers GCATGGACGAGCTGTACAAGGGCAACCTGGAGAGCACCGA and TAGTTCTAGACCGGATCCGGCTAACAGTTTGACTCGTCATG, respectively.

To generate the GFP-Fmnl3 plasmid construct for in vitro mRNA synthesis, the Gibson Assembly cloning method was used. Three linear DNA fragments, corresponding to pCS2+ backbone, GFP reporter gene, and Formin like 3 (Fmnl3) cDNAs, are initially generated by PCR amplification. During this step, overlapping ends are incorporated into each fragment.

Forward and reverse primers to obtain a 4,087-bp fragment of the pCS2+ backbone: TGACGAGTCAAACTGTTAGCCGGATCCGGTCTAGAACTATAGTGAGTCGT and AGTGAGTCGTATTACCGGATCCGGTCTATAGTGTCACCTAAATC.

Forward and reverse primers to obtain a 717-bp fragment encoding GFP: CGGTAATACGACTCACTATAGGCCGGATCCGGATGGTGAGCAAGGGCGAGGA and TCGGTGCTCTCCAGGTTGCCCTTGTACAGCTCGTCCATGC.

Following DNA purification, the assembly of the final construct is achieved by incubating the 3 fragments in the Gibson Assembly Master Mix (NEB, Ipswich, MA, USA, E2611S), according to the manufacturer’s instruction.

Following the linearization of the pCS2-GFP-Fmnl3 plasmid using Hind III, GFP-Fmnl3 mRNA is transcribed using the mMESSAGE mMACHINE SP6 Kit (Invitrogen, Waltham, MA, USA, AM1340) according to manufacturer’s instructions and resuspended in Rnase-free water.

GFP mRNA is generated by in vitro transcription of a GFP linear DNA fragment of approximately 750 bp obtained by PCR amplification from the pCS2-GFP-Fmnl3 plasmid, with fw primer ATTTAGGTGACACTATAGAGCC and rv primer CTACTTGTACAGCTCGTCCAT.

Microinjection

Glass capillaries (Harvard Apparatus (Holliston, MA, USA) glass capillaries with 780-μm inner diameter) are pulled using a needle puller and micro forged to forge a holding pipette and an injection needle. The resulting injection needles are filled with mRNA solution diluted to 1 μg/μL in injection buffer (5 mM Tris-HCl pH = 7.4, 0.1 mM EDTA). The filled needle is positioned on a micromanipulator (Narishige MMO-4) and connected to a positive pressure pump (Eppendorf FemtoJet 4i). Embryos are placed in FHM drops covered with mineral oil under Leica (Wetzlar, Germany) TL Led microscope. Two-cell stage embryos were injected while holding with holding pipette connected to a Micropump CellTram Oil.

Micropipette aspiration

As described previously [22,64], a microforged micropipette coupled to a microfluidic pump (Fluigent, Le Kremlin-Bicêtre, France, MFCS EZ) is used to measure the surface tension of embryos. In brief, micropipettes of radii 8 to 16 μm are used to apply stepwise increasing pressures on the cell surface until reaching a deformation, which has the radius of the micropipette (R). At steady state, the surface tension γ of the cell is calculated from the Young–Laplace’s law applied between the cell and the micropipette: γ = P / 2 (1/R—1/R), where P is the critical pressure used to deform the cell of radius of curvature R.

Eight-cell stage embryos are measured before compaction (all contact angles < 105°), during which surface tension would increase [22].

Fragmented cells and their control cells are measured 10 to 15 hours after fragmentation. At that point, enucleated fragments are mostly irregular in shape and cannot be measured.

Measurements of individual blastomeres from the same embryo are averaged and plotted as such.

Immunostaining

Embryos are fixed in 2% PFA (Euromedex, Strasbourg, France, 2000-C) for 10 minutes at 37°C, washed in PBS, and permeabilized in 0.01% Triton X-100 (Euromedex, T8787) in PBS (PBT) at room temperature before being placed in blocking solution (PBT with 3% BSA) at 4°C for 2 to 4 hours. Primary antibodies (Table 1) are applied in blocking solution at 4°C overnight. After washes in PBT at room temperature, embryos are incubated with secondary antibodies and phalloidin (Table 1) in blocking solution at room temperature for 1 hour. Embryos are washed in PBT and imaged in PBS-BSA immediately after.

Table 1

Antibodies and dyes used for immunostaining.

Primary antibody	Dilution	Provider
Fmnl3	1:200	[65]
Secondary antibodies and dyes	Dilution	Provider
Alexa Fluor 647 anti-guinea pig	1:200	Jackson ImmunoResearch, 706-605-148
Alexa Flour 488 phalloidin	1:500	Thermo Fisher Scientific, A12379
Alexa Flour 405 phalloidin	1:200	Thermo Fisher Scientific, A30104

Microscopy

For live imaging, embryos are placed in 5-cm glass bottom dishes (MatTek) under a CellDiscoverer 7 (Zeiss, Oberkochen, Germany) equipped with a 20×/0.95 objective and an ORCA-Flash 4.0 camera (C11440, Hamamatsu, Hamamatsu City, Japan) or a 506 axiovert (Zeiss) camera.

Using the experiment designer tool of ZEN (Zeiss), we set up nested time-lapses in which all embryos are imaged every 3 to 5 hours for approximately 10 minutes with an image taken every 5 seconds at 2 focal planes positioned 10 μm apart. Embryos are kept in a humidified atmosphere supplied with 5% CO2 at 37°C.

mTmG embryos are imaged at the 16-cell stage using an inverted Zeiss Observer Z1 microscope with a CSU-X1 spinning disc unit (Yokogawa, Tokyo, Japan). Excitation is achieved using a 561 nm laser through a 63×/1.2 C Apo Korr water immersion objective. Emission is collected through 595/50 band-pass filters onto an ORCA-Flash 4.0 camera (C11440, Hamamatsu). The microscope is equipped with an incubation chamber to keep the sample at 37°C and supply the atmosphere with 5% CO2.

Surface tension measurements are performed on a Leica DMI6000 B inverted microscope equipped with a 40×/0.8 DRY HC PL APO Ph2 (11506383) objective and Retina R3 camera and 0.7× lens in front of the camera. The microscope is equipped with an incubation chamber to keep the sample at 37°C and supply the atmosphere with 5% CO2.

Stained embryos are imaged on a Zeis LSM900 Inverted Laser Scanning Confocal Microscope with Airyscan detector. Excitation is achieved using a 488-nm laser line through a 63×/1.4 OIL DICII PL APO objective. Emission is collected through a 525/50 band-pass filter onto an airyscan photomultiplier (PMT) allowing to increase the resolution up to a factor 1.7.

Data analysis

Image analysis

Manual shape measurements. Fiji [66] is used to measure cell, embryo, pipette sizes, and wave velocity. The circle tool is used to fit a circle onto cells, embryos, and pipettes. The line tool is used to fit lines onto curvature kymographs.

PIV analysis. To detect PeCoWaCo in phase contrast images of embryos, we use PIV analysis followed by a Fourier analysis.

As previously [22,40], PIVlab 2.02 running on MATLAB [67,68] is used to process approximately 10 minutes long time lapses with images taken every 5 seconds using 2 successive passes through interrogation windows of 20/10 μm resulting in approximately 180 vectors per embryo.

The x- and y-velocities of individual vectors from PIV analysis are used for Fourier analysis. A Fourier transform of the vector velocities over time is performed using MATLAB’s fast Fourier transform function. The resulting Fourier transforms are squared to obtain individual power spectra. Squared Fourier transforms in the x and y directions of all vectors are averaged for individual embryos resulting in mean power spectra of individual embryos.

Spectra of individual embryos are checked for the presence of a distinct amplitude peak to extract the oscillation period. The peak value between 50 seconds and 200 seconds was taken as the amplitude, as this oscillation period range is detectable by our imaging method. An embryo is considered as oscillating when the amplitude peaks 1.777 times above background (taken as the mean value of the power spectrum signal of a given embryo). This threshold value was determined using CutOffFinder [69] (S1 Fig) to minimize false positive and false negative according to visual verification of time-lapse movies. The number of oscillating zygote is likely overestimated, while the number of oscillating 8-cell stage is underestimated (S1 Fig).

Two-cell, 4-cell, and 8-cell stages are considered early during the first half of the corresponding stage and late during the second half.

Since PeCoWaCo halt during mitosis (S2 Movie), time lapses including dividing cells were excluded from the analysis.

Local curvature analysis. To measure PeCoWaCo period, amplitude, and velocity, we analyze the associated changes in surface curvature and perform Fourier analysis. Importantly, since we can only extract these parameters from oscillating blastomeres and embryos, data shown in Fig 3 and S4 Fig come from selected cells and embryos based on their visible oscillation.

To obtain the local curvature of isolated blastomeres and embryos, we developed an approach similar to that of [22,36,70]. First, a Gaussian blur is applied to images using Fiji [66]. Then, using ilastik [71], pixels are associated with cell surface or background. Segmentations of cells are then used in a custom made Fiji plug-in (called WizardofOz, found under the Mtrack repository) for computing the local curvature information using the start, center and end point of a 10-μm strip on the cell surface to fit a circle. The strip is then moved by 1 pixel along the segmented cell, and a new circle is fitted. This process is repeated till all the points of the cell are covered. The radius of curvature of the 10-μm strip boundaries are averaged. Kymograph of local curvature values around the perimeter over time is produced by plotting the perimeter of the strip over time.

Curvature kymographs obtained from local curvature tracking are then exported into a custom made Python script for 2D Fast Fourier Transform analysis.

Spectra of individual cells are checked for the presence of a distinct amplitude peak to extract the oscillation period. The peak value between 50 seconds and 200 seconds was taken as the amplitude, as this oscillation period range is detectable by our imaging method.

To measure the wave velocity, a line is manually fitted on the curvature kymograph using Fiji.

Cortex thickness measurement. Super resolution images obtained using airyscan microscopy are used to measure cortex thickness. The full width at half maximum of cortical intensity profiles were used to assess cortical thickness by using CortexThicknessAnalysis tool [43] available at https://github.com/PaluchLabUCL/CortexThicknessAnalysis.

Statistics

Data are plotted using Excel (Microsoft, Redmond, WA, USA) and R-based SuperPlotsOfData tool [72]. Mean, standard deviation, median, 1-tailed Student t test, and chi-squared p-values are calculated using Excel (Microsoft) or R (R Foundation for Statistical Computing). Statistical significance is considered when p < 10−2.

The sample size was not predetermined and simply results from the repetition of experiments. No sample that survived the experiment, as assessed by the continuation of cell divisions, was excluded. No randomization method was used. The investigators were not blinded during experiments.

Code availability

The code used to analyze the oscillation frequencies from PIV and local curvature analyses can be found at https://github.com/MechaBlasto/PeCoWaCo.git.

The Fiji plug-in for local curvature analysis WizardofOz can be found under the MTrack repository.

(related to Fig 1).

Analysis of PeCoWaCo during cleavage stages using PIV and Fourier transform. (A) Peak value divided by mean signal of the respective power spectra after Fourier analysis of PIV data for embryos at the zygote, 2-, 4-, and 8-cell stages. Embryos are classified as showing a visible oscillation (+) or not (−), as assessed visually. (B) ROC curve resulting from CutOffFinder [62] showing that a threshold of 1.777 for the peak/mean amplitude (red cross) yields a maximized AUC of 0.97. (C–F) Classification of zygote (C), 2- (D), 4- (E), and 8-cell stages (F) using a threshold of 1.777 for the peak/mean amplitude. Red indicates a mismatch between the visual assessment and the use of the threshold to determine whether a given embryo oscillates or not at a given time point. (G) Proportion of early and late 2-cell (blue, n = 33 and 44), 4-cell (orange, n = 38 and 29), and 8-cell stage (green, n = 17 and 26) embryos showing detectable oscillations after Fourier transform of PIV analysis. Error bars show SEM. Chi-squared p-values comparing different stages are indicated (S2 Table, S1 Data). Light gray shows nonoscillating embryos. (H) Oscillation period of early and late 2-cell (blue, n = 11 and 9), 4-cell (orange, n = 27 and 17), and 8-cell (green, n = 8 and 15) stages embryos. Larger circles show median values. Student t test p-values are indicated (S2 Table, S1 Data). AUC, area under the curve; PeCoWaCo, periodic cortical waves of contraction; PIV, Particle Image Velocimetry; ROC, receiver operating characteristic.

(PDF)

Click here for additional data file.

(related to Fig 2).

Surface tension of Vx-680 and fragmented embryos. (A) Surface tension of embryos treated with DMSO (n = 12) or Vx-680 (n = 13). Student t test p-value is indicated (S4 Table). Larger circles show median values. (B) Surface tension of mechanical control (n = 14) or fragmented cells (n = 14). Student t test p-value is indicated (S4 Table). Larger circles show median values.

(PDF)

Click here for additional data file.

(related to Fig 3).

Surface tension of fused blastomeres. (A) Surface tension of cells resulting from the fusion of 8, 4, or 2 16-cell stage blastomeres (n = 18, 20 and 14 embryos, respectively). Student t test p-value is indicated (S6 Table, S1 Data). Larger circles show median values. (B) Radius of fused and fragmented 16-cell stage blastomeres. Larger circles show median values (S1 Data).

(PDF)

Click here for additional data file.

(related to Figs 1 and 3).

Comparison of PIV and curvature analyses of PeCoWaCo. (A) Representative images of a 4-cell stage embryo overlaid with a subset of velocity vectors from PIV analysis (top left) or a color coded local curvature analysis (top right). Velocity over time for a representative velocity vector (bottom left) or local curvature measurement (bottom right) for the bottom most blastomere. White scale bar, 10 μm. Colored scale bar indicates curvature. See S7 Movie. (B) Oscillation period of 4-cell stage embryos (n = 6) as determined by PIV or curvature tracking analyses. Pairwise Student t test p-value is indicated (S1 Data). PeCoWaCo, periodic cortical waves of contraction; PIV, Particle Image Velocimetry.

(PDF)

Click here for additional data file.

(related to Fig 4).

Molecular and structural characterization of the actomyosin cortex during cleavage stages. (A) Representative image of the actin cortex of a Phalloidin-stained 2-cell stage embryo acquired using super resolution microscopy. Scale bar, 5 μm. Overlaid white line shows the segmentation of the cortex, and orthogonal blue and yellow lines show line scans outside and inside the cell, respectively. Schematic diagram below shows example of where in the cell such image is taken. (B) Phalloidin intensity along lines orthogonal to the cell cortex of the cell shown in (A) (black, n = 348). Mean intensity profile shown in red. (C) Cortex thickness measured at the zygote, 2-, 4-, and 8-cell stage (n = 15, 19, 13, and 11, respectively). Student t test p-values are indicated (S8 Table, S1 Data). Larger circles show median values. (D–G) mRNA (D and E) and protein (F and G) levels during cleavage stages for formins (D and F) and arps (E and G) adapted from [44]. (H) Immunostaining of FMNL3 (gray and cyan in merged image) on representative zygote, 2-, 4-, and 8-cell stage embryos. Phalloidin shown in magenta on the merged image. Scale bar, 20 μm.

(PDF)

Click here for additional data file.

Molecular and structural characterization of the actomyosin cortex during cleavage stages. (A) Schematic diagram of GFP-Fmnl3 mRNA injection in one blastomere of a 2-cell stage embryo. (B) Immunostaining of a 4-cell stage embryo injected with GFP-Fmnl3 at the 2-cell stage. GFP-Fmnl3 is shown on the left, and FMNL3 immunostaining is shown in gray in the middle and in cyan on the right together with Phalloidin in magenta. Scale bar, 20 μm. (C) Live imaging of a 4-cell stage embryo injected with GFP-Fmnl3 at the 2-cell stage. Left shows a merged image of phase contrast and GFP-Fmnl3. Right image shows the same embryo overlaid with a subset of velocity vectors from PIV analysis. Graphs on the right are velocity over time for a representative velocity vector of an uninjected (left) and GFP-Fmnl3 injected blastomere (right). Scale bar, 20 μm. See S9 Movie. (D) Schematic diagram of GFP or GFP-Fmnl3 mRNA injection in both blastomeres of a 2-cell stage embryo. (E) Representative images of the preimplantation development of GFP or GFP-Fmnl3 expressing embryos shown at the 4-, 8-, 16-cell, and blastocyst stages. Scale bar, 20 μm. S11 Movie. PIV, Particle Image Velocimetry.

(PDF)

Click here for additional data file.

p-Values from chi-squared test for PeCoWaCo detection and from Student t test for period comparisons. Red when above 0.05, green when below 0.01, and black in between. See S1 Data for individual quantitative observations. PeCoWaCo, periodic cortical waves of contraction.

(DOCX)

Click here for additional data file.

(related to S1 Fig).

p-Values from chi-squared test for PeCoWaCo detection and from Student t test for period comparisons. Red when above 0.05, green when below 0.01, and black in between. See S1 Data for individual quantitative observations. PeCoWaCo, periodic cortical waves of contraction.

(DOCX)

Click here for additional data file.

p-Values from chi-squared test for PeCoWaCo detection and from Student t test for period comparisons. Red when above 0.05, green when below 0.01, and black in between. See S1 Data for individual quantitative observations. PeCoWaCo, periodic cortical waves of contraction.

(DOCX)

Click here for additional data file.

(related to S2 Fig).

p-Values from Student t test. Red when above 0.05, green when below 0.01, and black in between. See S1 Data for individual quantitative observations.

(DOCX)

Click here for additional data file.

p-Values from Student t test. Red when above 0.05, green when below 0.01, and black in between. See S1 Data for individual quantitative observations.

(DOCX)

Click here for additional data file.

(related to S3 Fig).

p-Values from Student t test. Red when above 0.05, green when below 0.01, and black in between. See S1 Data for individual quantitative observations.

(DOCX)

Click here for additional data file.

p-Values from chi-squared test for PeCoWaCo detection and from Student t test for period and surface tension comparisons. Red when above 0.05, green when below 0.01, and black in between. See S1 Data for individual quantitative observations. PeCoWaCo, periodic cortical waves of contraction.

(DOCX)

Click here for additional data file.

(related to S5 Fig).

p-Values from chi-squared test for PeCoWaCo detection and from Student t test for period and surface tension comparisons. Red when above 0.05, green when below 0.01, and black in between. See S1 Data for individual quantitative observations. PeCoWaCo, periodic cortical waves of contraction.

(DOCX)

Click here for additional data file.

Individual quantitative values collected to compute the data shown in figures.

Individual tabs are named according to the corresponding figure panels.

(XLSX)

Click here for additional data file.

PIV analysis during cleavage stages.

Time-lapse imaging of zygote, 2-, 4-, and 8-cell stage embryos showing PeCoWaCo. Pictures are taken every 5 seconds, and PIV analysis is performed between 2 consecutive images. PIV vectors are overlaid on top of the images with vectors pointing upward in magenta and downward in green. Scale bar, 20 μm. PeCoWaCo, periodic cortical waves of contraction; PIV, Particle Image Velocimetry.

(AVI)

Click here for additional data file.

PeCoWaCo are absent during mitosis.

Time-lapse imaging of 4- to 8-cell stage embryos before, during and after undergoing their third cleavage. Pictures are taken every 5 seconds. Scale bar, 20 μm. PeCoWaCo, periodic cortical waves of contraction.

(AVI)

Click here for additional data file.

PIV analysis of 4-cell stage embryos treated with DMSO or Vx-680.

Time-lapse imaging of 4-cell stage embryos showing PeCoWaCo after treatment with DMSO or 2.5 μM Vx680 at the time of the second cleavage division. Pictures are taken every 5 seconds, and PIV analysis is performed between 2 consecutive images. PIV vectors are overlaid on top of the images with vectors pointing upward in magenta and downward in green. Scale bar, 20 μm. PeCoWaCo, periodic cortical waves of contraction; PIV, Particle Image Velocimetry.

(AVI)

Click here for additional data file.

PIV analysis of fragmented 2-cell stage blastomeres.

Time-lapse imaging of mechanically manipulated and fragmented 2-cell stage blastomeres with and without nucleus. Pictures are taken every 5 seconds, and PIV analysis is performed between 2 consecutive images. PIV vectors are overlaid on top of the images with vectors pointing upward in magenta and downward in green. Scale bar, 20 μm. PIV, Particle Image Velocimetry.

(AVI)

Click here for additional data file.

Surface deformation tracking of fused cells.

Montage of mTmG (top) and local curvature measurements (bottom) of fused 8×, 4×, 2× 1/16th blastomeres showing PeCoWaCo. Scale bar, 20 μm. PeCoWaCo, periodic cortical waves of contraction.

(AVI)

Click here for additional data file.

Surface deformation tracking of fragmented 16-cell stage blastomeres.

Montage of mTmG (top) and local curvature measurements (bottom) of mechanically manipulated and fragmented 16-cell stage blastomeres with and without nucleus 1/16th blastomeres showing PeCoWaCo. Scale bar, 10 μm. PeCoWaCo, periodic cortical waves of contraction.

(AVI)

Click here for additional data file.

Comparison of PIV and curvature tracking analyses.

Time-lapse imaging of a 4-cell stage embryos. PIV analysis is performed between 2 consecutive images. PIV vectors are overlaid on top of the images with vectors pointing upward in magenta and downward in green. Curvature analysis is performed by locally fitting a circle to the cell surface. Pictures are taken every 5 seconds. Scale bar, 20 μm. PIV, Particle Image Velocimetry.

(AVI)

Click here for additional data file.

PIV analysis of 2-cell stage embryos treated with DMSO or Latrunculin A.

Time-lapse imaging of 2-cell stage embryos treated with DMSO or 100 nM Latrunculin A (LatA) showing PeCoWaCo. Pictures are taken every 5 seconds, and PIV analysis is performed between 2 consecutive images. PIV vectors are overlaid on top of the images with vectors pointing upward in magenta and downward in green. Scale bar, 20 μm. PeCoWaCo, periodic cortical waves of contraction; PIV, Particle Image Velocimetry.

(AVI)

Click here for additional data file.

PIV analysis of 4-cell stage embryo injected in one blastomere with GFP-Fmnl3 mRNA at the 2-cell stage.

Time-lapse imaging of 4-cell stage embryos expressing GFP-Fmnl3 in 2 blastomeres. First frame shows the merge of GFP-Fmnl3 (green) and phase contrast (gray) images. Pictures are taken every 5 seconds, and PIV analysis is performed between 2 consecutive images. PIV vectors are overlaid on top of the images with vectors pointing upward in magenta and downward in green. Scale bar, 20 μm. PIV, Particle Image Velocimetry.

(AVI)

Click here for additional data file.

PIV analysis of 4-cell stage embryo expressing GFP or GFP-Fmnl3.

Time-lapse imaging of 4-cell stage embryos expressing GFP or GFP-Fmnl3. Pictures are taken every 5 seconds, and PIV analysis is performed between 2 consecutive images. PIV vectors are overlaid on top of the images with vectors pointing upward in magenta and downward in green. Scale bar, 20 μm. PIV, Particle Image Velocimetry.

(AVI)

Click here for additional data file.

Preimplantation development of embryos expressing GFP or GFP-Fmnl3.

Time-lapse imaging of 4-cell stage embryos expressing GFP or GFP-Fmnl3. Pictures of GFP (green) and phase contrast (gray) are taken every 3 hours. Scale bar, 20 μm.

(AVI)

Click here for additional data file.

23 Sep 2021

Submitted filename: 118346_1_rebuttal_2180637_qzqbfm.docx

Click here for additional data file.

6 Oct 2021

Dear Dr Maitre,

Thank you for submitting your manuscript entitled "Zygotic contractility awakening during mouse preimplantation development" for consideration as a Short Report by PLOS Biology.

Your manuscript, reviews from Review Commons, and revision plan have now been evaluated by the PLOS Biology editorial staff as well as by an Academic Editor with relevant expertise and I am writing to let you know that we would like to consider a revised version of your manuscript that addresses the reviewer comments from Review Commons.

Before we can invite you to submit a revised manuscript, we need you to complete your submission by providing the metadata that is required for full assessment. To this end, please login to Editorial Manager where you will find the paper in the 'Submissions Needing Revisions' folder on your homepage. Please click 'Revise Submission' from the Action Links and complete all additional questions in the submission questionnaire.

Once you have completed your submission, we will send you a formal "major revision" decision, which will include additional comments from the Academic Editor and a 3 month deadline for the revision.

Please re-submit your manuscript within two working days, i.e. by Oct 08 2021 11:59PM.

Login to Editorial Manager here: https://www.editorialmanager.com/pbiology

During resubmission, you will be invited to opt-in to posting your pre-review manuscript as a bioRxiv preprint. Visit http://journals.plos.org/plosbiology/s/preprints for full details. If you consent to posting your current manuscript as a preprint, please upload a single Preprint PDF when you re-submit.

Given the disruptions resulting from the ongoing COVID-19 pandemic, please expect delays in the editorial process. We apologize in advance for any inconvenience caused and will do our best to minimize impact as far as possible.

Feel free to email us at plosbiology@plos.org if you have any queries relating to your submission.

Kind regards,

Lucas

Lucas Smith

Associate Editor

PLOS Biology

lsmith@plos.org

8 Oct 2021

Submitted filename: 118346_1_rebuttal_2180637_qzqbfm.docx

Click here for additional data file.

11 Oct 2021

Dear Dr Maitre,

Thank you for submitting your manuscript "Zygotic contractility awakening during mouse preimplantation development" for consideration as a Short Report at PLOS Biology. As mentioned in our last email, your manuscript, the reviews from Review Commons, and your revision plan have been evaluated by the PLOS Biology editors and an Academic Editor with relevant expertise.

In light of the reviews, which I have appended below, we will not be able to accept the current version of the manuscript. However, we would welcome re-submission of a much-revised version that takes into account the reviewers' comments as outlined in your submission. Having discussed your revision plan with the Academic Editor, we would like to emphasize the need to strengthen the evidence from the latrunculin experiments by a) providing measurements of changes in surface tension b) providing alternative methods to manipulate surface tension (including the Fmnl3, actin stability, and Rho and myosin inhibition experiments you propose). We also would emphasize the need to measure surface tension in size-manipulated embryos.

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent for further evaluation by the reviewers.

We expect to receive your revised manuscript within 3 months.

Please email us (plosbiology@plos.org) if you have any questions or concerns, or would like to request an extension. At this stage, your manuscript remains formally under active consideration at our journal; please notify us by email if you do not intend to submit a revision so that we may end consideration of the manuscript at PLOS Biology.

**IMPORTANT - SUBMITTING YOUR REVISION**

Your revisions should address the specific points made by each reviewer. Please submit the following files along with your revised manuscript:

1. A 'Response to Reviewers' file - this should detail your responses to the editorial requests, present a point-by-point response to all of the reviewers' comments, and indicate the changes made to the manuscript.

*NOTE: In your point by point response to the reviewers, please provide the full context of each review. Do not selectively quote paragraphs or sentences to reply to. The entire set of reviewer comments should be present in full and each specific point should be responded to individually, point by point.

You should also cite any additional relevant literature that has been published since the original submission and mention any additional citations in your response.

2. In addition to a clean copy of the manuscript, please also upload a 'track-changes' version of your manuscript that specifies the edits made. This should be uploaded as a "Related" file type.

*Re-submission Checklist*

When you are ready to resubmit your revised manuscript, please refer to this re-submission checklist: https://plos.io/Biology_Checklist

To submit a revised version of your manuscript, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' where you will find your submission record.

Please make sure to read the following important policies and guidelines while preparing your revision:

*Published Peer Review*

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details:

https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/

*PLOS Data Policy*

Please note that as a condition of publication PLOS' data policy (http://journals.plos.org/plosbiology/s/data-availability) requires that you make available all data used to draw the conclusions arrived at in your manuscript. If you have not already done so, you must include any data used in your manuscript either in appropriate repositories, within the body of the manuscript, or as supporting information (N.B. this includes any numerical values that were used to generate graphs, histograms etc.). For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5

*Blot and Gel Data Policy*

We require the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require these files before a manuscript can be accepted so please prepare them now, if you have not already uploaded them. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements

*Protocols deposition*

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

Thank you again for your submission to our journal. We hope that our editorial process has been constructive thus far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Lucas Smith

Associate Editor

PLOS Biology

lsmith@plos.org

*****************************************************

REVIEWS:

Reviewer # 1

Evidence, reproducibility and clarity:

Periodic waves of contraction (PeCoWaCo) are stereotypical phenomena conserved in many oocytes and embryos that can lead to large-scale shape changes. However, their function is often unclear, and the parameters controlling their characteristics (de novo onset, amplitude, velocity...) still elusive in many model systems. In this manuscript, Ozguc and collaborators study the initiation of zygotic contractility during preimplantation development in the mouse. They show that PeCoWaCo become detectable in early embryos after the 2-cell stage, and progressively increase in frequency with each successive cleavage. Using elegant and challenging macro-manipulations of mouse embryos, they show that PeCoWaCo are not initiated by a reduction in cell size inherent in cell cleavage, nor their oscillation properties. Instead, PeCoWaCo are initiated and amplified by a gradual decrease in surface tension from the zygote to the 8-cell stage. The authors suggest that cortical softening awakens zygotic contractility.

The question addressed by the authors is an important one, in several fields (embryogenesis, cell biology, biophysics) and could therefore have wide impact. However, although the data presented are convincing, they fall short, controls are lacking to fully support the conclusions, and easy experiments could complement the existing limited results and take the paper to a higher level, making it a more complete study.

**Major comments:**

-Since the authors talk about "cortical maturation" during early embryogenesis and briefly about actin polymerization, they should describe the cortex itself during early embryogenesis (thickness, composition in terms of actin

nucleators, actin dynamics by FRAP...). This could also help to understand why embryos decrease their surface tension during early development.

-The authors use only one mean to reduce the tension of the cortex, using low doses of Latrunculin A. First, the authors should actually show that surface tension is reduced after this treatment by measuring it by micropipette aspiration, as they do in Figure 4 for control embryos, and show actin organization after such treatment (by immunofluorescence or live imaging). Second, could they use other means to reduce the tension of the cortex (for example play with actin polymerization by addressing actin nucleators/regulators at the cortex, or play with Myosin-II activity...)? Third, could they do the reverse, increase the tension of the cortex after the 2-cell stage to test if this inhibits/decreases PeCoWaCo (using Concanavallin A as in Kunda 2008, or embedding the embryos in loose collagen, or attracting

Myosin-II to the cortex...)? Finally, what is the long-term effect of disrupting the appearance/characteristics of PeCoWaCo on subsequent embryo development? This question could be addressed by tuning the intensity of PeCoWaCo using the experiments suggested above in the zygote or at the 2- cell stage, and monitoring embryo development up to the blastocyst stage to assess the outcome on embryo development.

-In most figures, with the exception of Figure 3, the authors detect and analyze PeCoWaCo using PIV, a technique that tracks movements in the cytoplasm. However, cytoplasmic movements are not always due to the contractility of the cortex and PeCoWaCo. They can be generated by cortex-independent cytoplasmic activity. Thus, it would have been preferable to follow the cell contour as in Figure 3 for all figures, for all stages (on dissociated embryos for

4 and 8-cell stages if too challenging due to overlapping of blastomeres in 2D). Another way to validate PIV as a means of detecting PeCoWaCo without having to repeat all the experiments could be to correlate PIV with oocyte contour in control embryos at all stages.

-In the treatments perturbing the cell size to test whether it is sufficient to initiate PeCoWaCo (Figure 2) or modify their periodicity (Figure 3), how is the surface tension between all conditions? Indeed, the authors nicely show that the cell size does not matter for PeCoWaCo, but that the cell surface does matter, so if PeCoWaCo are similar between cells of different sizes, it means that their surface tension should be in the same range as well. The authors should therefore measure it by micropipette aspiration.

- re the characteristics of the PeCoWaCo the same in interphase and mitosis? In Bischof 2017, surface contraction waves in starfish oocytes are regulated by a cdk1-cyclinB gradient in meiosis. Could such a mechanism play a role in what the authors observe in early mouse embryos? For example, is there a correlation between cell cycle length (and especially M-phase) and PeCoWaCo strength? If so (shorter cell cycles/M-phases in zygotes compared to 8-cell stage embryos), one could imagine that mouse embryos are progressively exposed to cdk1-cyclinB for longer periods of time during their development, which would contribute to the appearance and increase in PeCoWaCo.

**Minor comments:**

-Why does the proportion of embryos with oscillations decrease at the 8-cell stage compared to the 4-cell stage (Figure 1D)? It should not, since the surface tension is lower in 8-cell stage compared to the 4-cell stage (Figure 4B).

-Figure 2G shows that PeCoWaCo are not detected in either control or fragmented cells at the 2-cell stage but with a volume corresponding to a 4-cell stage, suggesting that 4-cell stage blastomere size is not sufficient to trigger PeCoWaCo. However, in Figure 1D, PeCoWaCo are detected in half of the control embryos at the 2-cell stage. Why is there a difference in the % of control embryos at the 2-cell stage with oscillations (0% versus 50%) between these 2 experiments? Could this be due to the CCD treatment allowing volume reduction (but also maybe reduction in surface tension) in Figure 2G?

-Since the authors fuse and dissociate embryos at the 16-cell stage, they should show the period and velocity of PeCoWaCo in unmanipulated 16-cell stage embryos prior to any treatment.

-In Figure 3, the percentage of embryos with detected oscillations should be added to the figure, as for Figure 1D or 2G.

-In Figure 3C-F, the period of the PeCoWaCo is about 100 s, higher than that of the 8-cell stage in Fig1E, which is about 75 s. Is this difference statistically significant? And if so, why would it be higher in Figure 3?

-Since PeCoWaCo become detectable after the 2nd cleavage, and thus after the ZGA, it could depend on a development program, allowing the surface tension to be reduced. The authors could have discussed this point further in the discussion

Finally, the figures are difficult to read and the legends lack precision:

-Some x-axis should be more informative with more than 3 values (Figures 1D,

2C, 2G, 4D, S1A).

- he value of the averages, or the exact percentages, should appear in full somewhere in the text, figures or legends (Figures 1D, 1E, 2C, 2D, 2G, 3C, 3D,

3F, 3G, 4B, 4D, 4E, S1A, S1B, S2).

-The exact p-value should be written in full somewhere in the text, figures or legends (concerns all figures).

-Sometimes the titles of the axes do not correspond to what the graph shows. For example, in graphs 1D, 2C, 2G, 4D, S1A, the x-axis shows all the embryos, not just the ones with oscillations.

-some figure legends lack information: What are the white arrows in Figure

3A? What are we looking at in Figure 3A, embryos in transmitted light or expressing a probe to follow the embryo contour? T and V in Figure 3A represent period and velocity, but it is not stated in the legend. The curvature bar in Figure 3A is strange as it is mostly white. The scale bar values are missing for Figures 2B, 2F, 4A and 4C.

-In Figure 3, the y-axes are not all consistent, sometimes the radius of the embryos is shown, sometimes fractions of 16-cell stage cells (which is not easy to read).

SIGNIFICANCE:

The question addressed by the authors is an important one, in several fields (embryogenesis, cell biology, biophysics) and could therefore have wide impact. However, although the data presented are convincing, they fall short, controls are lacking to fully support the conclusions, and easy experiments could complement the existing limited results and take the paper to a higher level, making it a more complete study.

Reviewer # 2

Evidence, reproducibility and clarity:

The manuscript by Özgüc and coworkers analyses the cortical contraction waves that are observed in early mouse embryos around the 8- to 16-cell stage. First, they provide a very careful, precise quantitative characterization of these contraction waves using PIV (particle image velocitometry) and by measuring the local cortex curvature. They find that contraction waves 'awaken' as development progresses, i.e. the oscillation frequency (and amplitude) of the waves is increasing during the cleavage divisions.

Then, they use a number of very elegant micromanipulations to dissect whether the decreasing cell size is the cause for the increased cortical activity and increased frequency of contraction waves. Somewhat surprisingly, but very clearly they demonstrate that cortical contractions are independent of cell size. These results are consistent across a wide range of manipulated cell (fragment) sizes, and various types of treatments.

Next, they measure the surface tension of cells using micropipette suction. These experiments reveal a clear correlation between surface tension and the period of contraction waves. To prove the causal relation between these processes, they artificially decrease the surface tension in 2-cell embryos by partially depolymerizing the cortex using Latrunculin A. This led to a strengthening of the contractions.

Together, the authors conclude that properties of cortical contraction waves are independent of cell size. Instead, they propose that the reason for the gradually increasing frequency of cortical contraction waves is the gradual softening of the cell cortex accompanying cleavage divisions.

**Major comments:**

1.The authors start introducing contraction waves by quantifying cytoplasmic flows using PIV. I would find it important to first show that deformations of the cortex are indeed causing the observed cytoplasmic flow patterns, which should be straightforward to analyze by using the tools shown on Fig. 3A. As there are other known, cortex independent mechanisms to generate cytoplasmic flows, these experiments would be important to exclude such alternative mechanisms.

2.I am very impressed by the various manipulations the authors use to demonstrate the independence of cell size and cortical contractions. However, I wonder why these manipulations have not been used in combination with surface tension measurements. Even more critically, I am missing more experiments that would directly demonstrate the causal relationship between cortical tension and contraction period. Unfortunately, the Latrunculin A results are less clear (as compared to other results shown in the paper), and the effect may indeed be more complex. For example, Bement et al (NCB, 2015) suggested a biochemical feedback mechanism based on F-actin, which in this experiment could not be distinguished from 'mechanical' effects of surface tension. Generally, I feel that additional perturbation experiments are needed in order to strengthen the conclusions. This should include upstream pathways known to regulate cortical contractility such as RhoA, for example.

**Minor comment:**

I would not mind if the authors used PeCoWaCo as an acronym through the present manuscript, but as they state, this is likely to be a very conserved feature of the cell cortex possibly of all animal cells. With this in mind, I doubt

that the community would adopt such a rather complicated acronym to describe this process.

SIGNIFICANCE:

Waves of cortical contractions are likely to be a widely conserved feature of the cortex of animal cells. The present manuscript makes important contributions to understand this process by (i) developing tools to quantify the process, (ii) show that contraction waves are independent of cell size, (iii) the period of contractions likely depend on the surface tension of the cell. These findings are broadly relevant for the cell biology community as a whole, however, as stated above, the findings needs to be substantially strengthened before publication, in my opinion.

10 Jan 2022

Submitted filename: 220106ResponseReferees.docx

Click here for additional data file.

7 Feb 2022

Dear Dr Maitre,

Thank you for submitting your revised Short Reports entitled "Zygotic contractility awakening during mouse preimplantation development" for publication in PLOS Biology. I have now obtained advice from the original reviewers and have discussed their comments with the Academic Editor.

Based on the reviews (attached below), we will probably accept this manuscript for publication, provided you satisfactorily address the remaining points raised by the reviewers. Please also make sure to address the following data and other policy-related requests.

Please also note that our Short Reports only have a maximum of 4 main figures, thus please redistribute the information currently shown in Figure 5 in the remaining figures or as a Supplementary Figure.

In addition, we would like to consider a suggestion to improve the title:

"Cortical softening mediated by Fmnl3 downregulation awakens zygotic contractility during mouse preimplantation development"

Please only use 'awakens' if it is an actual term used in the field. Otherwise, "elicits" would probably be more appropriate.

As you address these items, please take this last chance to review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the cover letter that accompanies your revised manuscript.

We expect to receive your revised manuscript within two weeks.

To submit your revision, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' to find your submission record. Your revised submission must include the following:

-  a cover letter that should detail your responses to any editorial requests, if applicable, and whether changes have been made to the reference list

-  a Response to Reviewers file that provides a detailed response to the reviewers' comments (if applicable)

-  a track-changes file indicating any changes that you have made to the manuscript.

NOTE: If Supporting Information files are included with your article, note that these are not copyedited and will be published as they are submitted. Please ensure that these files are legible and of high quality (at least 300 dpi) in an easily accessible file format. For this reason, please be aware that any references listed in an SI file will not be indexed. For more information, see our Supporting Information guidelines:

https://journals.plos.org/plosbiology/s/supporting-information

*Published Peer Review History*

Please note that you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details:

https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/

*Early Version*

Please note that an uncorrected proof of your manuscript will be published online ahead of the final version, unless you opted out when submitting your manuscript. If, for any reason, you do not want an earlier version of your manuscript published online, uncheck the box. Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us as soon as possible if you or your institution is planning to press release the article.

*Protocols deposition*

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

Please do not hesitate to contact me should you have any questions.

Sincerely,

Ines

--

Ines Alvarez-Garcia, PhD,

Senior Editor,

ialvarez-garcia@plos.org,

PLOS Biology

------------------------------------------------------------------------

DATA POLICY: IMPORTANT - PLEASE READ

You may be aware of the PLOS Data Policy, which requires that all data be made available without restriction: http://journals.plos.org/plosbiology/s/data-availability. For more information, please also see this editorial: http://dx.doi.org/10.1371/journal.pbio.1001797

Note that we do not require all raw data. Rather, we ask that all individual quantitative observations that underlie the data summarized in the figures and results of your paper be made available in one of the following forms:

1) Supplementary files (e.g., excel). Please ensure that all data files are uploaded as 'Supporting Information' and are invariably referred to (in the manuscript, figure legends, and the Description field when uploading your files) using the following format verbatim: S1 Data, S2 Data, etc. Multiple panels of a single or even several figures can be included as multiple sheets in one excel file that is saved using exactly the following convention: S1_Data.xlsx (using an underscore).

2) Deposition in a publicly available repository. Please also provide the accession code or a reviewer link so that we may view your data before publication.

Regardless of the method selected, please ensure that you provide the individual numerical values that underlie the summary data displayed in the following figure panels as they are essential for readers to assess your analysis and to reproduce it:

Fig. 1B-E; Fig. 2C, D, G, F; Fig. 3C, D, F, G, I-L; Fig. 4C, E-G; Fig. 5B-D; Fig. S1A-H; Fig. S2A-B; Fig. S3A-B; Fig. S4A-B; Fig. S5B-G and Fig. S6C

NOTE: the numerical data provided should include all replicates AND the way in which the plotted mean and errors were derived (it should not present only the mean/average values).

Please also ensure that figure legends in your manuscript include information on WHERE THE UNDERLYING DATA CAN BE FOUND, and ensure your supplemental data file/s has a legend.

Additionally, please provide all the accession numbers and make the files publicly available at this stage.

Please ensure that your Data Statement in the submission system accurately describes where your data can be found.

------------------------------------------------------------------

Reviewers' comments

Rev. 1:

As stated in my previous review for Review Commons, the manuscript has three major conclusions: (i) it provides a quantitative description of oscillatory cortical contraction waves in early mouse embryos; (ii) it shows using a series of perturbation and micromanipulation experiments that frequency and amplitude of these contraction waves is independent of cell size; (iii) it provides correlative evidence and a couple of perturbation experiments suggesting that progressive softening of the oocyte cortex is the cause of the observed 'awakening' of contractions as cleavage divisions proceed.

My major criticism was the lack of direct evidence for a causal relationship between cortical tension and contraction waves. This criticism was partially addressed by the authors in the revised manuscript by combining the perturbation experiment (low-dose latrunculin treatment) with measurement of the cortical tension, and by including an additional perturbation (overexpression of fmnl3). With these additions, I think the manuscript is very well suited for publication in PLoS Biology as a Short Report, as I consider the findings still somewhat preliminary, but certainly of high relevance, which is the exact purpose of the Short Reports, as I understand.

I only have a few minor comments to improve readability:

1. As I explained in my previous review, I do think it is very important to establish that PIV is a valid approach to report on cortical contractions. Therefore, I would suggest moving the panels now shown on FS4 into ideally Figure 1 or into one of the other main figures.

2. I would suggest to include the data on FS6 in the last main figure. I think this is a very a nice experiment!

3. I would suggest removing FS5 panel H, because without detailed validation these stainings are not easily interpretable.

Rev. 2:

The authors responded to all my comments by arguing or adding experiments, and the result is that the article is strengthened (both by adding controls, but also mechanistic like the part on Fmnl3).

One key question remains: what is the physiological role of these contractions ? In other word, what is the long-term effect of disrupting the appearance/characteristics of PeCoWaCo on the subsequent development of the embryo? This question could be addressed by tuning the intensity of PeCoWaCo in the zygote or at the 2-cell stage, and monitoring the development of the embryo up to the blastocyst stage to assess the outcome on embryo development. This question was only partly addressed by Fmnl3 overexpression, as the effect is transient: the

embryos show PeCoWaCo at the end of the 4-cell stage and develop to blastocyst normally. However, since this manuscript is considered a Short Report, this is not necessary and will pave the way for future research.

Minor:

- The scale bar values are still missing in the legends for Figures 2B, 2F, 4A, 4D 5A.

- The tables legends are wrong sometimes (Table 9 is related to figure S5 and not 5, Table 8 is related to figure 5 and not S5).

18 Feb 2022

Submitted filename: 220215ResponseToReferees.docx

Click here for additional data file.

4 Mar 2022

Dear Jean-Leon,

On behalf of my colleagues and the Academic Editor, Sally Lowell, I am pleased to say that we can in principle accept your Short Report entitled "Cortical softening elicits zygotic contractility during mouse preimplantation development" for publication in PLOS Biology, provided you address any remaining formatting and reporting issues. These will be detailed in an email that will follow this letter and that you will usually receive within 2-3 business days, during which time no action is required from you. Please note that we will not be able to formally accept your manuscript and schedule it for publication until you have any requested changes.

Please take a minute to log into Editorial Manager at http://www.editorialmanager.com/pbiology/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production process.

PRESS

We frequently collaborate with press offices. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximise its impact. If the press office is planning to promote your findings, we would be grateful if they could coordinate with biologypress@plos.org. If you have previously opted in to the early version process, we ask that you notify us immediately of any press plans so that we may opt out on your behalf.

We also ask that you take this opportunity to read our Embargo Policy regarding the discussion, promotion and media coverage of work that is yet to be published by PLOS. As your manuscript is not yet published, it is bound by the conditions of our Embargo Policy. Please be aware that this policy is in place both to ensure that any press coverage of your article is fully substantiated and to provide a direct link between such coverage and the published work. For full details of our Embargo Policy, please visit http://www.plos.org/about/media-inquiries/embargo-policy/.

Thank you again for choosing PLOS Biology for publication and supporting Open Access publishing. We look forward to publishing your study.

Sincerely,

Ines

--

Ines Alvarez-Garcia, PhD

Senior Editor

PLOS Biology

ialvarez-garcia@plos.org