Detection of multiple mycetoma pathogens using fungal metabarcoding analysis of soil DNA in an endemic area of Sudan.

Mycetoma is a tropical disease caused by several fungi and bacteria present in the soil. Fungal mycetoma and eumycetoma are especially challenging to treat; therefore, prevention, early diagnosis, and early treatment are important, but it is also necessary to understand the geographic distribution of these pathogenic fungi. In this study, we used DNA metabarcoding methodology to identify fungal species from soil samples. Soil sampling was implemented at seven villages in an endemic area of Sennar State in Sudan in 2019, and ten sampling sites were selected in each village according to land-use conditions. In total, 70 soil samples were collected from ground surfaces, and DNA in the soil was extracted with a combined method of alkaline DNA extraction and a commercial soil DNA extraction kit. The region for universal primers was selected to be the ribosomal internal transcribed spacer one region for metabarcoding. After the second PCR for DNA library preparation, the amplicon-based DNA analysis was performed using next-generation sequencing with two sets of universal primers. A total of twelve mycetoma-causative fungal species were identified, including the prime agent, Madurella mycetomatis, and additional pathogens, Falciformispora senegalensis and Falciformispora tompkinsii, in 53 soil samples. This study demonstrated that soil DNA metabarcoding can elucidate the presence of multiple mycetoma-causative fungi, which may contribute to accurate diagnosis for patient treatment and geographical mapping.

Introduction

Mycetoma is a chronic granulomatous and disabling inflammatory disease caused by specific groups of bacteria (actinomycetoma) or fungi (eumycetoma). It typically affects people living in poor, remote communities in tropical and subtropical regions within the so-called mycetoma belt, located between latitude 15°S and 30°N [1]. Most of the causative microorganisms inhabit the soil and invade the human body through minor unnoticed wounds on the skin, mainly in the foot and hand, and multiply to form multiple painless subcutaneous mass lesions that discharge seropurulent grains [1-4]. As the lesions progress, the microorganisms invade more deeply into tissues and bones, which can lead to amputation of the affected limb and is sometimes fatal [5]. The detailed epidemiological characteristics, such as the route of transmission, incubation period, prevalence, and incidence, have not been elucidated due to its chronic slow progression, with patients only visiting the hospital after being infected for years [6,7].

Between actinomycetoma and eumycetoma, the latter causes serious public health problems, because there is no effective short-term medicine compared to the former, which is treated by existing antibiotics. Therefore, prevention and screening programs are needed for early detection and treatment before the lesions reach vital parts of the body. It is thus necessary to understand the geographical risk distribution of the infective fungi. Because the causative fungal pathogens exist in the soil in endemic areas, it is possible to determine the distribution of infection by analyzing collected soil samples from areas in or near-endemic areas to confirm their presence. Before now, only soil sampling surveys have been conducted explicitly targeting only Madurella mycetomatis, the leading causative agent in Sudan [4]. However, to date, over 50 species of mycetoma-causative fungi have been reported around the world [8], and some patients are simultaneously infected with multiple fungi [9-13]. To understand the distributions of the causative fungi, it is necessary to comprehensively capture all fungi in an endemic area’s soil.

To comprehensively capture and analyze large quantities of DNA information simultaneously, metabarcoding using next-generation sequencing (NGS) is used as a high throughput approach in several scientific fields. This technique has been applied for soil microbiome research to detect environmental DNA (eDNA) from soil samples in the fields of soil microbial ecology, environmental science, and botany [14-16]. By applying this metabarcoding technology, it is possible to capture all the causative fungi in the soil for environmental surveillance of mycetoma, which will be critical for eumycetoma prevention measurements and control programs.

In this study, we performed a metabarcoding technology-based soil sampling survey in an endemic area to establish the geographical risk distribution of eumycetoma.

Methods

Study area and soil sampling

We chose ten villages in the state of Sennar, Sudan, located about 250 km south-east of Khartoum, where a mycetoma clinic is operated by the Mycetoma Research Centre (MRC), University of Khartoum, to manage mycetoma patients (Fig 1). Ten sampling sites where people gather or were near water sources were selected per village; we planned 100 soil sample collections from 10 villages. Each sampling site was categorized according to the land usage at the site as follows: 1) inside a cow fence, 2) dryland, 3) farmland, 4) riverside farm, and 5) road. The sampling survey was conducted for two days using a mobile data collection system, Open Data Kit (available online: https://opendatakit.org/) [17]. The soil sampling survey was conducted from October 16 to 17, 2019. The average temperature of Senner in October of 1991–2020 was 29.64°C (range: 22.28°C–37.05°C), and the average precipitation was 24.11 mm (sourced from the World Bank Climate Change Knowledge Portal) [18]. Soil samples were collected with 50 ml Falcon tubes from surfaces that none of the team members had stepped on using disposable plastic shovels [19]. The gloves and disposable shovels were changed at every location, and shoe covers were worn at every village to avoid contamination. The Falcon tubes were packed in a small plastic bag and stored in a styrofoam box with dry ice to minimize DNA degradation. Samples from the first day were kept in an empty −30°C freezer provided by the village head. After completing sampling on the second day, soil samples in the tubes were packed in styrofoam boxes with additional dry ice, transported to Khartoum by land, then stored in a −30°C freezer immediately upon arrival at MRC (see Supplemental method 1 in S1 Protocol for more details).

Fig 1

The geographical location of areas where soil samples were collected in this study.

Each point on the map presents a sample collection site. Country and state maps were obtained from the GADM database under a CC BY license (https://geodata.ucdavis.edu/gadm/gadm4.0/shp/gadm40_SDN_shp.zip). Waterways (blue line) data were downloaded from the OpenStreetMap project (OpenStreetMap contributors) under a CC BY-SA 2.0 license (www.openstreetmap.org) through the platform Geofabrik (https://download.geofabrik.de/africa/sudan-latest-free.shp.zip). The map was created using the QGIS Geographic Information System, Open Source Geospatial Foundation Project, under a CC BY-SA 3.0 license (http://qgis.osgeo.org).

DNA extraction

The DNA extraction protocol was broadly followed as previously reported to increase the amount of DNA extracted from the soil samples [19,20]. We used the integrated method of alkaline DNA extraction with ethanol precipitation and a commercial DNA extraction kit for soil samples (PowerSoil DNA Isolation Kit, Qiagen, Germany). For each sample, 9 g of soil was used for DNA extraction. During this process for each village, one negative control was obtained using 9 g of distilled water. The final DNA solutions were dissolved into the elusion buffer of the kit (see Supplemental method 2 in S1 Protocol for more details).

Universal primers

To choose universal primers for metabarcoding on the MiSeq platform (Illumina, USA), we cataloged mycetoma-causing fungi species from previous studies, which resulted in 29 genera with 55 species (including three at genus-level classification) (S1 Table). The internal transcribed spacer (ITS) regions and 18S ribosomal DNA are generally used for the identification of fungal species [21]. The accession of each causative fungus in the GenBank database by the National Center for Biotechnology Information (NCBI) was checked, and subsequently, the ITS1 and ITS2 regions were chosen as universal primer targets (S1 Table). Then, the sequences of 52 species available in GenBank were downloaded and subjected to multiple alignments using MUSCLE in the Unipro UGENE program (version 40.0) [22,23]. The set of aligned sequences was inspected visually with primers reported previously [24-26]. The universal primers that covered as many species as possible in the data set were adopted as our MiSeq primers. Primers sets named ITS1/ITS2 and ITS3_KYO1/ITS4_KYO1 shared sequences well with the target fungal genes [24,26]. Therefore, primers were designed for MiSeq in combination with ITS1/ITS2 and ITS3_KYO1/ITS4_KYO1, and six random hexamers (N) and adapter sequences (Fig 2 and Table 1).

Fig 2

Map of ribosomal DNA genes with universal primers.

The internal transcribed spacer 1 (ITS1) and 2 (ITS2) regions were targeted to identify causative species. The primer sets ITS1/ITS2 and ITS3_KYO1/ITS4_KYO1 were used as universal primers for the MiSeq system.

Table 1

Primer sequences for the MiSeq analysis.

Primers	Sequence	Original primer names
ITS1_U	5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT NNNNNN TCCGTAGGTGAACCTGCGG-3’	ITS1a
ITS2_U	5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT NNNNNN GCTGCGTTCTTCATCGATGC-3’	ITS2a
ITS3_KYO1_U	5’- ACACTCTTTCCCTACACGACGCTCTTCCGATCT NNNNNN AHCGATGAAGAACRYRG- 3’	ITS3_KYO1b
ITS4_KYO1_U	5’- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT NNNNNN TCCTCCGCTTWTTGWTWTGC- 3’	ITS4_KYO1b

Underlined sequences are traditionally used as universal fungal primers. The bolded base was slightly modified from the original.

a reference [24]

b reference [26]

PCR amplification

Targeting ribosomal ITS1 and ITS2, we employed two-step PCR library preparations. The first was to amplify specific regions in eumycetoma-causing species, and the second was for the attachment of distinguishable tags for metabarcoding, as reported previously [27,28]. PCR reagents and PCR products were prepared in separate rooms to avoid unanticipated DNA contamination. Three replicates were amplified for the first-round PCR (1st PCR) for each sample using the forward and reverse primers targeting the fungal ITS1 and ITS2 regions (Table 1). A total of 25 μl PCR reaction volume contained 0.5 U of KOD-Plus-Neo (Toyobo, Japan), 2.5 μl of 10× buffer for KOD-Plus-Neo (Toyobo), 2.5 μl of 2 mM dNTPs solution, 1.5 μl of 25 mM MgSO4 solution, 0.75 μl of 10 μM each primer, and 2 μl DNA extract. For the PCR targeting ribosomal ITS2, ten-fold dilutions of 17 colored DNA extracts were also used to reduce the influence of PCR inhibition (S2 Table). The PCR was carried out with 40 cycles at 94°C for 20 s, 65°C for 30 s (57°C for PCR targeting ribosomal ITS2), and 68°C for 30 s, then completed with a final 68°C for 5 min. Then, DNA purification was performed for the 1st PCR products with SPRIselect Reagent Kit (Beckman Coulter, USA) and quantified using a Qubit fluorometer 3.0 (Thermo Fisher Scientific, USA). Preliminary checks using gel electrophoresis were performed to confirm PCR products. The dilution factor was calculated for each sample to 0.1 ng/μl, and the average dilution rate was applied to the negative controls. Subsequently, all DNA samples from the soils were diluted for the second-round PCR (2nd PCR).

Next, the 2nd PCR, which added a unique 8-bp index and MiSeq adaptor sequences at each end of the amplicons, was performed for Illumina MiSeq. The PCR was carried out in a 12 μl reaction volume using 6 μl of 2× KAPA HiFi HotStart ReadyMix (KAPA Biosystems, USA), 2 μl of forward and reverse primers with index and adaptor sequences (1.8 μM), 1 μl of combined 1st PCR DNA templates, and 1 μl of ultrapure water under the following thermal cycler profile: 95°C for 3 min, followed by 12 cycles of 98°C for 20 s and 72°C for 30 s, finally 72°C for 5 min. All the 1st PCR products were combined into one and then applied to the MiSeq Reagent Kit v3 for 2 × 300 bp (600 cycles) (Illumina) with PhiX Control v3 (Illumina). Detailed protocols are described in the supplement (see Supplemental method 3 in S1 Protocol).

Bioinformatics

According to previously reported methods, the raw MiSeq data were pretreated and analyzed using USEARCH v10.0.240 [19,29]. Paired-end reads were combined; meanwhile, reads with low quality, short length, and many differences (>5 positions) in the merged region were discharged. Next, primer sequences, low-quality reads, and short reads were removed. Dereplication was performed to the set of reads; then denoising was conducted to generate amplicon sequence variants (ASVs). Chimeric and minor (<10 reads) ASVs were removed.

Then the data were analyzed systematically and robustly, and species-level identification by ASVs was conducted through BLAST+ [30] searches with a 97% identity threshold and 90% query cover of the entire query sequence [27,31,32]. Since a small number of ASVs occurred in negative control samples, these ASV sequences were first removed from the sequence data of all samples. We downloaded and used the UNITE database v8.2 (2020-02-04) (https://unite.ut.ee/) [33,34]. After a homology search with BLASTN, the species names of the eumycetoma-causative fungi were extracted from the results. To ensure identification at the level of a single species, we checked the species names manually, whether best (i.e., single and top) or not, with reference to the value of identity and E-values (see Supplemental method 4 in S1 Protocol for more details).

Statistical analysis

One-way analysis of variance (ANOVA) followed by the Turkey-Kramer test was conducted to test whether there were differences in the number of causative species by land use of the sampling sites, using R (version 4.1.2, 64-bit).

Results

Soil sampling and DNA extraction

Finally, 70 soil samples were retrieved from seven villages (Al Awia, Al Ragal Al Batahin, Deshein, Sharfa Al Mihrab, Wad Ajeeb, Wad Al-Har, Wad Hassan) (Fig 3). We could not approach three villages due to flooding. Although the weather was sunny during the sampling, one village (Wad Al-Har) was muddy, except for the center of the village. Few riverside farm samples were collected from the targeted location due to secured blockades and fences; therefore, samples were collected from the closest location.

Fig 3

Schematic diagram of soil sampling prior to NGS analysis.

A total of 64 DNA samples with six negative controls were extracted, and 17 of the samples were colored with soil components. During the laboratory work process, seven samples, including one negative control, were lost due to a malfunction of the centrifuge separator (Fig 3).

PCR amplification and MiSeq sequencing

After the 1st PCR targeting ribosomal ITS1 to amplify fungal DNA, preliminary checks found target size bands from 37 samples, but no band was found in the negative controls. Hence, for the MiSeq for ribosomal ITS2, we did only an initial check for some samples.

As an outcome of MiSeq for ribosomal ITS1, 3,158,851 pair-end sequences (reads) were obtained in total from the soil and negative control samples. The averages (±SD) of soil samples and negative controls (blanks of DNA extraction and the 1st PCR) were 24,631 (± 22,865) reads (lowest number 19 reads; highest number 161,247 reads) and 306 (± 346) reads, respectively. After processing with USEARCH, 7,357 ASVs were found in all DNA samples. The averages (±SD) of soil samples and negative controls/PCR blanks of the 1st PCR were 114 (± 86.0) reads and 6.1 (± 5.7) reads, respectively. For ribosomal ITS2, a total of 21,177,128 pair-end reads, an average of 130,569 (± 126,731) reads (lowest number 14 reads; highest number 679,229 reads) for soil samples and 1,248 (± 2,208) for negative controls, and a total of 10,780 ASVs, an average of 133 (± 107) reads for soil samples, and 5.8 (± 9.8) reads for negative controls, were obtained.

Eumycetoma-causative fungi detected in the samples

In the BLAST results based on the UNITE database, nine genera and twelve species of causative fungi, including the primary pathogen in Sudan, M. mycetomatis, and Falciformispora senegalensis and Falciformispora tompkinsii, were retrieved (Table 2). The number of detected species was counted based on land use; there was a significant difference only between road (3.3 ± 1.5) and dryland (1.9 ± 1.0) (p = 0.045) (S1 Fig).

Table 2

Causative fungal species hit with 97% identity threshold and top hit species.

Village	Land use	Aspergillus terreus	Amesia atrobrunnea	Curvularia lunata	Exserohilum rostratum	Falciformispora senegalensis	Falciformispora tompkinsii	Fusarium solani	Madurella fahalii	Madurella mycetomatis	Madurella tropicana	Medicopsis romeroi	Phaeoacremonium parasiticum
A. Deshein	Farm 1	-	-	c	b	-	-	-	-	-	-	-	-
	Farm 2	-	-	c	a	-	-	-	-	b	-	-	-
	Road	-	-	b	b	-	-	b	-	b	-	-	-
	Cattle 1	-	-	a	-	-	-	-	-	-	-	-	-
	Cattle 2	-	b	c	-	-	-	b	-	-	-	-	-
	Dryland	-	-	c	-	-	-	-	-	b	-	-	-
	Riverfarm	-	-	a	-	-	-	b	-	-	-	-	-
B. Sharfa Al-Mihrab	Farm 1	a	-	-	-	-	-	-	-	-	-	-	-
	Road	-	-	a	-	-	-	-	-	b	b	-	-
	Dryland 1	a	-	c	b	-	-	-	-	-	-	-	-
	Riverfarm 1	-	-	a	-	a	-	-	-	-	-	-	-
	Riverfarm 2	-	-	a	-	a	-	-	-	-	-	-	-
	Dryland 2	-	-	-	b	-	-	-	-	-	-	-	-
	Farm 2	-	-	c	-	-	-	b	b	-	-	-	-
C. Al-Awia	Farm 1	-	-	c	-	-	-	-	b	-	-	-	-
	Farm 2	-	-	c	-	-	-	-	b	-	-	-	-
	Road 1	-	-	c	b	-	-	b	-	b	b	-	-
	Road 2	-	b	c	b	-	-	b	-	b	b	-	-
	Cattle	-	-	a	-	-	-	-	-	-	b	-	-
	Dryland 1	-	-	a	-	-	-	-	-	-	-	-	-
	Riverfarm 1	-	-	c	-	-	a	b	-	-	-	-	-
	Riverfarm 2	-	-	c	-	-	-	-	-	-	-	-	-
	Dryland 2	-	-	c	-	-	-	-	-	-	-	-	-
D. Wad Hassan	Farm 1	-	-	c	c	-	-	b	-	-	-	-	-
	Riverfarm 1	a	-	c	-	-	-	b	-	-	-	-	-
	Road 1	a	-	c	-	-	-	-	b	-	-	-	b
	Road 2	-	-	b	-	-	-	b	-	b	-	-	-
	Farm 2	-	b	c	-	-	-	b	-	b	-	-	-
	Dryland 1	a	-	c	-	b	-	-	-	-	-	b	-
	Dryland 2	a	-	c	-	-	-	-	-	-	-	-	-
	Riverfarm 2	-	-	c	-	-	-	-	b	-	-	-	-
E. Wad Ajeeb	Farm 1	a	-	c	-	-	-	-	-	b	-	-	-
	Farm 2	-	-	c	b	-	-	-	-	b	-	-	-
	Road 1	-	-	-	b	-	-	-	b	-	-	-	-
	Road 2	-	-	b	-	-	-	-	-	-	-	-	-
	Dryland 1	-	-	a	-	-	-	-	b	b	-	-	-
	Dryland 1	a	-	-	-	-	-	-	-	-	-	-	-
	Riverfarm 1	-	-	c	-	-	-	b	b	-	-	-	-
	Riverfarm 2	-	-	c	-	-	-	-	-	-	-	c	-
F. Al-Ragal Al-Batahin	Dryland	-	-	c	-	-	-	-	-	-	-	-	-
	Farm 1	a	-	c	-	-	-	-	-	-	-	-	-
	Farm 2	a	-	c	b	-	-	-	-	-	-	-	-
	Cattle	-	-	a	-	-	-	-	-	-	-	-	-
	Road	-	-	b	b	-	-	b	-	b	-	b	-
	Farm 1	-	-	c	-	-	-	b	b	-	-	-	-
	Farm 2	-	-	c	-	-	-	-	-	-	-	-	-
G. Wad Al-har	Road 1	-	-	c	-	-	-	-	b	b	-	-	-
	Farm 1	-	-	c	-	-	-	b	-	b	-	-	-
	Farm 2	-	-	c	-	-	-	-	-	-	-	-	-
	Road 2	-	-	c	-	-	-	-	-	-	-	-	-
	Road 3	-	-	a	-	-	c	-	-	-	-	-	-
	Farm 2	-	-	a	-	-	-	-	-	b	-	-	-
	Farm 3	-	b	c	-	-	-	b	-	-	-	-	-

Letters indicate the following: a, detected species the MiSeq targeting the ribosomal ITS1 region; b, ribosomal ITS2; c, species hit in both analyses. Only locations where the target fungi were detected are shown.

Discussion

In this study, we detected several eumycetoma-causing fungi simultaneously from soils of different land uses in an endemic area using a metabarcoding technology-based soil sampling survey method. Our analysis identified twelve species of eumycetoma pathogens from soil DNA samples, including the principal causative agent, M. mycetomatis. Only two previous studies detected the DNA of M. mycetomatis and other causative species from the soil or Acacia thorns and other environmental agents [4,16]. However, the simultaneous detection of multiple pathogenic fungi is scientifically warranted because 1) over 50 species of mycetoma-causative fungi are reported worldwide [8], 2) mycetoma is caused by various fungi classes [5,35], 3) multiple fungi are found even in a single lesion of a patient [36], and 4) it has been reported that fungi collected from patient lesions and cultured are present in the soil [6,7,35].

As previous reports have mentioned, mycetoma is distributed widely within arid areas, called the mycetoma belt [1]. In this study, the field sites were selected from the state of Sennar, which is in a dry climate. Soil samples from several different land-use conditions in the endemic region of eumycetoma were also collected and analyzed. As a result, surprisingly, the DNA of the twelve species known as causative agents, including the most important, M. mycetomatis, and some other rare pathogenic species (i.e., Aspergillus and Curvularia), were detected from 83% (53/64) of the soil samples. In regard to specificity and sensitivity, this study shows the advantage of multiple detections of mycetoma-causative pathogens. Our results showed that regardless of the environmental conditions, various eumycetoma pathogens are ubiquitous in the soils of these areas. In addition, the analysis showed a statistical difference between roads and drylands, which indicates that some environmental agents may affect the existence of pathogens in soil, though this requires further study. More extensive field sampling, including soil composition or climate data, may uncover the environmental preferences of mycetoma-causative fungi. Moreover, the outcome of soil fungal metabarcoding can be used to visualize a risk map of the causative agents with remote sensing data, as with previous studies using clinical data [37,38]. This can lead to robust estimates of the environmental risk factors associated with mycetoma, which have not been elucidated over its long history.

Furthermore, our findings can help with diagnosis or preventive measures for patients. Clarifying the diversity of fungi, including eumycetoma agents, in patients’ villages might contribute to the accurate diagnosis of the pathogens. Our data also suggest that protective measures such as wearing shoes should be strongly promoted for people in mycetoma-endemic areas.

Based on the data obtained in this study, we constructed a system of amplicon sequencing and metabarcoding techniques targeting a group of mycetoma-causative organisms. Considering the PCR conditions, we faced a major limitation: some extracted DNA solutions were brown-colored (S2 Table), which means that the samples might have been contaminated with PCR inhibitors such as humic acids in the soil. Here, we applied a DNA extraction method developed for sedimentary soils of river bottoms [20]; however, the soil moisture contents were different for each land use, which might have influenced the PCR amplification. For subsequent MiSeq analysis targeting ribosomal ITS2, the colored DNA samples were diluted in the 1st PCR to produce accurate results. Accordingly, most target DNA was successfully amplified (i.e., reads and ASVs) compared with the same samples that were not diluted.

In this study, we focused on species-level detection of causative agents of eumycetoma. Therefore, the number of sequences that could not be identified as species might be underestimated, which means there were possibly more pathogens in the sampling sites. Thus, further identifying species from mycetoma specimens and registration in gene databases is still needed. In our results, Aspergillus terreus was only identified at the species level for the ribosomal DNA ITS1 region, although the Madurella genus was identified in the analysis for ITS2. For pathogenic species identification, at this point, using both the ITS1 and ITS2 regions would lead to more accurate results.

Conclusion

The metabarcoding technology-based soil sampling survey method can detect multiple causative fungi from soil samples in an endemic area, including the major pathogen, M. mycetoma. Applying the technology to construct a geographic distribution of causative fungi provides essential and fundamental information for preventive measures, diagnosis considering regional characteristics and fungi distribution, and the development of therapeutic agents against mycetoma.

Causative microorganisms of eumycetoma in the world.

We used sequences of the accession numbers below to choose universal primers.

(XLSX)

Click here for additional data file.

Colored DNA samples after extraction.

These samples had inadequately remove soil-derived PCR inhibitors. Each letter shows a sampling village: A. Deshein, B. Sharfa Al-Mihrab, C. Al-Awia, D. Wad Hassan, E. Wad Ajeeb, F. Al-Ragal Al-Batahin, and G. Wad Al-har. NCs, negative controls at DNA extraction.

(XLSX)

Click here for additional data file.

Number of detected eumycetoma-causative species per land-use category.

(EPS)

Click here for additional data file.

Supplemental methods.

Supporting information of methods. Supplemental method 1. Soil sampling. Supplemental method 2. DNA extraction. Supplemental method 3. PCR amplification. Supplemental method 4. Bioinformatics.

(DOCX)

Click here for additional data file.

24 Nov 2021

Dear Prof. Kaneko,

Thank you very much for submitting your manuscript "A novel method of an environmental study of multiple mycetoma pathogens: Metabarcoding analysis for soil DNA of the endemic area in Sudan" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.

Dear Dr. Kaneko and colleagues:

Thanks for submitting your manuscript to PLoS Neglected Tropical Diseases. I have now received three independent reviews of your work, and as you will see, one reviewer recommended rejection, another suggested a major revision and third a minor revision. I am affording you the option of revising your manuscript according to all three reviews but understand that your resubmission may be sent to at least one new reviewer for a fresh assessment (unless the reviewer recommending rejection is willing to re-review).

There are concerns about the novelty of your methods…please explain how your approach is novel and differs from standard approaches used in the field. I realize this is one opinion and the other reviewers are less concerned about the novelty of your methodology. So in your rebuttal letter please argue for the novelty aspect of your study.

Please have an English-speaking expert help revise your manuscript. Please also work on the clarity, organization and presentation of the manuscript (several suggestions are made by the reviewers). Submit your manuscript with track-changes demonstrating that a native-speaking expert has helped with grammar and context.

Importantly, please ensure your Materials and Methods are clearly stated. The methods should be clear, concise and repeatable. Please ensure this, and make sure all relevant information and references are provided.

I look forward to seeing your revision, and thanks again for submitting your work to PLoS Neglected Tropical Diseases.

Good luck with your revision,

-joe

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Joseph James Gillespie, Ph.D.

Associate Editor

PLOS Neglected Tropical Diseases

Dileepa Ediriweera

Deputy Editor

PLOS Neglected Tropical Diseases

***********************

Dear Dr. Kaneko and colleagues:

Thanks for submitting your manuscript to PLoS Neglected Tropical Diseases. I have now received three independent reviews of your work, and as you will see, one reviewer recommended rejection, another suggested a major revision and third a minor revision. I am affording you the option of revising your manuscript according to all three reviews but understand that your resubmission may be sent to at least one new reviewer for a fresh assessment (unless the reviewer recommending rejection is willing to re-review).

There are concerns about the novelty of your methods…please explain how your approach is novel and differs from standard approaches used in the field. I realize this is one opinion and the other reviewers are less concerned about the novelty of your methodology. So in your rebuttal letter please argue for the novelty aspect of your study.

Please have an English-speaking expert help revise your manuscript. Please also work on the clarity, organization and presentation of the manuscript (several suggestions are made by the reviewers). Submit your manuscript with track-changes demonstrating that a native-speaking expert has helped with grammar and context.

Importantly, please ensure your Materials and Methods are clearly stated. The methods should be clear, concise and repeatable. Please ensure this, and make sure all relevant information and references are provided.

I look forward to seeing your revision, and thanks again for submitting your work to PLoS Neglected Tropical Diseases.

Good luck with your revision,

-joe

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: The methods used are the regular methods used in that study and there is no new and contribution to the methods used

Reviewer #2: Firstly, a thorough review of English is necessary.

The main claims of the paper is that eumycetoma is highly frequent in Sudán and the main etiologicla agent is M. mycetomatis. These claims are very significant to meet the proposed objective.

The authors have enough fairly the literature.

In general the manuscript is well organized, but not written clearly enough to be accessible to non-specialists.

Methods

The objective of the study is clearly established but not articulated with a clear testable hypothesis.

-The study design could be supplemented with culture to address the stated objectives.

-The population is clearly described and appropriate.

-The sample size sufficient to ensure adequate power to address the study.

-The statistical analysis used were correct to support conclusions.

-Specifically, in the sampled sites (Sennar State Suda), what are the most frequent eumycetoma agents reported? If the answer is M. mycetomatis, something is not well in the methodology. The authors tried to recover M. mycetomatis in culture?

-Some of additional work would improve the paper. For exemple, cultivation of different soils to get eumycetoma agents and phenotipically identify these ones. This methodology is laborious but not difficult.

-The NGS is a technique that makes outstanding this paper, but unfortunately is not well explained and results no well exploited. Authors do not say if NGS was make at least by duplicate.

-Details of the methodology are no sufficient to allow the experiments to be reproduced.

-The analysis presented does not match the analysis plan. Madurella mycetomatis DNA was not detected by NGS after DNA extraction from soil.

-Results are clearly and completely presented, but are not that expected.

-The figures (Tables, Images) are of sufficient quality for clarity.

-I think authors should have done some previous experiments to standardize amplification conditions and then apply them to the NGS technique.

Reviewer #3: -Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

Yes

-Is the study design appropriate to address the stated objectives?

Yes

-Is the population clearly described and appropriate for the hypothesis being tested?

Yes

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

Yes

-Were correct statistical analysis used to support conclusions?

Yes

-Are there concerns about ethical or regulatory requirements being met?

No

--------------------

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: ok

Reviewer #2: -The analysis presented does not match the analysis plan. Madurella mycetomatis DNA was not detected by NGS after DNA extraction from soil.

-Results are clearly and completely presented, but are not that expected.

-The figures (Tables, Images) are of sufficient quality for clarity.

Reviewer #3: -Does the analysis presented match the analysis plan?

Yes

-Are the results clearly and completely presented?

Yes

-Are the figures (Tables, Images) of sufficient quality for clarity?

Yes; please make sure the map employed complies with the journal copyright requirements.

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: there is no conclusion on the study but it is general sentences not supported to the results obtained

Reviewer #2: Discussion

In Discussion, authors say that that they did not find M. mycetomatis because of some PCR inhibitors. Why was this phenomenon not present with the other fungal agents?

Conclusions

-The conclusions are not supported by the data presented, but only by the method advantage.

-The limitations of analysis considered by authors are described.

-The public health relevance is addressed.

Reviewer #3: -Are the conclusions supported by the data presented?

Yes

-Are the limitations of analysis clearly described?

Yes

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

Yes

-Is public health relevance addressed?

Yes

--------------------

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: (No Response)

Reviewer #2: I dont have experience about Editorial work. However, if Editorial Committee decides accept this paper I dont have modifications to recommend.

Reviewer #3: Minor Revision

--------------------

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: This paper lacks novelty. there is no new in the results of the study and it is not contribute to the readers rather than the scientific community. I ask where is the new findings or contribution in the field?. All methods are routinely used in the similar studies, also the results obtained have no impact in the scientific community

Reviewer #2: I have reviewed the manuscript entitled “A novel method of an environmental study of multiple mycetoma pathogens: Matabarcoding análisis for soil DNA of the endemic área in Sudan”.

The authors use a relatively novel technique and this is remarkable and valuable. However, the wording and clarity must be improved especially in the methodology. Unfortunately authors did not recover M. mycetomatis DNA, as the main eumycetoma agent in Sudan. If the authors improve the writing and clarity of the English (the discussion is fine), the document is salvageable.

Reviewer #3: The authors performed an analysis of soil samples in several locations in Sudan with the objective of detecting eumycetoma causing agents. The study is well performed and the methodology thoroughly detailed. The findings are interesting and relevant due to the scarcity of environmental studies of these fungi. Please include in the methodology section the month and usual weather when the soil samples were retrieved as these may influence future studies that aim to isolate or detect these microorganisms. Please include in the discussion section the reasons you believe of M. mycetomatis was not found.

--------------------

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Tarek A. A. Moussa

Reviewer #2: No

Reviewer #3: Yes: JA Cardenas-de la Garza

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

5 Feb 2022

Submitted filename: Response to Reviewers Comments_hh3.docx

Click here for additional data file.

23 Feb 2022

Dear Prof. Kaneko,

We are pleased to inform you that your manuscript 'Detection of multiple mycetoma pathogens using fungal metabarcoding analysis of soil DNA in an endemic area of Sudan' has been provisionally accepted for publication in PLOS Neglected Tropical Diseases.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Joseph James Gillespie, Ph.D.

Associate Editor

PLOS Neglected Tropical Diseases

Dileepa Ediriweera

Deputy Editor

PLOS Neglected Tropical Diseases

***********************************************************

Dear Dr. Kaneko and colleagues:

Thanks for revising your manuscript based on the concerns raised by the reviewers. I now believe that your manuscript is suitable for publication. Congratulations! I look forward to seeing this work in print, and I anticipate it being an important resource for groups studying Mycetoma pathogens as well as approaches using metabarcoding fungi. Thanks again for choosing PLoS Neglected Tropical Diseases to publish such important work.

Best,

-joe

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #2: Fort he second time I have reviewed the manuscript entitled “Detection of multiple mycetoma pathogens using fungal metabarcoding analysis of soil DNA in an endemic area of Sudan.” The document looks clearer and better written.

Methods

The objective of this study is clear, as well as the study design. The geographical sites to study are well described. The authors do not propose a hypothesis. Considering the authors use an innovative but very expensive technology, the sample size is adequate, as well as the statistical analyse.

Reviewer #3: (No Response)

**********

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #2: The presented analysis match well with analysis plan. Results are clearly and completely presented, both in text and figures. Figures are of sufficient quality and clarity.

Reviewer #3: (No Response)

**********

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #2: Conclussions are supported by the data presented. Limitations of analysis are not mentioned by authors. The authors discuss how the knowledge of the distribution of eumycetoma agents can contribute to understanding the population's risk of developing the disease. These data can be helpful.

The relevance in public health is highlighted, indicating that Sudan is a country with a high rate of eumycetoma.

Reviewer #3: (No Response)

**********

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #2: I suggest ACCEPT the manuscript for publication, with a minor change: In Conclusión, line 334, Did the authors mean M. mycetomatis?

Reviewer #3: Accept

**********

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #2: After a second review, the manuscript is clearer and better written. Authors performed a novel technique with results that reinforce the information available on the etiological agents of mycetoma.

Reviewer #3: Great job.

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

Reviewer #3: Yes: JA Cardenas-de la Garza

7 Mar 2022

Dear Prof. Kaneko,

We are delighted to inform you that your manuscript, "Detection of multiple mycetoma pathogens using fungal metabarcoding analysis of soil DNA in an endemic area of Sudan," has been formally accepted for publication in PLOS Neglected Tropical Diseases.

We have now passed your article onto the PLOS Production Department who will complete the rest of the publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Editorial, Viewpoint, Symposium, Review, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript will be published online unless you opted out of this process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Shaden Kamhawi

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

Paul Brindley

co-Editor-in-Chief

PLOS Neglected Tropical Diseases