| Literature DB >> 35309990 |
Maik Friedrich1,2, Gabriele Pfeifer1, Stefanie Binder1, Achim Aigner3, Philippe Vollmer Barbosa4, Gustavo R Makert2, Jasmin Fertey2, Sebastian Ulbert2, Jochen Bodem5, Eva-Maria König5, Nina Geiger5, Axel Schambach4,6,7, Erik Schilling1, Tilo Buschmann1, Sunna Hauschildt8, Ulrike Koehl1,2,6,9, Katherina Sewald10.
Abstract
In 2019, the novel highly infectious severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) outbreak rapidly led to a global pandemic with more than 346 million confirmed cases worldwide, resulting in 5.5 million associated deaths (January 2022). Entry of all SARS-CoV-2 variants is mediated by the cellular angisin-converting enzyme 2 (ACE2). The virus abundantly replicates in the epithelia of the upper respiratory tract. Beyond vaccines for immunization, there is an imminent need for novel treatment options in COVID-19 patients. So far, only a few drugs have found their way into the clinics, often with modest success. Specific gene silencing based on small interfering RNA (siRNA) has emerged as a promising strategy for therapeutic intervention, preventing/limiting SARS-CoV-2 entry into host cells or interfering with viral replication. Here, we pursued both strategies. We designed and screened nine siRNAs (siA1-9) targeting the viral entry receptor ACE2. SiA1, (siRNA against exon1 of ACE2 mRNA) was most efficient, with up to 90% knockdown of the ACE2 mRNA and protein for at least six days. In vitro, siA1 application was found to protect Vero E6 and Huh-7 cells from infection with SARS-CoV-2 with an up to ∼92% reduction of the viral burden indicating that the treatment targets both the endosomal and the viral entry at the cytoplasmic membrane. Since the RNA-encoded genome makes SARS-CoV-2 vulnerable to RNA interference (RNAi), we designed and analysed eight siRNAs (siV1-8) directly targeting the Orf1a/b region of the SARS-CoV-2 RNA genome, encoding for non-structural proteins (nsp). As a significant hallmark of this study, we identified siV1 (siRNA against leader protein of SARS-CoV-2), which targets the nsp1-encoding sequence (a.k.a. 'host shutoff factor') as particularly efficient. SiV1 inhibited SARS-CoV-2 replication in Vero E6 or Huh-7 cells by more than 99% or 97%, respectively. It neither led to toxic effects nor induced type I or III interferon production. Of note, sequence analyses revealed the target sequence of siV1 to be highly conserved in SARS-CoV-2 variants. Thus, our results identify the direct targeting of the viral RNA genome (ORF1a/b) by siRNAs as highly efficient and introduce siV1 as a particularly promising drug candidate for therapeutic intervention.Entities:
Keywords: ACE2; COVID-19; Nsp1; RNAi; SARS-CoV-2; coronavirus; therapeutic siRNA
Year: 2022 PMID: 35309990 PMCID: PMC8925020 DOI: 10.3389/fbioe.2022.801870
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
FIGURE 1Identification, selection, and validation of human ACE2 specific siRNAs capable to inhibit SARS-CoV-2 entry. (A) Schematic representation of the human ACE2 gene. The structure of the human ACE2 gene was determined by database analyses (https://genome-euro.ucsc.edu, reference mRNA variants: ENST00000678046.1, ENST00000679278.1, ENST00000677282.1, ENST00000427411.2, ENST00000678073.1, and ENST00000252519.8). From two regions spanning exon 1–8 and exon 10–18, nine different siRNAs (siA1-9) were selected by algorithms. Coding exons are shown as blue boxes, the 5′- and 3′-UTRs are indicated by white boxes and introns are symbolized by black lines. Putative promoters and transcription start sites are symbolized by arrows. Black boxes (numbered 1–9) mark siRNA target regions. (B) Identification of the most effective ACE-2 siRNA using a reporter gene assay. A hACE2/dTomato expressing reporter cell line (293T_hACE2_dTom) was generated by lentiviral transduction. The reporter gene’s function is visualized by a cartoon. The reporter cells were transfected with ACE2 siRNAs by lipofection and the dTomato expression was determined by flow cytometry after 72 h. Data represent the mean ± s.d. of n = 3 biological replicates. Significance: not significant (n.s.); p ≤ 0.05 (*), p ≤ 0.001 (***); Tukey post ANOVA Test with multiple comparison. (C) Validation of ACE2-siRNA knockdown efficiency using the ACE2-positive human lung epithelial cell line Calu-3. Calu-3 cells were transfected with siA1, siA3, siA7 or control siRNA by lipofection and the knockdown efficiency was determined after 48 h by RT-qPCR. Data represent the mean ± s.d. of n = 3 biological replicates. Significance: not significant (n.s.); p ≤ 0.001 (***); two-sided student-t test. (D) siA1-induced ACE2 knockdown kinetics in Calu-3 cells. To test for the duration of the siA1-mediated knockdown upon a single administration, kinetics were studied over a period of 6 days. The knockdown efficiency was determined every 24 h by RT-qPCR. The experiments were done in triplicates. (E) Confirmation of the ACE2 knockdown on the protein level. Calu-3 cells were transfected with siA1, siA3, siA7 or control siRNA by lipofection. Proteins were isolated after 72 h and subjected to western blot analysis, using ACE2-and β-Actin- (loading control) specific antibodies. The specificity of the antibody was tested by comparing protein expression of lung lysates from human ACE2-transgenic (K18-hACE2) vs. wild-type mice. Each immunoblot is a representative example out of at least two independent biological replicates. (F) siA1-mediated inhibition of SARS-CoV-2 replication in Vero E6 cells. Vero E6 cells were transfected with siA1 or control-siRNA 24 h before infection with SARS-CoV-2 (100 foci forming units). After 1 h, the supernatants were replaced with overlay medium containing 1% methylcellulose. 24 h later, cells were fixed, permeabilized and immunohistochemically stained by using an anti-SARS-CoV-2 spike protein antibody. Viral spots were automatically detected by immune spot analyzer and quantified as focus forming units (FFU). Data represent the mean ± s.d. of n = 2 biological replicates determined in n = 4 technical replicates. Significance: not significant (n.s.); two-sided unpaired-t test. (G) siA1-mediated inhibition of SARS-CoV-2 replication in Huh-7 cells. Human Huh-7 cells were transfected with siA1 or control-siRNA, 5 h prior to cell infection with SARS-CoV-2. Cell culture supernatants were harvested after 72 h and viral RNAs were isolated and quantified by RT-qPCR. None-transfected cells were used as a control. Data represent the mean ± s.d. of n = 3 biological replicates. Significance: not significant (n.s.), p ≤ 0.001 (***); two-sided student-t test.
siRNAs used for lipofection. siRNAs containing a 3’ dTdT overhang were ordered from Ambion (LIFE Technologies).
| siRNA name | Sequence 5’ - 3′ | Target region |
|---|---|---|
| siA1 | GGACAAGUUUAACCACGAA | ACE2 Exon 1 |
| siA2 | CCAAAUGUAUCCACUACAA | ACE2 Exon 2 |
| siA3 | CCAGAUAAUCCACAAGAAU | ACE2 Exon 3 |
| siA4 | GCAGCUGAGGCCAUUAUAU | ACE2 Exon 4 |
| siA5 | GCUCAUUUGCUUGGUGAUA | ACE2 Exon 6 |
| siA6 | GCAUCUCUGUUCCAUGUUU | ACE2 Exon 12 |
| siA7 | CCCUUUACCAAUUCCAGUU | ACE2 Exon 13 |
| siA8 | GCACUUUGUCAAGCAGCUA | ACE2 Exon 13 |
| siA9 | GCGAGUGGCUAAUUUGAAA | ACE2 Exon 17 |
| siV1 | GCGAAAUACCAGUGGCUUA | SARS-CoV-2 Leader Protein |
| siV2 | GCUACUAAUGGACCACUUA | SARS-CoV-2 Papain-like-Protease |
| siV3 | UCCUUCUUUAGAAACUAUACA | SARS-CoV-2 Papain-like-Protease |
| siV4 | UGGUUUCACUACUUUCUGUUU | SARS-CoV-2 Nonstructural Protein 7 |
| siV5 | UUCACUACUUUCUGUUUUGCU | SARS-CoV-2 Nonstructural Protein 7 |
| siV6 | GCGGUUCACUAUAUGUUAA | SARS-CoV-2 RNA-dependent RNA-Polymerase |
| siV7 | GCAAUUAACAGGCCACAAA | SARS-CoV-2 helicase |
| siV8 | GCGAACAAAUAGAUGGUUA | SARS-CoV-2 2′-O-Ribose methyltransferase |
qPCR primers. Primers were designed using primer3 and ordered by MWG Eurofins. Species specificity of oligos: Homo sapiens (h), Chlorocebus aethiops (c).
| Target | Primer type | Primer sequence 5’ - 3′ | Annealing temperature (°C) | Target region |
|---|---|---|---|---|
| ACE2 (h,c) | Forward | TGCTTGGTGATATGTGGGGT | 59 | Exon |
| ACE2 (h,c) | Reverse | TTTCCTGGGTCCGTTAGCAT | 59 | Exon |
| ACE2 (h) | Forward | CTGGGATGCACAGAGAATATTCA | 59 | Exon |
| ACE2 (h) | Reverse | CATTTCTTAGCAGAAAAGGTTGTGCA | 59 | Exon |
| GAPDH (h,c) | Forward | GTCAGTGGTGGACCTGACCT | 60 | Exon |
| GAPDH (h,c) | Reverse | AGGGGAGATTCAGTGTGGTG | 60 | Exon |
| U6 (h,c) | Forward | CTCGCTTCGGCAGCACA | 59 | Exon |
| U6 (h,c) | Reverse | AACGCTTCACGAATTTGCGT | 59 | Exon |
| TNFα (h) | Forward | TCAGCCTCTTCTCCTTCCTG | 60 | Exon |
| TNFα (h) | Reverse | GGCTACAGGCTTGTCACTCG | 60 | Exon |
| Il-1β (h) | Forward | GGGCCTCAAGGAAAAGAATC | 60 | Exon |
| Il-1β (h) | Reverse | TTCTGCTTGAGAGGTGCTGA | 60 | Exon |
| Il-6 (h) | Forward | GGATTCAATGAGGAGACTTGC | 60 | Exon |
| Il-6 (h) | Reverse | GTTGGGTCAGGGGTGGTTAT | 60 | Exon |
| CXCL-8 (h) | Forward | ACCACCGGAAGGAACCAT | 60 | Exon |
| CXCL-8 (h) | Reverse | TTCCTTGGGGTCCAGACA | 60 | Exon |
| IFN-β (h) | Forward | AACTTTGACATCCCTGAGGAGATTAAGCAG | 60 | Exon |
| IFN-β (h) | Reverse | GACTATGGTCCAGGCACAGTGACTGTACTC | 60 | Exon |
| GNB2L1 (h) | Forward | GAGTGTGGCCTTCTCCTCTG | 60 | Exon |
| GNB2L1 (h) | Reverse | GCTTGCAGTTAGCCA GGTTC | 60 | Exon |
Primary and secondary antibodies used for western blot detection.
| Primary antibodies | Note |
|---|---|
| anti-human/mouse/rat-ACE2 | Goat, polyclonal, 5 μg/ml in 3% milk powder in TBS-N, R&D Systems, Minneapolis, Minnesota, United States (AF933) |
| anti-beta-actin | Mouse, monoclonal, 1:1,000 in 5% BSA in TBS-N, Sigma-Aldrich, Taufkirchen, Germany (Clone AC-74) |
| Secondary antibodies | Note |
| Rabbit-anti-mouse-HRP | 1:10,000 in TBS-N, DAKO, Jena, Germany |
| Rabbit-anti-goat-HRP | 1:10,000 in TBS-N, R&D Systems, Minneapolis, Minnesota, United States (HAF017) |
FIGURE 2Identification, selection, and validation of SARS-CoV-2 Orf1a/b specific siRNAs capable of inhibiting SARS-CoV-2 replication within the host cells. (A) Selection of siRNA target and schematic representation of the SARS-CoV-2 RNA genome. Eight siRNAs (siV1-8) derived from non-structural viral proteins (nsp) encoding open reading frame 1a/b (Orf1a/b) were designed by algorithms. Orange boxes denote nsp encoding ORF1a and 1b; blue boxes the structural proteins: spike (S), envelope (E), membrane (M), and nucleocapsid (N). Grey boxes symbolize the accessory factors. Orange boxes, black numbered with 1–16 mark the nsp coding regions. siRNAs are indicated as black numbered boxes (si1-8) and the corresponding siRNA targeting regions are labeled as followed: Leader protein (Lp), Papain-like protease (PLpro), Papain-like protease (PLpro) (2x), nsp7 (2x), RNA-dependent RNA-Pol, helicase (Hel), and 2′-O-ribose methyltransferase (2′-O-Mtase). The graphic was adapted from (Romano et al., 2020). (B) Identification of siV1 as the most effective siRNA that strongly inhibits SARS-CoV-2 replication. Vero E6 cells were transfected with siV1 - siV8 or control-siRNA 24 h prior to cell infection with SARS-CoV-2 (100 foci forming units). After 1 h, the supernatants were replaced with overlay medium containing 1% methylcellulose. 24 h later, cells were fixed, permeabilized and immunohistochemically stained, using an anti-SARS-CoV-2 spike protein antibody. Viral spots were automatically detected by immune spot analyzer and quantified as focus forming units (FFU). Data represent the mean ± s.d. of n = 2 biological replicates determined in n = 4 technical replicates. Significance: not significant (n.s.), p ≤ 0.05 (*); two-sided unpaired-t test. (C) Validation of siV1-mediated inhibition of SARS-CoV-2 replication in human Huh-7 cells. Huh-7 cells were transfected with siV1 or control-siRNA. After 5h, cells were infected with SARS-CoV-2. Cell culture supernatants were harvested after 72 h and viral RNAs were isolated and quantified by RT-qPCR. Non-transfected cells were used as a control. Data represent the mean ± s.d. of n = 3 biological replicates. Significance: not significant (n.s.), p ≤ 0.001 (***); two-sided student-t test. (D) Sequence alignments of the most potent siRNA siV1 target region in SARS-CoV-2 escape mutants. In silico analysis of siRNA binding sites in the SARS-COV-2 genomes of: Wuhan-Hu-1 (wild-type; MN908947.3), SARS-CoV-2 variants: alpha (MW686007.1), beta (MW880890), gamma (LR963075.1), delta (MW994451) and omicron (OV112121) is shown. Genomic positions are numbered, the target sequence of siV1 is shown in red (framed) and matching nucleotides (consensus) are marked by asterisks. (E) The target sequences of siV1, siV6, and siV7 are strongly conserved in SARS-CoV-2 genomes. The siRNAs sequences were aligned to all SARS-CoV-2 sequences archived at the National Center for Biotechnology Information (366,993 genomes) using software Parasail software, standard Linux command line tools and self-developed Python scripts. The numbers and percentages of perfectly matching SARS-CoV-2 genomes among all genomes are shown.