| Literature DB >> 35299951 |
Guangyuan Zhou1,2, Tianfei Liu2, Yan Wang2, Hao Qu2, Dingming Shu2, Xinzheng Jia1, Chenglong Luo2.
Abstract
Hyperpigmentation of the visceral peritoneum (HVP) has been becoming one of the most challenging problems in yellow-feathered chicken production, which seriously affected chicken carcass quality traits. Detecting which genes dominantly impact pigmentation in the peritoneum tissues is of great benefit to the genetic improvement of HVP. To investigate the genetic mechanism of HVP in yellow-feathered broilers, genome-wide association studies (GWASs) were conducted in the F2 generation of a cross broiler population with 395 birds. A total of 115,706 single-nucleotide polymorphisms (SNPs) of 122,415 were retained to identify quantitative trait loci (QTL) associated to HVP in chicken. The GWAS results based on the logistic mixed model (LMM) revealed that a narrow genomic location on chromosomes 1 (49.2-51.3 Mb) was significantly associated (p ≤ 4.32 × 10-7) with HVP, which contained 23 SNP makers related to 14 functional genes (MFNG, POLDIP3, POLR2F, PICK1, PDXP, SGSM3, RANGAP1, MYH9, RPL3, GALP3, LGALS1, MICALL1, ATF4, and CYP2D6). Four highly associated (p < 10-5) haplotype blocks of 0.80 kb (two SNPs), 0.06 kb (two SNPs), 0.95 kb (two SNPs), and 0.03 kb (two SNPs) were identified with two, two, four, and four distinct haplotypes, respectively. As a melanoma-associated gene, CYP2D6 were also possibly involved in the development of HVP occurring in chicken with two significant variations (rs314284996 and rs317955795) in the promoter regions. Further tests revealed that the expression of CYP2D6 was obviously higher in the visceral peritoneum tissue of chicken with HVP than that in the normal group (p < 0.05). Our results provide a novel clue to understand the genetic mechanism of HVP generation in chicken, and the mapped QTL or candidate genes might serve for genomic selection to improve carcass quality in the yellow-feathered chicken industry.Entities:
Keywords: carcass traits; chicken; genome-wide association studies; high-throughput sequencing; hyperpigmentation
Year: 2022 PMID: 35299951 PMCID: PMC8921551 DOI: 10.3389/fgene.2022.820297
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.599
FIGURE 1Visceral peritoneum of the normal chicken (A) and HVP chicken (B).
FIGURE 2Information from SLAF-seq genotyping was used in this study. (A) SNPs’ density distribution on 28 autosomes; the SNP density based on a 1 Mbp window was estimated. (B) Average distance between SNPs was used to calculate the LD decay plot.
FIGURE 3Population structure plots demonstrated by the 395 individuals. (A) By constructing the 3D plot, the first three PCs were chosen to depict the population structure. (B) Admixture analysis. Each bar represents an individual. Different colors represent various genetic clusters, and the proportion of the color represents the likelihood of an individual being allocated to that genetic cluster. The individuals were sorted by aligning clusters using the alink function of R package pophelper. (C) Cross-validation errors across 17 ancestral genetic clusters.
FIGURE 4Manhattan plots for analyzing the results of HVP. Significant SNP loci are indicated in bold.
Significant SNPs with p ≤ 4.32 × 10−7 from GWAS.
| SNP | Chr | Position (bp) | Nearest gene | Distance (Kb) |
|
|---|---|---|---|---|---|
| rs736467172 | 1 | 51282572 | MFNG | D5.96 | 2.71E-10 |
| rs741188868 | 1 | 51282630 | MFNG | D6.02 | 2.71E-10 |
| rs737774287 | 1 | 51070638 | POLR2F | within | 5.23E-10 |
| rs1058585183 | 1 | 51021678 | PICK1 | within | 1.51E-09 |
| rs734622509 | 1 | 51176674 | PDXP | U5.02 | 2.94E-09 |
| rs314284996 | 1 | 49407107 | CYP2D6 | U1.29 | 4.03E-09 |
| rs317933544 | 1 | 49182509 | POLDIP3 | U0.96 | 4.02E-08 |
| rs317955795 | 1 | 49407909 | CYP2D6 | U0.49 within U0.79 | 7.12E-08 |
| rs734376222 | 1 | 50080245 | SGSM3 | U0.70 | 7.92E-08 |
| rs317439499 | 1 | 49733538 |
| D20.40 | 8.64E-08 |
| rs732579815 | 1 | 49733625 |
| U11.25 within within D20.38 | 9.38E-08 |
| rs735088380 | 1 | 51840959 |
| U6.81 | 1.14E-07 |
| rs80653259 | 1 | 50708200 | RPL3 | U1.69 within within within U2.10 within | 1.27E-07 |
| rs737034753 | 1 | 51117437 | GALP3 | 1.28E-07 | |
| rs732895613 | 1 | 51067727 | POLR2F | 2.29E-07 | |
| rs317658316 | 1 | 51840929 |
| 2.42E-07 | |
| rs740218724 | 1 | 51159699 | LGALS1 | 2.47E-07 | |
| rs317243218 | 1 | 51253923 | MFNG | 2.60E-07 | |
| rs313652047 | 1 | 51067889 | POLR2F | 2.62E-07 | |
| rs736902992 | 1 | 51092656 | MICALL1 | 2.81E-07 | |
| rs13652709 | 1 | 51067809 | POLR2F | 3.13E-07 | |
| rs736693927 | 1 | 50597253 | ATF4 | 3.44E-07 | |
| rs13866298 | 1 | 51816134 | MYH9 | 3.46E-07 |
Genes in bold italics have been detected in the previous study by Luo et al. (2013).
U means that the SNP is in the upstream of the gene, and D means that the SNP is in the downstream of the gene.
FIGURE 5Quantile–quantile plots of the logistic mixed model (LMM) analyzed for HVP traits in China yellow chickens.
Significant SNPs in the LD Block.
| LD block | Size (Kb) | SNP | Location | Nearest gene | Distance (Kb) |
|---|---|---|---|---|---|
| Block1 | 0.80 | rs314284996 | 49407107 | CYP2D6 | U1.32 |
| rs317955795 | 49407909 | CYP2D6 | U0.52 | ||
| Block2 | 0.09 | rs317439499 | 49733538 | RANGAP1 | U0.79 |
| rs732579815 | 49733625 | RANGAP1 | U0.70 | ||
| Block3 | 0.06 | rs736467172 | 51282572 | MFNG | D16.06 |
| rs741188868 | 51282630 | MFNG | D16.12 | ||
| Block4 | 0.03 | rs317658316 | 51840929 | MYH9 | D20.38 |
| rs735088380 | 51840959 | MYH9 | D20.40 |
U means that the SNP is in the upstream of the gene, and D means that the SNP is in the downstream of the gene.
FIGURE 6Linkage disequilibrium analysis of significant SNPs. Values in boxes are LD (r 2) between SNP pairs. The absence of the r 2 value within the boxes means r 2 = 1, complete linkage disequilibrium (LD). The LD color display is based on the D′/LOD score ratio.
Results of haplotype association analysis.
| Block | Haplotype | Haplotype frequency | Haplotype score |
| Global |
|---|---|---|---|---|---|
| Block1 | AG | 0.62405 | −7.36153 | ≤10−5 | ≤10−5 |
| GT | 0.37595 | 7.36153 | ≤10−5 | ||
| Block2 | AT | 0.51013 | −5.54528 | ≤10−5 | ≤10−5 |
| GC | 0.48861 | 5.54528 | ≤10−5 | ||
| Block3 | TG | 0.76177 | −6.31563 | ≤10−5 | ≤10−5 |
| TA | 0.01797 | −0.74768 | 0.45466 | ||
| CG | 0.01291 | 1.31051 | 0.19002 | ||
| CA | 0.20734 | 6.59693 | ≤10−5 | ||
| Block4 | CT | 0.7277 | −6.03254 | ≤10−5 | ≤10−5 |
| CC | 0.01028 | 0.09231 | 0.92645 | ||
| TT | 0.13559 | 0.9448 | 0.34476 | ||
| TC | 0.12643 | 7.09266 | ≤10−5 |
Global p-value: p-value of score.global based on Chi-square distribution, with degrees of freedom equal to df.
Primer sequences for qRT-PCR.
| Gene | Forward primer 5->3′ | Reverse primer 5->3′ |
|---|---|---|
|
| AACTGTGAAGGAAGCCCTGG | CTTGCCAAAACAAGCCCTTCA |
|
| GGGAACCTGACTCTTGGGGA | ACCACATGGTCACCCATTCTC |
|
| GCTGATTAGACAAGTGCGGG | AGTTTGCGGACGTGCTTGAT |
|
| AGTCGGAGCTCAAGAGGTGT | AAAGGCGTTGTCACTCAGGT |
|
| GGTGAAAGTCGGAGTCAACGG | TCGATGAAGGGATCATTGATGGC |
FIGURE 7Expression of chickens CYP2D6, MYH9, RANGAP1, and MFNG; * indicates significant differences at p < 0.05.