Literature DB >> 35316825

Increased yield of AP-3 by inactivation of asm25 in Actinosynnema pretiosum ssp. auranticum ATCC 31565.

Hong Cheng1,2, Guoqing Xiong1,2, Yi Li2, Jiaqi Zhu2,3, Xianghua Xiong2, Qingyang Wang2, Liancheng Zhang2, Haolong Dong2, Chen Zhu2, Gang Liu2, Huipeng Chen2.   

Abstract

Asamitocins are maytansinoids produced by Actinosynnema pretiosum ssp. auranticum ATCC 31565 (A. pretiosum ATCC 31565), which have a structure similar to that of maytansine, therefore serving as a precursor of maytansine in the development of antibody-drug conjugates (ADCs). Currently, there are more than 20 known derivatives of ansamitocins, among which ansamitocin P-3 (AP-3) exhibits the highest antitumor activity. Despite its importance, the application of AP-3 is restricted by low yield, likely due to a substrate competition mechanism underlying the synthesis pathways of AP-3 and its byproducts. Given that N-demethylansamitocin P-3, the precursor of AP-3, is regulated by asm25 and asm10 to synthesize AGP-3 and AP-3, respectively, asm25 is predicted to be an inhibitory gene for AP-3 production. In this study, we inactivated asm25 in A. pretiosum ATCC 31565 by CRISPR-Cas9-guided gene editing. asm25 depletion resulted in a more than 2-fold increase in AP-3 yield. Surprisingly, the addition of isobutanol further improved AP-3 yield in the asm25 knockout strain by more than 6 times; in contrast, only a 1.53-fold increase was found in the WT strain under the parallel condition. Thus, we uncovered an unknown function of asm25 in AP-3 yield and identified asm25 as a promising target to enhance the large-scale industrial production of AP-3.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35316825      PMCID: PMC8939807          DOI: 10.1371/journal.pone.0265517

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The development of cancer therapy drugs has undergone several generations [1,2]. Antibody-drug conjugates (ADCs) are one of the fastest growing categories of anticancer drugs, characterized by a monoclonal antibody linked to a molecule with antitumor activity to form conjugates [3,4]. Maytansine, first isolated from African shrubs by Kupchan et al. in 1972, is capable of suppressing tubulin polymerization during mitosis, thereby exerting a strong proapoptotic effect on cancer cells [5-7]. Due to its strong cytotoxicity, maytansine has been utilized in the development of new generations of ADCs [8,9]. However, the natural content of maytansine in plants is too low, making it difficult to satisfy the fast-growing market demand. Ansamitocins, isolated from Actinosynnema pretiosum, have antitumor activity similar to that of maytansine and could serve as a precursor of maytansine due to their structural similarity [10-12]. In contrast to maytansine, which can be extracted only from plants, ansamitocins can be easily obtained by the large-scale fermentation of certain bacterial strains, such as Actinosynnema pretiosum ssp. auranticum ATCC 31565 (A. pretiosum ATCC 31565). Among more than 20 derivatives [13], AP-3 shows outstanding antitumor activities not only through the inhibition of tubulin polymerization but also by activating dendritic cells to enhance antitumor immunity [14-16]. Despite its apparent advantages, the yield of AP-3 from the original strains is still limited. Traditional mutagenesis and specific gene modification represent two major ways to obtain AP-3 high-yield strains. By traditional methods, high-yield strains can be obtained by physical irradiation- and compound-induced mutagenesis [17,18]. However, mutations are usually accompanied by unexpected randomness, which makes it difficult to achieve precise control of the direction of evolution. In recent decades, with the explosive development of gene editing technology, targeting a certain gene or a batch of tightly related genes to generate high-yield strains for interesting products has become a possibility, and an increasingly attractive one. Liu et al. constructed a multigene coexpression system in Escherichia coli BW25113 and obtained strains with a high yield of shikimic acid [19]. Singh et al. improved artemisinin yield by ectopic expression of β-glucosidase to increase the glandular hair density in Artemisia annua [20]. More recently, alone with a set of genes, asm1-48, were found to be closely related to AP-3 biosynthesis, strategies that overexpression or inactivation of these genes in host strains have successfully improved AP-3 yield [17,21-23]. Since N-demethylansamitocin P-3 (PND-3), the precursor of AP-3, is regulated by the genes asm25 and asm10 to synthesize ansamitocinosides P-3 (AGP-3) AP-3, respectively [24-26], the competitive consumption of the common substrate in the AGP-3 synthesis pathway may dampen the yield of AP-3. However, the effect of asm25 on AP-3 yield is still unclear. Hence, in this study, we inactivated asm25 in A. pretiosum ATCC 31565 by CRISPR-Cas9-guided gene knockout and determined AP-3 production by high-performance liquid chromatography (HPLC) (Fig 1). Inactivation of asm25 indeed increased AP-3 yield in A. pretiosum ATCC 31565. Additionally, adding isobutanol, which facilitates the synthesis of the C-3 side chain of AP-3 [27], further improved the yield of AP-3 in the asm25 knockout strain.
Fig 1

Schematic of the biosynthesis pathway of AP-3 and a brief workflow.

Materials and methods

Strains and plasmids

A. pretiosum ATCC 31565 was obtained from the ATCC (USA) and cultured on solid or in liquid ISP2 medium containing 0.4% yeast extract, 1% malt extract and 0.4% glucose (pH 7.2). Solid medium contains 1.8% agar. DH5α E. coli competent cells were purchased from CoWin Biosciences, and E. coli electrocompetent cells (ET12567, pUZ8002) were in laboratory stock. The pCas9 (pWHU2653) plasmid used for asm25 targeting was in laboratory stock as well.

Construction of the knockout plasmid pCas9-asm25-LR

The sgRNA sequence “ctcgttgagccggggcagca” targeting asm25 was designed according to AF453501, deposited in NCBI GenBank, and synthesized artificially. A 0.3 kb fragment located between the PermE promoter and Terminator was cleaved from pCas9 pWHU2653 with NheI and XbaI, and then the sgRNA was inserted to place the sgRNA under the control of the PermE promoter. The fragment containing sgRNA was cloned into pWHU2653, resulting in K-asm25sg. Subsequently, homologous arms flanking asm25 were amplified from A. pretiosum ATCC 31565 genomic DNA and named asm25-L (1.4 kb) and asm25-R (1.5 kb). Then, asm25-LR (2.9 kb) was generated from asm25-L and asm25-R by overlapping PCR, followed by cloning into K-asm25sg to obtain the pCas9-asm25-LR targeting plasmid. The primers used for PCR amplification are listed in Table 1. A diagrammatic sketch of the construction of the asm25 targeting plasmid is shown in S1 Fig.
Table 1

Primers used in this study.

PrimerPrimer sequence (5’-3’)
asm25-L-F GCAAGCTTACGTTGTCCACCCCGTTGTCC
asm25-L-R GGTTCTGGGTGGAGCTGGCCGATCCCCGCTTCACC
asm25-R-F GGATCGGCCAGCTCCACCCAGAACCTCGC
asm25-R-R GCAAGCTTTGGCGGACGTGGACGACGACC
asm25-seq-F ACCAGCGGAGGAGGAGACCCA
asm25-seq-R CCCCAGCACGGAGGAAGACAG

Generation of the asm25 knockout strain

pCas9-asm25-LR was introduced into A. pretiosum ATCC 31565 via E. coli-Actinosynnema biparental conjugation as described [28]. Briefly, the pCas9-asm25-LR plasmid was electrotransferred into E. coli ET12567 competent cells and then cells were grown on LB solid medium containing kanamycin (25 μg/mL), chloramphenicol (25 μg/mL) and apramycin (100 μg/mL) at 37°C overnight to obtain a single clone. After heat shock, A. pretiosum ATCC 31565 cells were resuspended in LB medium and mixed with E. coli ET12567, followed by cultivation for 3–7 days on a solid medium with apramycin to obtain exconjugants. To screen for double-crossover mutants, single clones of exconjugant were cultured in liquid medium without the presence of apramycin for three rounds. Then, the exconjugants were plated on solid medium with or without apramycin. The clones that regained sensitivity to apramycin were selected for analysis for asm25 deletion via PCR amplification with the primers asm25-seq-F and asm25-seq-R (Table 1). Positive clones were further confirmed by sequencing.

Fermentation of A. pretiosum ATCC 31565 in flasks

A. pretiosum ATCC 31565 single clones from culture dishes were cultured in seed culture medium (yeast extract: 4 g/L, maltose: 10 g/L, dextrose: 4 g/L and sodium chloride: 1.5 g/L) for 60 hours. Subsequently, 10 mL of seed medium was added to 200 mL of fermentation medium (yeast extract: 4 g/L, maltose: 10 g/L, soluble starch: 4 g/L and sodium chloride: 1.5 g/L) in a 500 mL cone flask at a ratio of approximately 1:20. Fermentation lasted for 9 days, and the medium was sampled every 24 hours for the determination of AP-3 yield. For isobutanol-related experiments, various amounts of isobutanol were added to the broth at the initiation of the fermentation reaction.

Determination of AP-3 yield by HPLC

After centrifugation, 2 mL of fermentation supernatant was collected and mixed vigorously with the same volume of ethyl acetate. The ethyl acetate phase was collected and mixed with ethyl acetate again for further extraction. After rotary evaporation, the concentrates were redissolved with methanol and subjected to component analysis by HPLC. An Agilent 1260 Infinity II instrument was used for HPLC analysis. The stationary phase was an Agilent EC-C18 column (4 μm, 4.6 × 250 mm). The mobile phase was 52% acetonitrile/48% water after degassing with a filter membrane and ultrasonication. The configuration was set as follows: the flow rate was 1 mL/min, the wavelength of the UV detector was 254 nm, the column temperature was 25°C, and the injection volume of the sample was 5 μL. The sample was injected automatically. The concentration of AP-3 standard ranging from high to low (80, 40, 20, 10, 5, 2.5, 1.25 and 0.625 mg/L) was prepared by gradient dilution in chromatographically pure methanol. The concentration of AP-3 in the samples was calculated by comparison with the AP-3 standard curve.

Statistical analysis

GraphPad Prism 9.0.0 (developed by GraphPad Software) was utilized to perform statistical analysis for AP-3 yield comparisons. The data are presented as the mean ± standard deviation (SD). The comparison between asm25-knockout and WT used Student’s t test, whereas the means of the six groups from the isobutanol experiments were compared by ANOVA.

Results

Establishment of a method for the detection of AP-3 by HPLC

First, we established an applicable approach to detect AP-3 from fermentation samples, as described above. Based on the principle that the x-axis indicates the concentration of the AP-3 standard and the y-axis indicates an absorbing peak area, the standard curve was generated (Fig 2A). The standard curve equation was Y = 10.261X-2.6282, R2 = 0.9999, and the linear relationship held true within the AP-3 concentration range of 0.625–80 mg/L (Fig 2A). The fermentation sample peaked at the same time point as the AP-3 standard (red arrow, Fig 2B and 2C), suggesting a presence of AP-3 in the sample. Then, the effluent indicated by the peak (red arrow in Fig 2B and 2C) was harvested for further analysis by nuclear magnetic resonance (NMR) and liquid chromatography-mass spectrometry (LS-MS), carried out by Dalian University and the Institute of Process Engineering of Chinese Academy of Sciences, respectively. The product was identified as AP-3 (S2 Fig). Thus, we successfully set up a practicable method to detect AP-3 from fermentation samples.
Fig 2

HPLC analysis of AP-3 production.

(A) AP-3 standard curve. (B) Products of the fermentation sample. (C) AP-3 standard. Red arrows indicate the AP-3 position in the graphs.

HPLC analysis of AP-3 production.

(A) AP-3 standard curve. (B) Products of the fermentation sample. (C) AP-3 standard. Red arrows indicate the AP-3 position in the graphs.

Inactivation of asm25 in A. pretiosum ATCC 31565

The diagram describing the construction of the pCas9-asm25-sgRNA targeting plasmid is shown in Fig 3A. Cloning of asm25-sgRNA into pWHU2653 did not cause plasmid degradation (Fig 3B). Then, the homologous arms flanking asm25 (1.5 kb for arm R and 1.4 kb for arm L) were amplified by PCR and then merged into one fragment (2.9 kb) (Fig 3C). After double-crossover screening (S3 Fig), selected exconjugants were analyzed for asm25 depletion. Theoretically, the asm25 knockout strain gave 0.7 kb products, whereas the wild type gave 1.6 kb products. Thus, clones 2, 5, 6, 7, and 9 were considered to exhibit asm25 knockout (Fig 3D). Cell sequencing showed that the most part of asm25 (885 bp of 1209 bp, 132 to 1016) was depleted from A. pretiosum ATCC 31565 genome, as expected (S4 Fig). Thus, the asm25-inactivated A. pretiosum ATCC 31565 strain was successfully established.
Fig 3

Generation of the asm25-inactivated strain.

(A) Schematic diagram of plasmid construction. Gel electrophoresis of pWHU2653 harboring asm25 sgRNA (both lanes). Plasmids were purified from E. coli. (C) Gel electrophoresis of homologous arms of asm25. Lanes 1 and 2 indicate arm R, Lanes 3 and 4 indicate arm L, and Lane 5 indicates arm LR fusion. (D) Gel electrophoresis of selected double-crossover exconjugantes. The primers asm25-seq-F and asm25-seq-R were used for PCR.

Generation of the asm25-inactivated strain.

(A) Schematic diagram of plasmid construction. Gel electrophoresis of pWHU2653 harboring asm25 sgRNA (both lanes). Plasmids were purified from E. coli. (C) Gel electrophoresis of homologous arms of asm25. Lanes 1 and 2 indicate arm R, Lanes 3 and 4 indicate arm L, and Lane 5 indicates arm LR fusion. (D) Gel electrophoresis of selected double-crossover exconjugantes. The primers asm25-seq-F and asm25-seq-R were used for PCR.

Increased yield of AP-3 in the asm25 knockout strain

To investigate whether asm25 knockout might affect AP-3 yield, WT and asm25-knockout strains of A. pretiosum ATCC 31565 were cultured in parallel fermentation conditions for 9 days. Samples were collected every 24 hours from Day 3 to the end of the fermentation. The levels of AP-3 were determined after all samples were collected. It was shown that asm25 knockout resulted in more AP-3 production than the WT strain from Day 6, and the difference in AP-3 levels between the two groups increased as fermentation progressed. At the end of the fermentation, the AP-3 yield reached a peak in each group, and the AP-3 yield in the asm25 knockout strain (4.42 ± 0.58 mg/L) was increased more than 2-fold in comparison with that of the WT strain (1.93 ± 0.15 mg/L) (Fig 4).
Fig 4

Determination of AP-3 yield in asm25 knockout and WT strains by HPLC.

Student’s t test was used for statistical analysis. *: p<0.05. The mean ± SD from three independent experiments (n = 3) are presented. Blue line: WT strain; Red line: asm25 knockout strain.

Determination of AP-3 yield in asm25 knockout and WT strains by HPLC.

Student’s t test was used for statistical analysis. *: p<0.05. The mean ± SD from three independent experiments (n = 3) are presented. Blue line: WT strain; Red line: asm25 knockout strain.

asm25 inactivation augments the improvement of AP-3 production by isobutanol

The addition of isobutanol has been reported to enhance the yield of AP-3 in fermentation via a C-3 side chain synthesis mechanism [27]. To investigate whether the addition of isobutanol combined with the knockout of asm25 has a synergistic effect on AP-3 yield, the fermentation processes started with the addition of a variety of concentrations of isobutanol (0, 20, 30, 40, 50 and 60 mM). As expected, adding isobutanol indeed improved AP-3 yield, with isobutanol used at concentrations of 20, 30, 40 and 50 mM. Interestingly, adding 40 mM isobutanol resulted in the highest production of AP-3 (2.92 ± 0.09 mg/L versus 1.39 ± 0.09 mg/L without isobutanol), suggesting an optimal concentration of isobutanol for AP-3 production (Fig 5A). Surprisingly, adding isobutanol showed a marked improvement in AP-3 yield in the asm25 knockout strain. As shown in Fig 5B, AP-3 yield in the group with 40 mM isobutanol was dramatically improved during the fermentation process, up to 27.43 ± 1.03 mg/L at Day 9, increasing almost 6-fold in comparison with that without isobutanol (4.42 ± 0.23 mg/L) and 9-fold compared with that in the WT strain with isobutanol (2.92 ± 0.09) (Fig 5A and 5B).
Fig 5

Determination of AP-3 yield in the presence of isobutanol.

(A) AP-3 yield curve in the WT strain. (B) AP-3 yield curve in the asm25 knockout strain. Lines in color represent various concentrations of isobutanol in fermentation. The mean ± SD from three independent experiments (n = 3) are presented. The comparison and statistical analysis for AP-3 yield at Day 9 among groups were performed by the ANOVA. **: p<0.01; ***: p<0.001.

Determination of AP-3 yield in the presence of isobutanol.

(A) AP-3 yield curve in the WT strain. (B) AP-3 yield curve in the asm25 knockout strain. Lines in color represent various concentrations of isobutanol in fermentation. The mean ± SD from three independent experiments (n = 3) are presented. The comparison and statistical analysis for AP-3 yield at Day 9 among groups were performed by the ANOVA. **: p<0.01; ***: p<0.001.

Discussion

Ansamitocins, known as the microbial versions of natural maytansinoids, represent a family of 19-membered macrocyclic lactams with outstanding cytotoxic and antitumor activities, which are widely used to design ADCs [29]. According to different side-chain substituents, ansamitocins can be roughly classified into 20 types, among which AP-3, with an isobutyryl group connected to the side chain at the C-3 position of the mother nucleus, exhibits a similar chemical structure and antitumor activity to maytansine. Currently, AP-3 is mainly obtained from biological fermentation. However, the yield of AP-3 is still hampered by the low productivity of its host strains, i.e., A. pretiosum ATCC 31565. In recent years, the genes belonging to the ansamitocin biosynthesis gene cluster (asms) have been functionally determined, and with the rapid development of synthetic biology technology, the situation has substantially improved. Pan et al. identified asm8 as an AP-3-positive gene and demonstrated that ectopic overexpression of asm8 improved AP-3 yield [21]. Ning et al. inactivated asm30 (negative AP-3) and overexpressed asm10 (positive AP-3) in A. pretiosum subsp. pretiosum ATCC 31280, obtaining a strain with a high AP-3 yield [22]. Hence, manipulation of the genes tightly related to AP-3 biosynthesis seems to be a promising way to obtain AP-3 high-yield strains. In our study, asm25 was chosen for investigation of its relationship with AP-3 yield. asm25 is known as an N-glycosyltransferase of ansamitocin that catalyzes the N-glycosylation of PND-3 to generate AGP-3 [26]. Because PND-3 is the common precursor for both AGP-3 and AP-3, we hypothesized that asm25 inactivation might shift the biological reaction to AP-3 synthesis. As expected, the AP-3 yield doubled upon asm25 knockout without affecting the general biological features of the host strain. To our surprise, in the presence of isobutanol, a supplement known to be advantageous to AP-3 biological synthesis, the yield of AP-3 increased more than 9-fold in the asm25 knockout strain compared with the WT. These data suggest that not only ams25 inactivation has a synergistic effect with isobutanol on AP-3 yield, but inactivation of asm25 also enlarges the effect, resulting in a substantial increase in AP-3 yield. Notably, asm25 knockout also improved the production of some byproducts, AP-2 and AP-4, by more than 10-fold (6.33 ± 1.23 mg/L versus 0.59 ± 0.19 mg/L in WT) and 1.2-fold (2.09 ± 0.17 mg/L versus 1.88 ± 0.23 mg/L in WT), respectively (S5 Fig). This is not puzzling because in addition to AGP-3, asm25 is also responsible for the catalysis of PND-2 and PND-4 to generate AGP-2 and AGP-4, respectively [26], logically resulting in the inhibition of AP-2 and AP-4 synthesis. Unfortunately, because the AGP-3 standard was not available, we did not perform assays to quantify the AGP-3 yield in the asm25 knockout strain. Further experiments should be carried out to address this issue to better understand the mechanisms by which asm25 regulates AP-3 yield. Several attempts have successfully improved the biological yield of AP-3 via a variety of strategies. Traditionally, a high yield of AP-3 can be obtained from physical and chemical factor-induced mutagenesis in host strains. Previously, a random mutagenesis approach was established by Chung et al. to generate mutant strains that produce 5- to 10-fold more AP-3 than the parental strain [30]. Du et al. isolated a mutant strain with a 3-fold AP-3 yield increase by an N-methyl-N’-nitro-N-nitrosoguanidine mutation [17]. Through mutation breeding, Zhong et al. generated a high AP-3 yield A. pretiosum ATCC 31565, in which the production of AP-3 increased up to 19.7-fold [18]. Although mutagenesis has shown advantages in obtaining new strains, completely random mutations in the host genome critically dampen the subsequent screening efficiency. Hence, targeting certain genes responsible for AP-3 synthesis has become a more popular way to generate strains with high AP-3 yield. The results from Ning et al., as mentioned above, showed that inactivation of asm30 and overexpression of asm10 improved AP-3 yield by 66% and 93%, respectively. In another study, overexpression of asm13-17 improved the AP-3 titer in a shake flask by 1.94-fold. In our study, by contrast, inactivation of asm25 exhibited a more profound effect on AP-3 production, with a more than 9-fold increase compared with WT, in the presence of 40 mM isobutanol. Although the absolute titer of AP-3 in our study was not remarkably high, optimization of the fermentation conditions and application of a fed-batch culture strategy might give rise to a more profound improvement in AP-3 yield in the asm25-inactivated strain. Collectively, we demonstrated that asm25 is a novel regulator of AP-3 yield. It is of great interest that involving asm25 inactivation in existing high-yield strains might further improve AP-3 yield to a new level.

Work flow of the construction of pCas9-asm25-LR, the asm25 targeting plasmid.

(PDF) Click here for additional data file.

Determination of the fermentation products in A. pretiosum ssp. auranticum ATCC 31565.

The products were analyzed and identified by Waters 600 series high performance liquid chromatograph (HPLC) and Bruker microtof-q II mass spectrometer (MS). The HPLC chromatogram and MS spectrum were well consistent with each other. Three samples, sample A, B and C, whose peak time ranged from 15 min to 30 min in MS spectrum, were further analyzed by hydrogenation analysis and compared with related database. Sample A, B and C were identified as AP-2, AP-3 and AP-4, respectively. (A) HPLC chromatograms. (B) MS spectrums. (PDF) Click here for additional data file.

Screening for asm25 knockout strains.

(A) Upper row: A. pretiosum ssp. auranticum ATCC 31565 cells mixed with plasmid-transformed E. coli ET12567 competent cells were plated on solid medium containing apramycin. Exconjugates were visible after 3–7 days. Lower row: Exconjugates single clones were sub-cultured for continuous three times on ISP2 solid medium without antibiotics to obtain knockout strain. (B) Exconjugants were plated on solid medium with or without apramycin to make the double-crossover clones visualized. Possible asm25 knockout strains were indicated by the red circles, which were further confirmed by PCR analysis. (PDF) Click here for additional data file.

Sequencing of asm25 gene in the A. pretiosum ssp. auranticum ATCC 31565 asm25 knockout strain.

(A) Alignment between sequencing result (from asm25-seq-R) and AF453501 (Actinosynnema pretiosum subsp. auranticum maytansinoid antitumor agent ansamitocin biosynthetic gene cluster I, partial sequence, 82746 bp). A fragment of 885 bp was depleted from asm25 gene (885 bp of 1209 bp). (B, C) Alignment in detail by zooming in A. (PDF) Click here for additional data file.

HPLC spectrum of the fermentation products of ansamitocins.

Red arrows showed AP-3, Blue arrows showed AP-2 and AP-4. (PDF) Click here for additional data file. 12 Jan 2022
PONE-D-21-32320
Increased Yield of AP-3 by Knockout of asm25 in Actinosynnema pretiosum ssp.auranticum ATCC31565
PLOS ONE Dear Dr. Chen, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Your manuscript was reviewed by an expert. They think that it will not be accepted without a major revision(s). Please revise it according to their suggestions. In addition, please also find my suggestions in the “Comments to Author” section. Please submit your revised manuscript by Feb 26 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Hodaka Fujii, M.D., Ph.D. Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. Additional Editor Comments (if provided): 1. Professional English language editing must be done as the reviewer suggested. 2. Line 161: Section 2.3 is missing. 3. Line 164 & 173: “Data not shown” is not acceptable. Please provide data in the main body or as Supplementary data. 4. Fig. 6: Student’s t-test cannot be used for comparison of three or more data sets. ANOVA must be used. Labeling of (A) WT and (B) mutant in the figure will make it more understandable. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: No ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: No ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: 1. In-depth experimental design and result analysis should be performed. It’s suggested the quantitative research of substrate consumption and by-products accumulation in the competent pathway(s) be provided, and the productivity be compared with previous research. 2. The gene sequencing results should be given to show the details of indels to prove the effectiveness of the CRISPR/Cas system. 3. The paragraph describing the plasmid/strain construction is best to precede other parts in the section of results. 4. The section of Materials and Methods should be given concisely and accurately, and some obvious errors must be corrected. For example, the concentration of antibiotics used for procaryotic cells usually ranks around mg/L, not g/L. 5. The writing is not acceptable for publication at present for a bundle of problems with sentence structure, verb tense, and clause construction (…Hence, 243 manipulation the genes related to AP-3 biosynthesis by the novel synthetic biology technology is 244 proven a feasible way to obtained high AP-3-yield strains…). It’s strongly suggested the authors have the work reviewed by a proper translation/reviewing service before submission. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 11 Feb 2022 Dear editor, We thank you for giving us opportunity to revise this paper. We carefully read the view letter and have made our best effort to perform paper revision. We also thank you and reviewer for finishing reading our manuscript with good patience. We are answering the questions as followed: Reviewer #1: 1. In-depth experimental design and result analysis should be performed. It’s suggested the quantitative research of substrate consumption and by-products accumulation in the competent pathway(s) be provided, and the productivity be compared with previous research. Answer: We thank reviewer for this suggestion. To answer it, we determined the yield of AP-2 and AP-4, two byproducts, in the asm25 knockout strain, and compared their yield with that of the WT strain. Results were described in the discussion section. Next, we have gotten some AGP-3 standards from other labs and tried quantification experiments. Unfortunately, these standards were not qualified for perform HPLC analysis, and there is no commercial AGP-3 available. Thus, the determination of AGP-3 accumulation might be carried out in the further investigation. Last, we compared the effects of asm25 inactivation in our study and other strategies from previous research, on the productivity of AP-3, and discussed this issue in the discussion section. 2. The gene sequencing results should be given to show the details of indels to prove the effectiveness of the CRISPR/Cas system. Answer: We thank reviewer for this suggestion. Gene sequencing results of asm25 knockout strain has been shown in Fig. S4. 3. The paragraph describing the plasmid/strain construction is best to precede other parts in the section of results. Answer: We thank reviewer for the suggestion. We rewrote some parts in the Materials and Methods and Results sections, to make the description of the construction more clear. In this version, the construction of the plasmid was described in the Materials and Methods section and summarized in Fig. S1, while the generation of asm25 knockout strain was described in the Results section. Screening for the exconjugants was shown in Fig. S3. Sequencing for the asm25 knockout strain was shown in Fig. S4. Consistently, the panels involved in previous Fig. 3 and Fig. 4 were combined and constituted new Fig. 3. 4. The section of Materials and Methods should be given concisely and accurately, and some obvious errors must be corrected. For example, the concentration of antibiotics used for procaryotic cells usually ranks around mg/L, not g/L. Answer: We sincerely thank the reviewer for this suggestion. We have rewritten the whole section of Materials and Methods to make it easier to understand, and corrected all obvious errors. 5. The writing is not acceptable for publication at present for a bundle of problems with sentence structure, verb tense, and clause construction (…Hence, 243 manipulation the genes related to AP-3 biosynthesis by the novel synthetic biology technology is 244 proven a feasible way to obtained high AP-3-yield strains…). It’s strongly suggested the authors have the work reviewed by a proper translation/reviewing service before submission Answer: We feel sorry for the unprofessional English writing. A language editing has been done by the Springer Nature Service to make it read more fluently. Additional comments from editor: 1. Professional English language editing must be done as the reviewer suggested. Answer: We feel sorry for that. A language editing has been done by the Springer Nature Service to make it read more fluently. 2. Line 161: Section 2.3 is missing. Answer: We have made the correction by renumber the section. 3. Line 164 & 173: “Data not shown” is not acceptable. Please provide data in the main body or as Supplementary data. Answer: We thank editor for this suggestion. The identification of AP-3 (Line 164) was described in the first graph in the Results section, and the results of MS analysis were shown in Fig. S2. The sequencing results of the asm25 knockout strain were shown in Fig. S4. 4. Fig. 6: Student’s t-test cannot be used for comparison of three or more data sets. ANOVA must be used. Labeling of (A) WT and (B) mutant in the figure will make it more understandable. We appreciated that editor gave such a good suggestion. ANOVA has been used to reanalyze the data from six different groups in isobutanol experiments. Annotations have been added to Fig. 5 to indicate the WT and asm25 knockout strain, respectively. Submitted filename: rebuttal letter.docx Click here for additional data file. 3 Mar 2022 Increased Yield of AP-3 by Inactivation of asm25 in Actinosynnema pretiosum ssp. auranticum ATCC31565 PONE-D-21-32320R1 Dear Dr. Chen, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Hodaka Fujii, M.D., Ph.D. Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 10 Mar 2022 PONE-D-21-32320R1 Increased Yield of AP-3 by Inactivation of asm25 in Actinosynnema pretiosum ssp. auranticum ATCC31565 Dear Dr. Chen: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Hodaka Fujii Academic Editor PLOS ONE
  29 in total

Review 1.  Bacterial conjugation: a two-step mechanism for DNA transport.

Authors:  Matxalen Llosa; F Xavier Gomis-Rüth; Miquel Coll; Fernando de la Cruz Fd
Journal:  Mol Microbiol       Date:  2002-07       Impact factor: 3.501

2.  New amide N-glycosides of ansamitocins identified from Actinosynnema pretiosum.

Authors:  Juan Ma; Pei-Ji Zhao; Yue-Mao Shen
Journal:  Arch Pharm Res       Date:  2007-06       Impact factor: 4.946

3.  Complete Genome Sequence of Actinosynnema pretiosum X47, An Industrial Strain that Produces the Antibiotic Ansamitocin AP-3.

Authors:  Chuanqing Zhong; Gongli Zong; Shulan Qian; Meng Liu; Jiafang Fu; Peipei Zhang; Jun Li; Guangxiang Cao
Journal:  Curr Microbiol       Date:  2018-06-01       Impact factor: 2.188

4.  The maytansinoids. Isolation, structural elucidation, and chemical interrelation of novel ansa macrolides.

Authors:  S M Kupchan; Y Komoda; A R Branfman; A T Sneden; W A Court; G J Thomas; H P Hintz; R M Smith; A Karim; G A Howie; A K Verma; Y Nagao; R G Dailey; V A Zimmerly; W C Sumner
Journal:  J Org Chem       Date:  1977-07-08       Impact factor: 4.354

5.  Combination of traditional mutation and metabolic engineering to enhance ansamitocin P-3 production in Actinosynnema pretiosum.

Authors:  Zhi-Qiang Du; Yuan Zhang; Zhi-Gang Qian; Han Xiao; Jian-Jiang Zhong
Journal:  Biotechnol Bioeng       Date:  2017-08-23       Impact factor: 4.530

Review 6.  Antibody-Drug Conjugates: A Comprehensive Review.

Authors:  Puregmaa Khongorzul; Cai Jia Ling; Farhan Ullah Khan; Awais Ullah Ihsan; Juan Zhang
Journal:  Mol Cancer Res       Date:  2019-10-28       Impact factor: 5.852

7.  Enhanced production of ansamitocin P-3 by addition of isobutanol in fermentation of Actinosynnema pretiosum.

Authors:  Jinxia Lin; Linquan Bai; Zixin Deng; Jian-Jiang Zhong
Journal:  Bioresour Technol       Date:  2010-10-25       Impact factor: 9.642

Review 8.  Recent developments in the maytansinoid antitumor agents.

Authors:  John M Cassady; Kenneth K Chan; Heinz G Floss; Eckhard Leistner
Journal:  Chem Pharm Bull (Tokyo)       Date:  2004-01       Impact factor: 1.645

9.  The biosynthetic gene cluster of the maytansinoid antitumor agent ansamitocin from Actinosynnema pretiosum.

Authors:  Tin-Wein Yu; Linquan Bai; Dorothee Clade; Dietmar Hoffmann; Sabine Toelzer; Khue Q Trinh; Jun Xu; Steven J Moss; Eckhard Leistner; Heinz G Floss
Journal:  Proc Natl Acad Sci U S A       Date:  2002-06-11       Impact factor: 11.205

10.  Ansamitocin P3 depolymerizes microtubules and induces apoptosis by binding to tubulin at the vinblastine site.

Authors:  Jubina B Venghateri; Tilak Kumar Gupta; Paul J Verma; Ambarish Kunwar; Dulal Panda
Journal:  PLoS One       Date:  2013-10-04       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.