Sonoko Matsumoto1, Kenta Watanabe1,2, Hiroko Kiyota2, Masato Tachibana3, Takashi Shimizu1,2, Masahisa Watarai1,2. 1. Joint Graduate School of Veterinary Medicine, Yamaguchi University, Yamaguchi, Japan. 2. Joint Faculty of Veterinary Medicine, Laboratory of Veterinary Public Health, Yamaguchi University, Yamaguchi, Japan. 3. Joint Faculty of Veterinary Medicine, National BioResource Project Paramecium, Yamaguchi University, Yamaguchi, Japan.
Abstract
Paramecium is employed as a valuable model organism in various research fields since a large number of strains with different characteristics of size, morphology, degree of aging, and type of conjugation can be obtained. It is necessary to determine a method for the classification and simple identification of strains to increase their utility as a research tool. This study attempted to establish a polymerase chain reaction (PCR)-based method to differentiate strains of the same species. Genomic DNA was purified from several strains of P. caudatum, P. tetraurelia, and P. bursaria used for comparison by the random amplified polymorphic DNA (RAPD)-PCR method. In P. tetraurelia and P. bursaria, it was sufficiently possible to distinguish specific strains depending on the pattern of random primers and amplification characteristics. For the classification of P. caudatum, based on the sequence data obtained by RAPD-PCR analysis, 5 specific primer sets were designed and a multiplex PCR method was developed. The comparative analysis of 2 standard strains, 12 recommended strains, and 12 other strains of P. caudatum provided by the National BioResource Project was conducted, and specific strains were identified. This multiplex PCR method would be an effective tool for the simple identification of environmental isolates or the management of Paramecium strains.
Paramecium is employed as a valuable model organism in various research fields since a large number of strains with different characteristics of size, morphology, degree of aging, and type of conjugation can be obtained. It is necessary to determine a method for the classification and simple identification of strains to increase their utility as a research tool. This study attempted to establish a polymerase chain reaction (PCR)-based method to differentiate strains of the same species. Genomic DNA was purified from several strains of P. caudatum, P. tetraurelia, and P. bursaria used for comparison by the random amplified polymorphic DNA (RAPD)-PCR method. In P. tetraurelia and P. bursaria, it was sufficiently possible to distinguish specific strains depending on the pattern of random primers and amplification characteristics. For the classification of P. caudatum, based on the sequence data obtained by RAPD-PCR analysis, 5 specific primer sets were designed and a multiplex PCR method was developed. The comparative analysis of 2 standard strains, 12 recommended strains, and 12 other strains of P. caudatum provided by the National BioResource Project was conducted, and specific strains were identified. This multiplex PCR method would be an effective tool for the simple identification of environmental isolates or the management of Paramecium strains.
Paramecium is a single-cell free-living eukaryote who lives in freshwaters worldwide, such as ponds and lakes [1]. The artificially cultivation is also easy, and it is considered a model organism for many aspects of eukaryotic biology [2,3]. For example, its high motility is useful in cell biology as a model for studying cell motility [4,5], and its unique and complex reproduction process, including genome duplication and rearrangement, is directly related to its utilization value as a model for sexual reproduction or inheritance analysis [6,7]. Paramecium is also a potential host that tolerates the intracellular symbiosis of different organisms [8]. Holospora spp., gram-negative α-proteobacteria, are well known to be maintained within Paramecium nuclei as an obligate symbiont [8,9]. Paramecium bursaria, which establishes an intracellular symbiotic relationship with green alga Chlorella, is widely studied as a suitable model system to elucidate secondary symbiosis [10-12]. Paramecium is also employed as a protist host model for environmental bacteria, including pathogenic bacteria, and has been reported for its symbiotic mechanism [13-15].Erstwhile, the classification of Paramecium spp. was based on morphological observations, but nowadays, with the development of genetic techniques, the classification based on genomic information, such as 18S rRNA, internal transcribed spacer (ITS), and mitochondrial cytochrome oxidase subunit 1 genes are widely used, as practiced in other species [16-18]. 18S rRNA is widely studied as it is a multicopy gene in many species, including Paramecium, making it easy to detect. Compared to 18S rRNA, the ITS region has higher interspecies polymorphism even among closely related species, increasing specificity in detection [19]. The ITS region is useful as an identification marker sequence that can distinguish closely related species [20]. However, it may be insufficient to distinguish between genetically related strains of the same species or classify new environmental isolates since genomic information registered in public databases is limited compared to the total number of Paramecium strains that have been identified. Besides, one of the unique phenotypes of Paramecium is the presence of syngens. The conjugation of Paramecium only occurs among the same syngens, and in some cases are recognized as a cryptic species. However, genes involved in the determination of syngen, whether or not they are present, have not yet been identified, nor has a method for genetically identifying them been established.Random amplified polymorphic DNA (RAPD) analysis is one of the classical molecular biological methods to assess genetic diversity by analyzing the homology or polymorphism of DNA sequence [21-23]. The major advantage of RAPD method is that the achievements of identification or discrimination are obtained quickly and easily without previous details about the genomic DNA of the organism. Due to these advantages, this analysis has been applied to the identification or comparative analysis of Paramecium strains [24,25]. We have also previously applied this RAPD method to distinguish between several strains of Paramecium or determine if there are specific patterns among strains with a common syngen [26]. To briefly distinguish Paramecium spp. whose genomic information of each strain is poor and morphological distinction is difficult, the RAPD method is a suitable approach. However, the RAPD method also has a disadvantage: the results may vary greatly depending on the polymerase chain reaction (PCR) conditions and the quality of the sample genome. In other words, there is a gap in reproducibility. It was confirmed that a small amount of genome of other organisms (e.g., symbionts of Paramecium or bacteria fed as a feed of Paramecium remaining in the culture medium) contaminating the purified Paramecium genome could affect the results [26]. In addition, since Chlorella, the symbiont in P. bursaria, is a eukaryote as well as the host Paramecium, it is necessary to consider the possibility that its presence or contamination of the genome could affect the results more than bacteria.This study searched for gene regions that can discriminate between strains of the same species of Paramecium based on the results obtained by the RAPD method and investigated the establishment of a convenient method to distinguish between strains. Several strains of various Paramecium spp. from the National BioResource Project (NBRP) were used, and a novel PCR tool was applied for strains identification.
Materials and methods
Paramecium strains
All strains of Paramecium caudatum, P. tetraurelia, and P. bursaria were obtained from the Symbiosis Laboratory, Yamaguchi University, supported by the NBRP (http://nbrpcms.nig.ac.jp/paramecium/?lang=en). All strains used in this study are listed in Table 1.
Table 1
List of Paramecium strains used in this study.
Species
No.
Strain Name
NBRP ID
Syngen
Mating Type
note
P. caudatum
1
dYDRM-3E
PC032039A
3
E
recommended strain
2
dYDRM-3O
PC031040A
3
O
recommended strain
3
G3-402
PC031044A
3
O
recommended strain
4
dOW-4E
PC042005A
4
E
recommended strain
5
dOW-4O
PC041006A
4
O
recommended strain
6
dCRT-5E
PC052001A
5
E
recommended strain
7
dCRT-5O
PC051002A
5
O
recommended strain
8
YDRM-6E
PC062131A
6
E
recommended strain
9
YDRM-6O
PC061132A
6
O
recommended strain
10
SBK2019-12E
PC122022A
12
E
recommended strain
11
SBK2019-12O
PC121226A
12
O
recommended strain
12
My43C3d
PC121015B
12
O
recommended strain, [27]
13
dKNZ-12E
PC122029A
12
E
standard strain
14
dKNZ-12O
PC121031A
12
O
standard strain
15
Myn92
PC012002A
1
E
16
BAT-CIA3
PC012001A
1
E
17
Ai102
PC011016A
1
O
18
Mmn64
PC011011A
1
O
19
YR1504-2
PC062012A
2
E
20
YDRM20
PC032036A
3
E
21
YDRM46
PC032037A
3
E
22
TAZ0462
PC032004A
3
E
23
RB-1
PC042001A
4
E
24
YR1504-6
PC061016A
6
O
25
YDRM28
PC062134A
6
O
26
SBK2019-3b1
PC122105A
12
E
P. tetraurelia
1
st110-1a
PA041001A
-
O
recommended strain
2
st110-1b
PA042002A
-
E
recommended strain
3
rie-1
PA042018A
-
E
recommended strain
4
rie-2
PA041019A
-
O
recommended strain
5
SSZ1
PA042017A
-
E
recommended strain
6
KMA21
PA041022A
-
O
recommended strain
7
ds4-2 (VIII)
PA042004A
-
E
standard strain
8
ds4-2 (VII)
PA041003A
-
O
standard strain
9
51
PA040011A
-
E
standard strain
P. bursaria
1
YKK10g
PB031015A
B1 or R3
I
recommended strain
2
YKK10w
PB031016A
B1 or R3
I
recommended strain
3
Dd1g
PB032001A
B1 or R3
II
recommended strain
4
KM2g
PB031002A
B1 or R3
II
recommended strain
5
YDS1g
PB032031A
B1 or R3
II
recommended strain
6
YDS1w
PB032061A
B1 or R3
II
recommended strain
7
YKK3g
PB033046A
B1 or R3
III
recommended strain
8
YKK3w
PB033049A
B1 or R3
III
recommended strain
9
HA1g
PB034004A
B1 or R3
IV
recommended strain
10
HA1w
PB034007A
B1 or R3
IV
recommended strain
11
Yad1g1N
PB031010B
B1 or R3
I
standard strain, [11]
Isolation of genomic DNA from Paramecium
Genomic DNA was isolated from 15 mL Paramecium cells culture (including ~10,000 cells) using a DNA extraction kit (Qiagen, Venlo, The Netherlands) according to the manufacturer’s instructions. Cells were washed with phosphate-buffered saline twice to remove extracellular bacteria before the DNA extraction by the kit. The DNA concentration in each sample was measured by Nanodrop-ND 2000 (Thermo Scientific, USA) for qualitative and quantitative analyses. The DNA samples were frozen at −30°C until use.
RAPD analysis
RAPD analysis was performed as described previously [26] with some modifications. In brief, RAPD-PCR was carried out in a 10 μL reaction mixture consisting of 5 μL PCR master mix (Tks Gflex DNA Polymerase; Takara Bio, Shiga, Japan), 1 μL primer (10 μM), 1 μL template DNA (adjusted to 10 ng/μL), and 3 μL nuclease-free water. The PCR program consisted of the first 4 cycles at a denaturation temperature of 94°C for 5 min, followed by annealing of the primer at 35°C for 5 min and final elongation at 72°C for 2 min. The subsequent 36 cycles consisted of denaturation at 94°C for 1 min, primer annealing at 40°C for 1 min, and elongation at 72°C for 2 min. A last elongation step was extended to 5 min at 72°C. The fragments were separated by electrophoresing at 100 V for 30 min on 2% agarose gel. The gels were stained with ethidium bromide and visualized using the gel imaging system (ATTO, Tokyo, Japan). All RAPD-PCR analyses were repeated at least thrice to confirm the reproducibility of the band patterns. The primers used in this RAPD analysis are listed in Table 2.
Table 2
Primers used in this study.
Primer name
Sequence (5’-3’)
Expected size of the PCR product (bp)
References
02
GCAGGATACG
-
[24,28]
03
CTGCGATACC
-
04
GCAGAGAAGG
-
05
CTAGCTCTGG
-
09
CGCTGTTACC
-
Pc_1 F
GGATATATGTACATGTGAAT
1487
This study
Pc_1 R
ATAAAACAGTTGATGTTTGG
This study
Pc_2 F
TAGCTCTGGACAGAATAGTG
1078
This study
Pc_2 R
TAGCTCTGGGATAAAGGAAA
This study
Pc_3 F
GCAGGATACGGCAATGTAAA
689
This study
Pc_3 R
GCAGGATACGTATCAACACA
This study
Pc_4 F
GCAGAGAAGGGTAATACTTC
554
This study
Pc_4 R
GCAGAGAAGGATGTAAGAGC
This study
Pc_5 F
GCTGTTACCAATTAGACATC
503
This study
Pc_5 R
CGCTGTTACCAAGTATGAAG
This study
18S F
GATGGTAGTGTATTGGAC
618
[29]
18S R
TTGGCAAATGCTTTCGC
DNA sequencing
After electrophoresis on a 2% agarose gel, RAPD-PCR products (several single bands that differed in size and presence or absence depending on the strain) were extracted using the QIAEx II Gel Extraction Kit (Qiagen) according to the manufacturer’s instructions and used as template DNA. PCR was performed using KOD-Plus-Neo polymerase (Toyobo, Osaka, Japan) with primers designed for cloning the PCR products into EcoRI cleaved pCold TF DNA vector (Takara Bio). Cloning was performed using an In-Fusion HD Cloning Kit (Takara Bio). The inserted DNA was amplified by pCold-F1 and pCold-R primers. These PCR products were purified and submitted to sequencing analysis using an ABI 3130 Genetic Analyzer (Applied Biosystems, Foster City, CA) with the Big Dye Terminator version 3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA).
Conventional and multiplex PCR for distinguishing P. caudatum strains
Conventional PCR was carried out using KOD-Plus-Neo polymerase. The reaction conditions were 2 min at 94°C, followed by 30 cycles of 10 s denaturation at 94°C, 30 s annealing at 60°C, 30 s extension at 68°C, and 7 min final extension at 68°C. The fragments were separated by electrophoresing at 100 V for 30 min on 1% agarose gel. Multiplex PCR was carried out using the Multiplex PCR Assay Kit version 2 (Takara Bio). The reaction conditions were 1 min at 94°C, followed by 30 cycles of 30 s denaturation at 94°C, 45 s annealing at 57°C, 45 s extension at 72°C, and 10 min final extension at 72°C. The fragments were separated by electrophoresing at 100 V for 30 min on 3% agarose gel. Gel staining and visualization were carried out as described above. Based on the sequence information (S1 File), specific primers were designed to identify P. caudatum strains. 18S rRNA was used as a control gene to check the quality of the template DNA. The primers used in this assay are also listed in Table 2.
Results
Comparative analysis of P. caudatum, P. tetraurelia, and P. bursaria using the RAPD method
The NBRP designate 6 strains of P. caudatum, P. bursaria, and P. tetraurelia as standard strains and the other 53 strains of the 24 species as recommended strains. Therefore, we first decided to conduct a comparative study using these designated strains. After the comparative study using these designated strains and ten random primer sets from a previous study [24,26,28], differences in band patterns were found between strains using only the random primer-02, -03, and -05 (Figs 1–3). In particular, results using primer-05 for P. caudatum (Fig 1C), primer-02 for P. tetraurelia (Fig 2A), and primer-03 for P. bursaria (Fig 3B) showed different patterns for each strain and were most effective in roughly identifying strains. Especially, No. 9 (51), one of the standard strains of P. tetraurelia, and No. 11 (Yad1g1N), a standard strain of P. bursaria, showed different numbers and patterns of bands compared to other strains (Figs 2 and 3). In contrast, some strains of P. caudatum showed quite similar band patterns among the recommended and standard strains. It was slightly more difficult to distinguish recommended and standard strains of P. caudatum by the RAPD method alone than P. tetraurelia and P. bursaria. The RAPD method did not reveal any specific band patterns that could distinguish between syngens and mating types in P. caudatum. In addition, P. bursaria showed similar band patterns in strains with Chlorella (Nos. 1, 3, 4, 5, 7, 9, and 11) and without Chlorella (Nos. 2, 6, 8, and 10). No distinct bands specific to strains with Chlorella were observed in any results. As expected, the same parental strain of P. bursaria with and without Chlorella, symbiotic green alga, showed very similar band patterns, for example, No.7 (YKK3g) and No.8 (YKK3w), or No.9 (HA1g) and No.10 (HA1w). However, there were cases where the band pattern was similar, although the strains were different, as in No. 3 (Dd1g) and No. 4 (KM2g).
Fig 1
RAPD analysis using template DNA from P. caudatum strains.
RAPD analysis using template DNA from 12 recommended strains (Nos. 1–12) and 2 standard strains (Nos. 13 and 14) of P. caudatum. The random primers used in each reaction are presented at the top of the figures (A, primer-02. B, primer-03. C, primer-05). M, weight marker.
Fig 3
RAPD analysis using template DNA from P. bursaria strains.
RAPD analysis using template DNA from 10 recommended strains (Nos. 1–10) and a standard strain (No. 11) of P. bursaria. G, strain with Chlorella. W, strain without Chlorella. The random primers used in each reaction are presented at the top of the figures (A, primer-02. B, primer-03. C, primer-05). M, weight marker.
Fig 2
RAPD analysis using template DNA from P. tetraurelia strains.
RAPD analysis using template DNA from 6 recommended strains (Nos. 1–6) and 3 standard strains (Nos. 7–9) of P. tetraurelia. The random primers used in each reaction are presented at the top of the figures (A, primer-02. B, primer-03. C, primer-05). M, weight marker.
RAPD analysis using template DNA from P. caudatum strains.
RAPD analysis using template DNA from 12 recommended strains (Nos. 1–12) and 2 standard strains (Nos. 13 and 14) of P. caudatum. The random primers used in each reaction are presented at the top of the figures (A, primer-02. B, primer-03. C, primer-05). M, weight marker.
RAPD analysis using template DNA from P. tetraurelia strains.
RAPD analysis using template DNA from 6 recommended strains (Nos. 1–6) and 3 standard strains (Nos. 7–9) of P. tetraurelia. The random primers used in each reaction are presented at the top of the figures (A, primer-02. B, primer-03. C, primer-05). M, weight marker.
RAPD analysis using template DNA from P. bursaria strains.
RAPD analysis using template DNA from 10 recommended strains (Nos. 1–10) and a standard strain (No. 11) of P. bursaria. G, strain with Chlorella. W, strain without Chlorella. The random primers used in each reaction are presented at the top of the figures (A, primer-02. B, primer-03. C, primer-05). M, weight marker.
Distinguishing P. caudatum strains depending on PCR for five candidate sequences selected from RAPD-PCR results
This study attempted to develop a method for more strictly distinguishing strains in P. caudatum. First, specific primers were designed based on the sequence information (S1 File) obtained from RAPD-PCR products (Fig 4A). Next, comparative analysis was performed using these primers on 26 strains, including the standard and recommended strains used in the RAPD method described above, and another strain of P. caudatum, which is not designated as the standard or recommended strain in the NBRP. As a result, in the PCRs targeting the five regions named as Pc-1 to Pc-5, the patterns of the bands were differentiated among each strain, and it was possible to distinguish some of the strains, including the standard strain (No. 14; dKNZ-12O), by comprehensively determining the results of these five individual PCRs (Fig 4B). This study also successfully distinguished strains (e.g., Nos. 4 and 5 and Nos. 10 and 11) that were difficult to distinguish clearly since the band patterns were similar in all cases using random primers in the RAPD method.
Fig 4
Selecting the target gene region to identify strains based on the RAPD-PCR and PCR results for these target sequences.
(A) RAPD-PCR was conducted individually using template DNA from No. 12 or 13 of P. caudatum and random primer-02, 04, 05, and 09, individually. Single bands which were selected and submitted to sequencing analysis were surrounded by white boxes. (B) PCR results using template DNA from 26 strains of P. caudatum are shown. Pc_1 to Pc_5 and 18S indicate target region names. 18S, 18S rRNA gene. M, weight marker.
Selecting the target gene region to identify strains based on the RAPD-PCR and PCR results for these target sequences.
(A) RAPD-PCR was conducted individually using template DNA from No. 12 or 13 of P. caudatum and random primer-02, 04, 05, and 09, individually. Single bands which were selected and submitted to sequencing analysis were surrounded by white boxes. (B) PCR results using template DNA from 26 strains of P. caudatum are shown. Pc_1 to Pc_5 and 18S indicate target region names. 18S, 18S rRNA gene. M, weight marker.
Examination of the application to multiplex PCR
Finally, this study investigated a simple method to distinguish P. caudatum strains by multiplex PCR. Although the PCR reagents used in Fig 4 had low reproducibility of the results, as some bands did not appear, the results were very reproducible, reflecting very well the PCR results performed individually targeting Pc_1 to PC_5 in Fig 4 using multiplex PCR-specific reagents (Fig 5). A maximum of five single bands (No. 4) was obtained with the predicted size, and no smearing or nonspecific bands due to primer-dimer were observed. As a result, by conducting this multiplex PCR once, it was possible to easily distinguish between several standard and recommended strains of P. caudatum.
Fig 5
Multiplex PCR.
Multiplex PCR results using template DNA from 6 strains (Nos. 4, 5, and 11–14) of P. caudatum. M, weight marker.
Multiplex PCR.
Multiplex PCR results using template DNA from 6 strains (Nos. 4, 5, and 11–14) of P. caudatum. M, weight marker.
Discussion
Although the identification of Paramecium species has largely relied on methods based on morphological observations, this is not a completely effective method; indeed, the species are frequently changed and reclassified [30-32]. Recently, genomic information, such as 18S rRNA, ITS, and mitochondrial cytochrome oxidase subunit 1 genes has become available, and isolation and identification of Paramecium strains based on this information are being carried out [16-18]. Once the genome information of all Paramecium species is analyzed, a more appropriate method of species and strain identification will be established based on this information. Whole-genome sequencing is proceeding in several strains of Paramecium [27,33], but its utilization is still very limited considering the cost and time. In this respect, the method established in this study is useful as a simple strain identification method for studies using multiple Paramecium strains or for identifying new isolates from the environment.The RAPD method is a useful approach to identify and distinguish various species [21-23], including the identification of Paramecium strains. However, one of the disadvantages that must be considered is the reproducibility of the tests and the quality of the template DNA that may affect the results. By investigating the design of random primers and reaction conditions, it is expected to improve the outcomes. However, the suitability of the RAPD analysis for each target species is likely to be variable, since it was more difficult to detect differences in band patterns of P. caudatum (Fig 1) than in those of P. tetraurelia (Fig 2) or P. bursaria (Fig 3) in RAPD analysis performed under the same conditions. A previous study also reported the importance of considering the contamination of the fed bacterial genomes or symbiont genomes when applying this RAPD method to the analysis of Paramecium [26]. In this study, RAPD-PCR products were extracted from agarose gels to design primers specific for P. caudatum, and sequence analysis was performed (Fig 4A). Results showed that most PCR products were amplified from Paramecium DNA, including Pc_1 to Pc_5, also used in the following analysis. The results included that the PCR product was amplified from the genomic DNA of a bacteria (Enterobacter aerogenes) fed to Paramecium, but the rate was extremely low with only one sample out of 16 samples extracted from gel. Therefore, it would be reasonable to conclude that the band patterns observed in the RAPD method under the method and conditions described in this study are mainly genomic products of Paramecium.The sequences (Pc_1–Pc_5) used in the primer design for P. caudatum-specific PCR (Figs 4B and 5) were analyzed for sequence homology in the database. However, all of them corresponded to genes of unknown function and their surrounding regions in P. caudatum and did not match the sequences of genes whose specific functions were identified (S1 File). This study would reveal genes involved in phenotypic determinations, such as syngen or mating types, also important as classification factors for Paramecium strains, but no such findings were obtained. Although several reports have referred to genes involved in determining mating types of Paramecium [34-39], genetic information on syngens of Paramecium is relatively lacking. Thus, the general method of identifying syngens remains deeply dependent on mating tests. As whole-genome sequences of many Paramecium strains are developed in the future, and more information on the function of each gene is revealed, the relationship between target DNA sequences employed in this study and the diversity of the strains will be clarified, leading to the identification of novel genes that determine syngens or mating types.The multiplex PCR method used in this study was only applied to the analysis of P. caudatum. Still, it is highly possible that the method can be improved to simplify the distinction and identification of other Paramecium strains, including P. tetraurelia and P. bursaria, in a similar manner. This study did not attempt to perform the method because there were not enough strains of these two species to determine the utility compared to P. caudatum. It is important to continue to examine the utility and generality of this method by preparing more strains of Paramecium species other than P. caudatum. There may be some strains to which the present analysis method cannot be applied in such investigations. In particular, because the purified genome DNA from P. bursaria strains that maintain symbiont Chlorella will certainly be a mix of the genome of Chlorella and that of the host P. bursaria, it is necessary to consider this effect in the RAPD-PCR process. It is also important to consider the existence of endosymbiotic bacteria, such as Holospora and Legionella, when studying P. caudatum strains that maintain them [8,13]. It is necessary to ensure species specificity by combining multiplex PCR as in this method; at the same time, it is important to modify this method to the most appropriate one by changing the target sequence for each Paramecium species or strain for use.
Conclusion
Although RAPD is a simple and rapid method for strain identification, the problem of reproducibility and the effect of the presence of DNA other than that of the target organism must be considered when identifying Paramecium strains. The multiplex PCR method applying the results of the RAPD method reported in this study is considerably more reliable than the RAPD method in terms of reproducibility. Multiplex PCR is also a method that can disregard unexpected contamination of DNA from nontarget organisms. In this study, we could provide a specific method for distinguishing the standard strains of several Paramecium species (S1 Table). Future studies should examine whether there will be any discrepancies or discrimination problems when this method is applied to the identification and differentiation of more strains of Paramecium.
Result of DNA sequencing.
(PDF)Click here for additional data file.
Quick identification chart for each standard strain.
(PDF)Click here for additional data file.(PDF)Click here for additional data file.27 Jan 2022
PONE-D-21-36346
Distinction of Paramecium strains by a combination method of RAPD analysis and multiplex PCR
PLOS ONE
Dear Dr. Watarai,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Please submit your revised manuscript by Mar 13 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.We look forward to receiving your revised manuscript.Kind regards,Maria Stefania LatrofaAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. Thank you for stating the following in the Acknowledgments Section of your manuscript:“This study was supported in part by the Japan Society for the Promotion of Science Grant-in-Aid for Scientific Research (C) and (B) under grant nos. 19K06383 and 17H03914 to K.W. and M.W.”We note that you have provided funding information within the Acknowledgements Section. Please note that funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:“This study was supported in part by the Japan Society for the Promotion of Science Grant-in-Aid for Scientific Research (C) and (B) under grant nos. 19K06383 and 17H03914 to K.W. and M.W. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.”Please include your amended statements within your cover letter; we will change the online submission form on your behalf.3. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.We will update your Data Availability statement to reflect the information you provide in your cover letter.4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.5. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.Reviewers' comments:Reviewer's Responses to Questions
Comments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: PartlyReviewer #2: YesReviewer #3: Yes********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: N/AReviewer #2: YesReviewer #3: N/A********** 3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: YesReviewer #2: YesReviewer #3: No********** 4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: YesReviewer #2: YesReviewer #3: Yes********** 5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: COMMENTS TO THE AUTHORSThe manuscript ONE-D-21-36346, entitled “Distinction of Paramecium strains by a combination method of RAPD analysis and multiplex PCR” describes a method that was established as an useful strain identification using multiple Paramecium strains and to better identify isolates from the environment. Despite needing corrections, the manuscript presents interesting results which will contribute to the knowledge of the identification of Paramecium strains and the study of new species. In addition, english language should be revised. Thus, the manuscript is suitable for publication in the Plos One following major revision.AbstractLine 24: To specify which characteristics could be obtained and where they could be employed, as mentioned in the text.Line 25: Replace “stablish” by “determine”.Line 27: Delete “between” and replace “discriminate” by “differentiate”.Line 28: Delete “interstrain”.Line 30: Replace “kind” by “pattern”.Line 31: Replace “settings” by “characteristics”.Line 32: Replace “constructed” by “designed”.Line 32: To specify how many primers were designed.Line 33: Remove “Using this method”.Line 33: Replace “A comparative” by “The comparative”.IntroductionThe introduction is too general with some confusing information. Some additional informations about the Chlorella, which are mentioned in the results, are necessary to give an overview.Line 40-42: Replace “Paramecium is a single-cell, free-living eukaryote living in freshwaters, such as ponds and lakes, worldwide. It is also easy to cultivate and maintain artificially, and it is a model organism for many aspects of eukaryotic biology” by “Paramecium is a single-cell free-living eukaryote who lives in freshwaters worldwide, such as ponds and lakes. The artificially cultivation i salso easy, and it is considered a model organism for many aspects of eukaryotic biology”.Line 46: Provide examples for the different symbiosis that are found for Paramecium, or make a link between this sentence and the following one about the P. bursaria.Line 51: Replace “In the past” by “Erstwhile”.Line 54: Replace “is” by “are”.Line 55: Replace “accepted” by “studied”.Line 55: To specify how many is related to “Relatively large number”.Line 55: Replace “molecules” by “nucleic acids”.Line 62: Explain why could be insufficient to distinguish.Line 63: Explain what is a syngen.Line 63: Add “related” before “the presence”.Line 68: Remove “this”.Line 69: Replace “any information on” by “previous details about”.Line 70: Remove “target”.Line 75: Replace “the” by “a”.Line 77: Replace “weakness” by “gap”.Line 81: Delete “new”.Line 84: Replace “prepared” by “inserted”.Material and MethodsLine 96: Replace “Applying” by “the DNA extraction”Line 119: Replace “subjected” by “submitted”.ResultsThe results are too general with some missing information. Authors are suggested to go deep in the results related to the figures, once they were not very approached.Line 135: Replace “The NBRP Paramecium maintains ~1000 strains of 24 species. They designate 6 strains of P. caudatum, P. bursaria, and P. tetraurelia as standard strains and the other 53 strains of the 24 species as recommended strains” by “The NBRP designate 6 strains of P. caudatum, P. bursaria, and P. tetraurelia as standard strains and the other 53 strains of the 24 species as recommended strains for this study”.Line 138-140: Delete “Genomic DNA was purified from the standard and recommended strains of P. caudatum, P. tetraurelia, and P. bursaria obtained from the NBRP, and RAPD analysis was performed using this DNA as a template” – this is material and methods, not results.Line 140: To specify how many random primers.Line 141: Remove “characteristic”.Line 143: Identify in which figure is possible to notice the different pattern.Line 148: P. caudatum in italics.Line 149: Specify which are “these strains”.Line 150: Authors elucidate that was slightly more difficult to distinguish the strains by the RAPD method. It is suggested to rewrite this part with a better overview over the figure 1. Furthermore, there are no specifications on the figure 1 about the Chrolella as mentioned in the text.Line 153: P. bursaria with and without Chlorella are not clear neither in the text, nor in the figures. The authors are suggested to review the approach about the Chrolella. Otherwise, it may be deleted.Line 159-166: Delete, once the sentences are not results.Line 167: Delete “appearance”.Line 171: Replace “because” by “once”.Line 175: Specify which are the problems.DiscussionIn discussion, the authors are suggested to better discuss the figures regarding the importance about the results of them, and make a relation between the results found and the literature. For example, in the discussion the different patters found for each strain were not discussed, being of extreme importance. The authors are also suggested to provide an information about how many primers are needed to conclude which strain is related to the pattern found.Line 188: Add a reference considering the “and identification of Paramecium strains based on this information are being carried out”Line 190-192: Replace “Whole-genome sequencing is proceeding in several strains of Paramecium, but its utilization is still very limited. The cost, time, and simplicity of the procedure are important for the identification of strains” by “Whole-genome sequencing is proceeding in several strains of Paramecium, but its utilization is still very limited considering the cost and time.Line 195-199: Replace “The RAPD method, which was also applied in this study, is a useful approach employed for a long time to identify and distinguish various species [20-22]. There are already several studies on the identification of Paramecium strains. However, one of the disadvantages that must be considered due to the properties of this method is the reproducibility of the results and the possibility that the quality of the template DNA will greatly affect the results” by “The RAPD method is a useful approach to identify and distinguish various species [20-22], including the identification of Paramecium strains. However, one of the disadvantages that must be considered is the reproducibility of the tests and the quality of the template DNA that may affect the results”.Line 213: Add a reference in the end of the sentence.ReferencesThe references may need some editing and corrections, authors should go through all the reference list to correct minor mistakes.FiguresIn all figures, authors are suggested to put the number of each sample in all three photos of the gels to facilitate the view. Besides that, a better way to link each reference strain and suggested strain would be good to make the understanding clear. The authors are also suggested to provide a final figure that would facilitate the overview of the results, summarizing all the finds of the study.Reviewer #2: This study appears to have been conducted rigorously, and the results, particularly in terms of unique banding patterns, appear to support the authors' conclusions. However, it would be helpful for the reader if the authors delineated which banding patterns (which samples) were unique, and which parts of the patterns made a unique fingerprint in each figure for the RAPD analysis. This would help the reader determine for themselves which strains and primers would be useful for their own analyses. Also, how did the authors determine uniqueness of banding patterns? Was a program used, or was it just by eye? Having a standard rigorous method for this is key- it may have been covered in the previous paper, which was cited, but if so, it would be good to make it clear what they did for this study as well.Also, it should be spelled out what NBRP is upon first usage of this acronym.Reviewer #3: 1. The study presents the results of original research.Yes2. Results reported have not been published elsewhere.No3. Experiments, statistics, and other analyses are performed to a high technical standard and are described in sufficient detail.Experiments have been described in detail, explicitly.4. Conclusions are presented in an appropriate fashion and are supported by the data.Conclusions have been appropriately described.5. The article is presented in an intelligible fashion and is written in standard English.The article has been presented in an adequate fashion and written in standard English6. The research meets all applicable standards for the ethics of experimentation and research integrity.The research meets all ethics of experimentation.7. The article adheres to appropriate reporting guidelines and community standards for data availability.The data availability statement does not appear in the manuscript.********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: NoReviewer #2: Yes: Lydia BrightReviewer #3: Yes: ABDUL RAUF SHAKOORI[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.3 Feb 2022To Reviewer #1,Thank you for your valuable comments and suggestions. We have revised the manuscript according to these comments. Our responses to individual suggestions or questions are as follows.>Line 24: To specify which characteristics could be obtained and where they could be employed, as mentioned in the text.According to your suggestion, we have modified this sentence (line. 23-25).>Line 25: Replace “stablish” by “determine”.We have replaced the word according to your suggestion (line. 25).>Line 27: Delete “between” and replace “discriminate” by “differentiate”.We have modified the description according to your suggestion (line. 27).>Line 28: Delete “interstrain”.We have deleted the word according to your suggestion.>Line 30: Replace “kind” by “pattern”.We have replaced the word according to your suggestion (line. 31).>Line 31: Replace “settings” by “characteristics”.We have replaced the word according to your suggestion (line. 31).>Line 32: Replace “constructed” by “designed”.We have replaced the word according to your suggestion (line. 33).>Line 32: To specify how many primers were designed.We have designed 5 primer sets. We have added the description in the text (line. 32-33).>Line 33: Remove “Using this method”.We have deleted the word according to your suggestion.>Line 33: Replace “A comparative” by “The comparative”.We have replaced the word according to your suggestion (line. 34).>The introduction is too general with some confusing information. Some additional information about the Chlorella, which are mentioned in the results, are necessary to give an overview.We have modified the introduction according to your comments, including providing additional information about the Chlorella (line. 83-86). Please refer to our responses to your other specific comments or suggestions below.>Line 40-42: Replace “Paramecium is a single-cell, free-living eukaryote living in freshwaters, such as ponds and lakes, worldwide. It is also easy to cultivate and maintain artificially, and it is a model organism for many aspects of eukaryotic biology” by “Paramecium is a single-cell free-living eukaryote who lives in freshwaters worldwide, such as ponds and lakes. The artificially cultivation is also easy, and it is considered a model organism for many aspects of eukaryotic biology”.We have replaced the sentence according to your suggestion (line. 40-42).>Line 46: Provide examples for the different symbiosis that are found for Paramecium, or make a link between this sentence and the following one about the P. bursaria.We have added other example of symbiosis here (line. 46-48).>Line 51: Replace “In the past” by “Erstwhile”.We have replaced the word according to your suggestion (line. 53).>Line 54: Replace “is” by “are”.We have replaced the word according to your suggestion (line. 56).>Line 55: Replace “accepted” by “studied”.We have replaced the word according to your suggestion (line. 57).>Line 55: To specify how many is related to “Relatively large number”.This description has been removed for clarity of its meaning.>Line 55: Replace “molecules” by “nucleic acids”.This description has been removed for clarity of its meaning.>Line 62: Explain why could be insufficient to distinguish.We have modified the sentence (line. 60-63).>Line 63: Explain what is a syngen.We have added the brief explanation about syngen (line. 64-66).>Line 63: Add “related” before “the presence”.In relation to the above comment, the relevant text has been removed.>Line 68: Remove “this”.We have removed the word.>Line 69: Replace “any information on” by “previous details about”.We have replaced the word according to your suggestion (line. 72).>Line 70: Remove “target”.We have removed the word.>Line 75: Replace “the” by “a”.We have replaced the word (line. 78).>Line 77: Replace “weakness” by “gap”.We have replaced the word (line. 80).>Line 81: Delete “new”.We have removed the word.>Line 84: Replace “prepared” by “inserted”.We have replaced the word (line. 90).>Line 96: Replace “Applying” by “the DNA extraction”We have replaced the word according to your suggestion (line. 102).>Line 119: Replace “subjected” by “submitted”.We have replaced the word (line. 125).>The results are too general with some missing information. Authors are suggested to go deep in the results related to the figures, once they were not very approached.We have modified the results section according to your comments (line. 159-163 and 168-170). Please refer to our responses to your other specific comments or suggestions below.>Line 135: Replace “The NBRP Paramecium maintains ~1000 strains of 24 species. They designate 6 strains of P. caudatum, P. bursaria, and P. tetraurelia as standard strains and the other 53 strains of the 24 species as recommended strains” by “The NBRP designate 6 strains of P. caudatum, P. bursaria, and P. tetraurelia as standard strains and the other 53 strains of the 24 species as recommended strains for this study”.We have replaced the sentence (line. 144-145). The designation of standard strains and recommended strains by NBRP is not done for this study but for general user. Thus, “for this user” is not included in the revised manuscript.>Line 138-140: Delete “Genomic DNA was purified from the standard and recommended strains of P. caudatum, P. tetraurelia, and P. bursaria obtained from the NBRP, and RAPD analysis was performed using this DNA as a template” – this is material and methods, not results.We have deleted the sentence according to your suggestion.>Line 140: To specify how many random primers.We have described the number of primers used in this assay (line. 146).>Line 141: Remove “characteristic”.We have removed the word.>Line 143: Identify in which figure is possible to notice the different pattern.We have modified the description (line. 148-151). And we have added S1_Table summarizing the results.>Line 148: P. caudatum in italics.We have corrected the notation (line. 154).>Line 149: Specify which are “these strains”.We have modified the description to specify the meaning (line. 156).>Line 150: Authors elucidate that was slightly more difficult to distinguish the strains by the RAPD method. It is suggested to rewrite this part with a better overview over the figure 1. Furthermore, there are no specifications on the figure 1 about the Chrolella as mentioned in the text.We have added the description about Figure. 1 (line. 157-158).And only P. bursaria maintains Chlorella cells among Paramecium species. Therefore, we have added the description about effects of the presence or absence of Chlorella on the results in Figure 3 (line. 159-163).>Line 153: P. bursaria with and without Chlorella are not clear neither in the text, nor in the figures. The authors are suggested to review the approach about the Chrolella. Otherwise, it may be deleted.Related to the other responses, we have added several statements about Chlorella (line. 159-163).>Line 159-166: Delete, once the sentences are not results.We have deleted the sentences or moved them from results section to methods section (line. 119-120, 138-139).>Line 167: Delete “appearance”.We have removed the word.>Line 171: Replace “because” by “once”.We have rephrased this sentence (line. 175-178)>Line 175: Specify which are the problems.We have modified the description (line. 181-182).>In discussion, the authors are suggested to better discuss the figures regarding the importance about the results of them, and make a relation between the results found and the literature. For example, in the discussion the different patters found for each strain were not discussed, being of extreme importance. The authors are also suggested to provide an information about how many primers are needed to conclude which strain is related to the pattern found.According to your comments, we have revised the discussion and added some description (line. 204-208, 213-216, 254-255). We assume that it is difficult to identify Paramecium strains using a method that depends only on the RAPD analysis, and that it is important to use other approaches such as multiplex PCR used in this study in combination. We have also added supplemental table to provide an information about conclusion.>Line 188: Add a reference considering the “and identification of Paramecium strains based on this information are being carried out”We have added references here according to you suggestion (line. 194).>Line 190-192: Replace “Whole-genome sequencing is proceeding in several strains of Paramecium, but its utilization is still very limited. The cost, time, and simplicity of the procedure are important for the identification of strains” by “Whole-genome sequencing is proceeding in several strains of Paramecium, but its utilization is still very limited considering the cost and time.We have replaced the sentence (line. 196-198).>Line 195-199: Replace “The RAPD method, which was also applied in this study, is a useful approach employed for a long time to identify and distinguish various species [20-22]. There are already several studies on the identification of Paramecium strains. However, one of the disadvantages that must be considered due to the properties of this method is the reproducibility of the results and the possibility that the quality of the template DNA will greatly affect the results” by “The RAPD method is a useful approach to identify and distinguish various species [20-22], including the identification of Paramecium strains. However, one of the disadvantages that must be considered is the reproducibility of the tests and the quality of the template DNA that may affect the results”.We have replaced the sentence (line. 201-204).>Line 213: Add a reference in the end of the sentence.We have decided to add the supplemental data (S1_File) here.>The references may need some editing and corrections, authors should go through all the reference list to correct minor mistakes.We have checked the references again and editing them.>In all figures, authors are suggested to put the number of each sample in all three photos of the gels to facilitate the view. Besides that, a better way to link each reference strain and suggested strain would be good to make the understanding clear. The authors are also suggested to provide a final figure that would facilitate the overview of the results, summarizing all the finds of the study.According to your suggestion, we have modified all figures, especially the labeling of strains. And we have added a supplemental table (S1_Table) at the end of this paper to show the quick identification chart for each standard strain depending on the results of this study.To Reviewer #2,Thank you for your valuable comments and suggestions. We have revised the manuscript according to these comments. Our responses to individual suggestions or questions are as follows.>This study appears to have been conducted rigorously, and the results, particularly in terms of unique banding patterns, appear to support the authors' conclusions. However, it would be helpful for the reader if the authors delineated which banding patterns (which samples) were unique, and which parts of the patterns made a unique fingerprint in each figure for the RAPD analysis. This would help the reader determine for themselves which strains and primers would be useful for their own analyses. Also, how did the authors determine uniqueness of banding patterns? Was a program used, or was it just by eye? Having a standard rigorous method for this is key- it may have been covered in the previous paper, which was cited, but if so, it would be good to make it clear what they did for this study as well. Also, it should be spelled out what NBRP is upon first usage of this acronym.As you pointed out, it is extremely important to determine the band pattern in the PARD method. In this study, we did not use any some specific analysis programs or tools, but evaluated the band pattern by only appearance. We are fully aware of the significant effect of subjectivity on conclusions by this approach. Therefore, in this study, we have constructed a multiplex PCR method by applying the results of this RAPD, and have proposed a simple and stable method to distinguish between Paramecium strains by this method. In relation to this, a supplemental table (S1_Tabale) was added at the end of this paper to show the quick identification chart for each standard strain depending on the results of this study.We also have added the full name of NBRP in the revised manuscript (line. 90).To Reviewer #3,Thank you for your valuable comments. We have revised the manuscript according to these comments. Our response to individual comment is as follow.>The data availability statement does not appear in the manuscript.As for “Data Availability statement”, we have prepared a new S1 file. We state the following.Data Availability: All relevant data are within the paper and its Supporting information file.Submitted filename: Response to Reviewers.docxClick here for additional data file.24 Feb 2022Distinction of Paramecium strains by a combination method of RAPD analysis and multiplex PCRPONE-D-21-36346R1Dear Dr. Watarai,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,Maria Stefania LatrofaAcademic EditorPLOS ONEAdditional Editor Comments:Dear Authors, the article has been improved and is accepted for publication,I would suggest only few modification as mentioned below:line 33: change in “5 specific primer sets were designed and a multiplex PCR method was developed”line 36: change in “specific strains were identified”; specify “This method”, which one?line 48: write the name “P” in fullline 55 and through the text change “18S rDNA” in “18S rRNA” and put “COI” I lower letter, the capital are used for protein productline 66: change “and in some cases are recognized as a cryptic species”lines 90-91: change in “were used, and a novel PCR tool, was applied for strains identification”Lines 145-148: Change in “After the comparative study using these designated strains and ten random primer sets from a previous study [24, 26, 27], differences in band patterns were found between strains using only the random primer-02, -03, and -05 (Figs. 1–3)”Lines 153-154: remove the sentence “These strains could be identified only by the results of these RAPD analysis”, is superfluousReviewers' comments:Reviewer's Responses to Questions
Comments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed********** 2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: N/A********** 4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes********** 5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes********** 6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The manuscript ONE-D-21-36346, entitled ''Distinction of Paramecium strains by a combination method of RAPD analysis and multiplex PCR'' was correctly reviewed by the authors that reinforced the interesting results that highlighted the knowledge of the study. With the new corrections, the article is now acceptable.********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Viviane Noll Louzada Flores4 Mar 2022PONE-D-21-36346R1Distinction of Paramecium strains by a combination method of RAPD analysis and multiplex PCRDear Dr. Watarai:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Maria Stefania LatrofaAcademic EditorPLOS ONE