Xinye Qian1,2, Hehe Liu2, Shangyi Fu2,3, Jiaxiong Lu1,2, Yu-Ting Hung4, Cassidy Turner4, Haiwei Gu4, Rui Chen2,5. 1. Verna and Marrs McLean Department of Biochemistry and Molecular Biology, Baylor College of Medicine, Houston, Texas, United States. 2. Human Genome Sequencing Center, Baylor College of Medicine, Houston, Texas, United States. 3. School of Medicine, Baylor College of Medicine, Houston, Texas, United States. 4. Arizona Metabolomics Laboratory, College of Health Solutions, Arizona State University, Scottsdale, Arizona, United States. 5. Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, Texas, United States.
Abstract
Purpose: The purpose of this study was to assess the therapeutic efficacy of rAAV8-hGRK1-Tlcd3b in a Tlcd3b-/- mouse model of retinal generation and validate TLCD3B's role as a ceramide synthase in vivo. Methods: Using Tlcd3b-/- mice as an inherited retinal disease animal model, we performed subretinal injection of rAAV8-hGRK1-Tlcd3b and evaluated the efficacy of gene replacement therapy. Tlcd3b-/- mice were treated at two time points: postnatal day 21 (P21) and postnatal day 120 (P120) with various dosages. Results: Tlcd3b overexpression rescued retinal degeneration in the mutant mice, as indicated by significantly improved photoreceptor function and preservation of photoreceptor cells over the course of 1 year. Although Tlcd3b is expressed in all cell types in the retina, photoreceptor cell-specific expression of Tlcd3b is sufficient to rescue the phenotype, indicating the primary function of TLCD3B is in photoreceptors. Consistent with the idea that TLCD3B is a ceramide synthase, mass spectrometry analyses of the mutant retina indicate the reduction of C16-, C18-, and C20-ceramides in the retina, which are restored with Tlcd3b overexpression. Conclusions: Our findings demonstrated the therapeutic efficacy of gene therapy in treating Tlcd3b mutant retina, laying the foundation for developing future therapy for TLCD3B retinopathy.
Purpose: The purpose of this study was to assess the therapeutic efficacy of rAAV8-hGRK1-Tlcd3b in a Tlcd3b-/- mouse model of retinal generation and validate TLCD3B's role as a ceramide synthase in vivo. Methods: Using Tlcd3b-/- mice as an inherited retinal disease animal model, we performed subretinal injection of rAAV8-hGRK1-Tlcd3b and evaluated the efficacy of gene replacement therapy. Tlcd3b-/- mice were treated at two time points: postnatal day 21 (P21) and postnatal day 120 (P120) with various dosages. Results: Tlcd3b overexpression rescued retinal degeneration in the mutant mice, as indicated by significantly improved photoreceptor function and preservation of photoreceptor cells over the course of 1 year. Although Tlcd3b is expressed in all cell types in the retina, photoreceptor cell-specific expression of Tlcd3b is sufficient to rescue the phenotype, indicating the primary function of TLCD3B is in photoreceptors. Consistent with the idea that TLCD3B is a ceramide synthase, mass spectrometry analyses of the mutant retina indicate the reduction of C16-, C18-, and C20-ceramides in the retina, which are restored with Tlcd3b overexpression. Conclusions: Our findings demonstrated the therapeutic efficacy of gene therapy in treating Tlcd3b mutant retina, laying the foundation for developing future therapy for TLCD3B retinopathy.
Ceramide is the component lipid that makes up sphingomyelin, which is one of the major lipids in the lipid bilayer. Evidence from both in vitro and in vivo studies has supported ceramide's role as an essential second messenger in the activation of apoptosis in photoreceptors, which is the hallmark of most retinal degenerative disorders.– Interestingly, both high and low levels of ceramides have been linked to apoptosis. The work of several groups has shown that the accumulation of ceramides, arising from the activation of different biosynthetic pathways, emerges as a death arbitrator in photoreceptors.– Reduced ceramide levels, however, have been previously linked to neurodegeneration in the cerebellum of CerS1-deficient mice. Although it is known that the maintenance of ceramide homeostasis is important for retinal cell survival,– the roles of ceramides are not well studied in the retina.Ceramide is generated through four pathways, de novo synthesis, the salvage pathway, the sphingomyelinase pathway, and the ceramide-recycling pathway, where ceramide synthases participate in all but the sphingomyelinase pathway., There are six ceramide synthase (CerS) isoforms, CerS1–6, in mammals, and different isoforms generate ceramides with distinct acyl chain lengths, thus generating different molecular species of ceramides with distinct cellular effects.,, Besides the six canonical ceramide synthases, a newly identified ceramide synthase, TLCD3B, was shown to synthesize C16-, C18-, and C20-ceramides in vitro. We identified a frameshift mutation (p. Gln79Asnfs*43) and a missense mutation (p. Gly56Ser) in TLCD3B, which encodes TLC domain-containing protein 3B, in patients diagnosed with autosomal recessive CRD (Cone-rod Dystrophy) and maculopathy. Both mutations were predicted to lead to TLCD3B loss of function. Patients with these TLCD3B mutations showed clinical signs of cone photoreceptor degeneration and predominant cone system dysfunction.A Tlcd3b knockout (Tlcd3b) mouse was generated to model the pathogenesis of TLCD3B retinopathy. Consistent with the patient phenotype, Tlcd3b deletion in mice leads to cone photoreceptor dysfunction and degeneration. At 7 months old, a reduction in outer nuclear layer (ONL) thickness and cone photoreceptor cell number is observed in Tlcd3b mouse retina compared to controls at 20% and 30%, respectively. Concerning the wide time window of disease progression, the Tlcd3b mouse model is an ideal candidate for gene therapy as most photoreceptors are present and functional in early staged mice.During the past decade, exciting progress has been made in the field of gene therapy study to correct the genetic defects that lead to nonsyndromic retinal dystrophies. Specifically, recombinant adeno-associated virus (rAAV)–based gene therapies, enabling efficient delivery of functional genes into mutant eyes and the rescue of disease phenotypes, have been shown to be a successful treatment method in both animal models of retinal degeneration– and patients.– Indeed, RPE65 gene therapy has been approved by the US Food and Drug Administration as the first gene therapy for patients with Leber congenital amaurosis 2 (OMIM entry MIM204100) and retinitis pigmentosa 20 (MIM#613794).In this study, using Tlcd3b mice as the model, we performed subretinal injections of rAAV8-hGRK1-Tlcd3b and evaluated the efficacy of gene replacement therapy. Among the various serotypes, a tyrosine-capsid mutant adeno-associated virus (AAV) vector plasmid, AAV8(Y733F), has been studied extensively to achieve high transduction efficiency, more rapid transgene expression, cell transduction specificity, and stable and long-term expression in photoreceptor cells.,,– As expected, the gene therapy significantly improved photoreceptor function and preservation of photoreceptor cells over a course of 1 year upon expression of rAAV8-Tlcd3b in the mutant retina. Consistent with the idea that TLCD3B is a ceramide synthase, mass spectrometry analyses of the mutant retina indicate the reduction of C16-, C18-, and C20-ceramides in the retina, which is restored by rAAV8-Tlcd3b expression. Taken together, our results demonstrate the feasibility of gene replacement therapy in treating the Tlcd3b knockout retinal disease mouse model. Therefore, given the conservation between humans and mice, this work lays a foundation for the potential gene therapy treatment in humans with retinal pathologies associated with TLCD3B mutations.
Materials and Methods
Production of rAAV8-Tlcd3b Viral Vector
Full-length Tlcd3b cDNA (Origene #MC210825; NM_029978.1) was sequence-verified and amplified by PCR. For exogenous Tlcd3b transgene expression detection, a FLAG tag was added at the N-terminus of the Tlcd3b gene during the PCR amplification using a primer set that includes the sequences of the FLAG tag and restriction enzyme sites AgeI and EcoRI at the end (forward primer: GGACCGGTGCCACCATGCTTACCCCAATGGTGGC; reverse primer: GGGAATTCTCACTTATCGTCGTCATCCTTGTAATCTCAGTCCTGGGTCTGACAA). Both the pTR-hGRK1 AAV vector (see vector map in Supplementary Fig. S1) and the PCR-amplified cDNA were digested with AgeI and EcoRI. The digested vector was gel-purified and then ligated with the digested insert. For AAV packaging, rAAV8 was used for packaging Grk1-Tlcd3b to achieve robust transduction efficiency and expression in retinal photoreceptors (Gene Vector Core, Baylor College of Medicine).
Animals
Tlcd3b mice were generated as previously described and maintained on a C57BL/6J genetic background. All mice in this study were maintained in a 14-hour light/10-hour dark cyclic environment. All animal operations were approved by the Institutional Animal Care and Use Committee at Baylor College of Medicine.
Subretinal Injection
Postnatal day 21 (P21) and postnatal day 120 (P120) mice were anesthetized with a combination drug consisting of ketamine (22 mg/kg), xylazine (4.4 mg/kg), and acepromazine (0.37 mg/kg), which was injected intraperitoneally. Subretinal injections were performed as described previously. A shallow incision was made through the sclera with a beveled 30-gauge needle. A 32-gauge blunt needle was presented inside the vitreous cavity and pushed forward until the tip of the needle had moved past the retina. The viral solution was injected into the subretinal space using an Ultra-Micro-Pump II and Micron-4 Controller (World Precision Instruments, Sarasota, Florida). All mice were treated once into the subretinal space with 1 µL rAAV8-hGRK1-Tlcd3b in the right eye, whereas the contralateral left eye was injected subretinally with 1 µL PBS, serving as an internal control, while age-matched wild types were used as the external controls. All animal phenotyping materials and methods are standard procedure and can be found in the Supplementary Materials and Methods.
Results
AAV-Mediated Tlcd3b Expression in Photoreceptor Cells
The primary defect observed in patients and mice in the absence of TLCD3B function is photoreceptor degeneration. Therefore, we reason that it is likely that the targeted expression of Tlcd3b cDNA in photoreceptor cells is sufficient to rescue the mutant phenotype. To target Tlcd3b expression in photoreceptor cells, we cloned mouse Tlcd3b cDNA under the control of the human rhodopsin kinase (hGRK1) promotor and then packaged the construct in rAAV8. Since Tlcd3b mice have a late onset of photoreceptor degeneration starting at 7 months, we performed subretinal injections of rAAV8-Tlcd3b at P21. To test if the effect of the timing of treatment, we also treated Tlcd3b mice at a late time point of P120. In this study, all treatments were performed in the right eye (RE), and the contralateral left eye (LE) was injected with PBS, serving as the internal control.Two months after the injection, we collected both eyes of injected mutant mice and examined their retina by immunofluorescence staining. In Tlcd3b mice, as expected, TLCD3B protein was not detected in the untreated LE (Fig. 1A). In contrast, the expression of TLCD3B, which extended throughout most of the retina, was observed in the treated RE (Fig. 1A). At a higher magnification, TLCD3B immunolabeling was detected specifically in the photoreceptors of the treated retina, where it colocalized with FLAG-positive staining (Fig. 1B). Taken together, the rAAV8-Tlcd3b vector resulted in a stable and specific expression of TLCD3B in photoreceptors upon treatment.
Figure 1.
AAV8-Tlcd3b transgene expression was verified in the rAAV8-Tlcd3b–treated retina of Tlcd3b mice. (A, B) Immunofluorescence staining of representative contralateral untreated LE of Tlcd3b mouse retina and treated RE of Tlcd3b mouse retina at 2 months postinjection performed on postnatal day 21. TLCD3B and FLAG staining was undetectable in the PBS-injected LE of Tlcd3b mice, whereas in the treated RE, robust staining was detected in the outer segment, the inner segment, and the outer nuclear layer of the retina. DAPI staining was performed to stain for cell nuclei. Scale bar: (A) 500 µm, (B) 20 µm. GCL, ganglion cell layer; INL, inner nuclear layer; IPL, inner plexiform layer; IS, inner segment; OPL, outer plexiform layer; OS, outer segment.
AAV8-Tlcd3b transgene expression was verified in the rAAV8-Tlcd3b–treated retina of Tlcd3b mice. (A, B) Immunofluorescence staining of representative contralateral untreated LE of Tlcd3b mouse retina and treated RE of Tlcd3b mouse retina at 2 months postinjection performed on postnatal day 21. TLCD3B and FLAG staining was undetectable in the PBS-injected LE of Tlcd3b mice, whereas in the treated RE, robust staining was detected in the outer segment, the inner segment, and the outer nuclear layer of the retina. DAPI staining was performed to stain for cell nuclei. Scale bar: (A) 500 µm, (B) 20 µm. GCL, ganglion cell layer; INL, inner nuclear layer; IPL, inner plexiform layer; IS, inner segment; OPL, outer plexiform layer; OS, outer segment.
Improvement in Photoreceptor Function in rAAV8-Tlcd3b–Treated Tlcd3b Mutant Mice
We next tested whether rAAV8-Tlcd3b treatment could rescue photoresponses in Tlcd3b mice. To determine if there is any functional rescue of electrophysiologic responses to light in Tlcd3b mice, we examined the ERGs of dark-adapted Tlcd3b mice by testing LE and RE responses independently.At 7 months of age, Tlcd3b mice exhibited significantly reduced scotopic and photopic b-wave amplitude in the contralateral untreated LE compared with the wild-type control mice (Fig. 2), indicating cone photoreceptor and bipolar dysfunction, while scotopic a-wave ERGs showed a normal response of rod photoreceptors. In both P21- and P120-treated Tlcd3b mice, at a concentration of 1.03 × 1012 g.c./mL (genome copies/mL) of rAAV8-Tlcd3b, the treated RE (Fig. 2) had significant improvements in both the scotopic and photopic b-wave responses, indicating functional improvement in cone photoreceptor cells and phototransduction/inner retinal neurons’ response. Nevertheless, an earlier treatment at P21 had a slightly better rescue efficacy than the later treatment at P120 (Supplementary Fig. S2A).
Figure 2.
ERG analysis demonstrated functional improvement in 7-month-old rAAV8-Tlcd3b–treated Tlcd3b mice injected at (A) P21 and (B) P120. Two-way ANOVA tests on electroretinography on (A) P21- and (B) P120-injected 7-month-old mice showed unaffected scotopic a-wave (P = 0.67 for P21-injected mice; P = 0.42 for P120-injected mice) and significantly elevated scotopic (P = 0.01 for P21-injected mice; P = 0.03 for P120-injected mice) and photopic b-waves (P = 0.003 for P21-injected mice; P = 0.008 for P120-injected mice) in AAV-treated RE (blue lines) compared with untreated, PBS-injected LE (red lines). In addition, results of untreated wild-type (WT) age-matched mice (black line) are included for comparison, and there was no significant difference between the a-wave and b-wave amplitudes of WT and AAV-injected mice for both P21- and P120-treated groups. Significance at each luminescence was determined by Student's t-test. Error bars denote the SEM. NS, not significant; wild-type versus PBS-injected (*P < 0.05) and PBS-injected versus AAV-treated (#P < 0.05). AAV-treated RE (blue line), PBS-treated LE (red line), and WT control (black line).
ERG analysis demonstrated functional improvement in 7-month-old rAAV8-Tlcd3b–treated Tlcd3b mice injected at (A) P21 and (B) P120. Two-way ANOVA tests on electroretinography on (A) P21- and (B) P120-injected 7-month-old mice showed unaffected scotopic a-wave (P = 0.67 for P21-injected mice; P = 0.42 for P120-injected mice) and significantly elevated scotopic (P = 0.01 for P21-injected mice; P = 0.03 for P120-injected mice) and photopic b-waves (P = 0.003 for P21-injected mice; P = 0.008 for P120-injected mice) in AAV-treated RE (blue lines) compared with untreated, PBS-injected LE (red lines). In addition, results of untreated wild-type (WT) age-matched mice (black line) are included for comparison, and there was no significant difference between the a-wave and b-wave amplitudes of WT and AAV-injected mice for both P21- and P120-treated groups. Significance at each luminescence was determined by Student's t-test. Error bars denote the SEM. NS, not significant; wild-type versus PBS-injected (*P < 0.05) and PBS-injected versus AAV-treated (#P < 0.05). AAV-treated RE (blue line), PBS-treated LE (red line), and WT control (black line).As significantly improved ERGs are observed at 7 months old for both P21- and P120-treated Tlcd3b mutant mice using a concentration of 1.03 × 1012 g.c./mL, we also tested if the rescue effect is dosage dependent. Treatment with a dosage of 1.03 × 1011 g.c./mL showed slightly increased scotopic and photopic b-wave amplitudes in treated REs compared to PBS-injected LEs, while the 1.03 × 1010 g.c./mL treatment showed no significant improvement in ERG b-waves (Supplementary Fig. S3). Similarly, a treatment dosage of 1.03 × 1012 g.c./mL also demonstrated the best rescue effect in terms of retinal morphology, as evident by most significantly increased ONL thickness (Supplementary Fig. S4). Based on these results, the dosage of 1.03 × 1012 g.c./mL was used for all subsequent experiments.
Targeted Expression of Tlcd3b in Photoreceptor Cells Rescues the Degeneration Phenotype Due to Tlcd3b Mutation
Consistent with the improved performance of the photoreceptors and interneurons measured by ERGs, a significant morphologic preservation was observed in P21 or P120 rAAV8-Tlcd3b–treated Tlcd3b mice. At 7 months old, Tlcd3b mice (indicated by untreated LE) exhibited significant overall retinal thickness reduction and ONL thinning compared to the wild-type control (Figs. 3A, 3B). H&E staining of retinal sections at 7 months old showed that treatments at P21 and P120 both led to significant improvements in retinal morphology (P = 0.006 for P21-treated group and P = 0.01 for P120-treated group), as evident by the preservation of photoreceptor cell nuclei in the ONL (Figs. 3A, 3B). There was about a 20% reduction in the ONL thickness of the untreated LE of Tlcd3b mice compared to the wild-type control. In contrast, the ONL thickness of P21-treated RE retinas (Fig. 3C) was at approximately 95% of the wild type, while the ONL thickness of P120-treated RE retinas (Fig. 3D) also had only a 10% reduction compared to the wild-type retina, indicating successful preservation of photoreceptor in treated mutant mice.
Figure 3.
Preservation of photoreceptor morphology in treated Tlcd3b mice at 7 months old. Hematoxylin and eosin staining of paraffin-embedded retinal sections was performed to assess morphologic changes in the untreated LE and treated RE of 7-month-old Tlcd3b mice that were injected at (A) P21 and (B) P120. Scale bar: 50 µm. The butterfly plot includes ONL thickness measured from 18 equally spaced positions along the vertical median of the retina collected 6 months after P21 injection (C) and 3 months after P120 injection (D). Each dot represents an individual data point plotted over mean ± SEM. Position 0 corresponds to the optic nerve head. Error bars denote the SEM. Wild-type versus AAV-injected (*P < 0.05) and PBS-injected versus AAV-treated (#P < 0.05). For both P21- and P120-treated mice, no significant difference between the ONL thickness of AAV-treated RE and age-matched WT controls. AAV-treated RE (blue line), PBS-treated LE (red line), and WT control (black line).
Preservation of photoreceptor morphology in treated Tlcd3b mice at 7 months old. Hematoxylin and eosin staining of paraffin-embedded retinal sections was performed to assess morphologic changes in the untreated LE and treated RE of 7-month-old Tlcd3b mice that were injected at (A) P21 and (B) P120. Scale bar: 50 µm. The butterfly plot includes ONL thickness measured from 18 equally spaced positions along the vertical median of the retina collected 6 months after P21 injection (C) and 3 months after P120 injection (D). Each dot represents an individual data point plotted over mean ± SEM. Position 0 corresponds to the optic nerve head. Error bars denote the SEM. Wild-type versus AAV-injected (*P < 0.05) and PBS-injected versus AAV-treated (#P < 0.05). For both P21- and P120-treated mice, no significant difference between the ONL thickness of AAV-treated RE and age-matched WT controls. AAV-treated RE (blue line), PBS-treated LE (red line), and WT control (black line).As Tlcd3b mice were reported to have a 30% loss of cones in mutant retinas compared with wild-type retinas at 7 months old, we also looked at cone photoreceptors to examine if cone cells are well preserved in the treated mutant mice. Retinal cross sections of the treated REs of Tlcd3b mice showed well-preserved cone outer and inner segments and axon terminal morphology, as well as an increased number of cones in both the inner and outer segments compared with that of the untreated LE retina (Figs. 4A–D). We also conducted peanut agglutinin (PNA) staining on retinal wholemounts to accurately determine the cone degeneration phenotype. Overall, there was a significantly increased number of PNA-positive cone cells 6 months after subretinal injection at P21 (Figs. 4E, 4F), as the cone cell density was increased by approximately 33% in the treated RE retina compared to the untreated LE retina. Similarly, the number of PNA-positive cone cells significantly increased by approximately 22% in the 7-month-old P120-injected Tlcd3b mice (Figs. 4E, 4F).
Figure 4.
Assessment of cone morphology preservation in 7-month-old rAAV8-Tlcd3b–treated Tlcd3b mice. Immunofluorescent staining of cone arrestin (red; A, B) and PNA (green; C, D) on cross sections of representative contralateral untreated LE and treated RE of Tlcd3b mouse retina at 6 months postinjection performed on (A, C) P21 and (B, D) 3 months postinjection performed on P120. (E) In 7-month-old P21- and P120-injected Tlcd3b mice, PNA staining (green) shows loss of cones compared with wild type in retinal whole mounts. Scale bar: 20 µm. (F) Cones were counted in the dorsonasal (DN), dorsotemporal (DT), ventronasal (VN), and ventrotemporal (VT) regions of (E) PNA-stained (green) retinal whole mounts of treated RE (n = 4) and untreated LE (n = 4) and then expressed as average number of cones per mm2 (mean ± SEM). *P < 0.05, **P < 0.01, ***P < 0.001. IS, inner segment; OS, outer segment.
Assessment of cone morphology preservation in 7-month-old rAAV8-Tlcd3b–treated Tlcd3b mice. Immunofluorescent staining of cone arrestin (red; A, B) and PNA (green; C, D) on cross sections of representative contralateral untreated LE and treated RE of Tlcd3b mouse retina at 6 months postinjection performed on (A, C) P21 and (B, D) 3 months postinjection performed on P120. (E) In 7-month-old P21- and P120-injected Tlcd3b mice, PNA staining (green) shows loss of cones compared with wild type in retinal whole mounts. Scale bar: 20 µm. (F) Cones were counted in the dorsonasal (DN), dorsotemporal (DT), ventronasal (VN), and ventrotemporal (VT) regions of (E) PNA-stained (green) retinal whole mounts of treated RE (n = 4) and untreated LE (n = 4) and then expressed as average number of cones per mm2 (mean ± SEM). *P < 0.05, **P < 0.01, ***P < 0.001. IS, inner segment; OS, outer segment.
Long-Term Rescue Efficiency of rAAV8-Tlcd3b–Mediated Gene Therapy in Tlcd3b−/− Mice
Both P21- and P120-treated Tlcd3b mice were examined at the 1-year time point to assess the long-term rescue potential of rAAV8-Tlcd3b gene therapy treatment. Functional improvement was consistently observed at 1 year, as measured by ERGs in dark-adapted Tlcd3b mice (Figs. 5A, 5B). In 1-year-old Tlcd3b mice, LEs exhibited a significantly reduced a-wave amplitude compared to the wild type, indicating significant rod photoreceptor dysfunctions at the late stage. Both scotopic and photopic b-wave responses of LEs were further diminished compared to those at 7 months old. REs of both P21 and P120 Tlcd3b mice demonstrated significantly increased a-wave and b-wave amplitudes compared to LEs, indicating successful preservation of photoreceptor and interneuron functions up to 1 year.
Figure 5.
Long-term rescue efficiency of rAAV8-Tlcd3b–mediated gene therapy in Tlcd3b mice. Two-way ANOVA analysis on ERG data demonstrated functional improvement in RE (blue line) compared with the LE (red line) of both (A) P21-injected and (B) P120-injected 1-year-old Tlcd3b mice, as indicated by the significantly elevated scotopic (P = 0.004 for P21-injected mice; P = 0.01 for P120-injected mice) and photopic b-waves (P = 0.0001 for P21-injected mice; P = 0.006 for P120-injected mice) in the treated eyes compared with the untreated eyes. Significance at each luminescence was determined by Student's t-test. Error bars denote the SEM. Wild-type versus PBS-injected (*P < 0.05) and PBS-injected versus AAV-treated (#P < 0.05). Hematoxylin and eosin staining of paraffin-embedded retinal sections from 1-year-old treated Tlcd3b mice injected at (C) P21 and (E) P120 demonstrated photoreceptor preservation in the treated RE compared to the untreated LE. The butterfly plot includes ONL thickness measured from 18 equally spaced positions along the vertical median of the retina collected (D) 6 months after P21 injection and (F) 3 months after P120 injection. Each dot represents an individual data point plotted over mean ± SEM. Cone arrestin staining of paraffin-embedded retinal sections from 1-year-old treated Tlcd3b mice injected at (G) P21 and (H) P120 demonstrated cone photoreceptor preservation in the treated RE compared to the untreated LE. Position 0 corresponds to the optic nerve head. Error bars denote the SEM. Scale bar: 20 µm.
Long-term rescue efficiency of rAAV8-Tlcd3b–mediated gene therapy in Tlcd3b mice. Two-way ANOVA analysis on ERG data demonstrated functional improvement in RE (blue line) compared with the LE (red line) of both (A) P21-injected and (B) P120-injected 1-year-old Tlcd3b mice, as indicated by the significantly elevated scotopic (P = 0.004 for P21-injected mice; P = 0.01 for P120-injected mice) and photopic b-waves (P = 0.0001 for P21-injected mice; P = 0.006 for P120-injected mice) in the treated eyes compared with the untreated eyes. Significance at each luminescence was determined by Student's t-test. Error bars denote the SEM. Wild-type versus PBS-injected (*P < 0.05) and PBS-injected versus AAV-treated (#P < 0.05). Hematoxylin and eosin staining of paraffin-embedded retinal sections from 1-year-old treated Tlcd3b mice injected at (C) P21 and (E) P120 demonstrated photoreceptor preservation in the treated RE compared to the untreated LE. The butterfly plot includes ONL thickness measured from 18 equally spaced positions along the vertical median of the retina collected (D) 6 months after P21 injection and (F) 3 months after P120 injection. Each dot represents an individual data point plotted over mean ± SEM. Cone arrestin staining of paraffin-embedded retinal sections from 1-year-old treated Tlcd3b mice injected at (G) P21 and (H) P120 demonstrated cone photoreceptor preservation in the treated RE compared to the untreated LE. Position 0 corresponds to the optic nerve head. Error bars denote the SEM. Scale bar: 20 µm.Besides retaining photoresponses, Tlcd3b mouse REs also maintained a better retinal morphology, as measured by histologic analyses (Figs. 5C–H). In 1-year-old Tlcd3b mice, the LE retina ONL was further reduced to 60% of the wild-type retina ONL, suggesting a progressive photoreceptor degeneration after the degeneration onset at 7 months old (Figs. 5C–F). Both P21- and P120-treated RE retinas of Tlcd3b mice, however, demonstrated a significantly thicker ONL compared to the untreated LEs, indicating significant retention of the photoreceptor integrity after prolonged treatment. Additionally, cone cells were better preserved in outer and inner segments as well as at synaptic terminals of the treated RE retina compared to the untreated LE retina of 1-year-old Tlcd3b mice (Figs. 5G, 5H), indicating that the rAAV-Tlcd3b treatment is capable of long-term preservation of cone photoreceptors for at least 11 months after treatment.Despite the normal scotopic a-wave and impaired scotopic b-wave responses, Tlcd3b mice had an insignificant thinning of the inner nuclear layer across the retina at 7 months of age, and no significant changes were observed for cell number or morphology of rod-bipolar cells. Although at both 7 month-old (7M) and 12 month-old (12M), Tlcd3b mice did not show significant changes in rod-bipolar cell morphology (Supplementary Fig. S5), it was evident that RIBEYE immunoreactive spots greatly decreased, indicating a loss of contact between photoreceptor and bipolar cells at 12M (Supplementary Fig. S5B). Meanwhile, both the P21 and P120 gene therapy treatments led to a better preservation of synapses, as evident by the more robust RIBEYE staining in the AAV-treated RE compared to the contralateral control eye (Supplementary Fig. S5).In terms of long-term rescue efficiency, although we observed successful preservation in both treatment groups, it is evident that an earlier treatment at P21 had a better rescue potential at 1 year old compared to the later treatment at P120, as indicated by more improved photoresponses (Supplementary Fig. S2B) and a better-preserved retinal morphology. The ONL thickness of P21-treated RE retinas was at approximately 90% of the wild type (Fig. 5D), which did not differ much from the results at 7 months old (Fig. 3C). The ONL thickness of P120-treated RE retinas (Fig. 5F), however, only maintained approximately 78% of the wild-type retina.
rAAV8-Tlcd3b–Mediated Gene Therapy Recovers the Level of Different Ceramide Species in Tlcd3b Mice
To investigate whether the rAAV8-Tlcd3b gene therapy alters the sphingolipid composition in the retina, we performed mass spectrometry analyses of different ceramide subtypes and sphingosine in retinas of LEs and REs of P21-injected Tlcd3b mice (Fig. 6). Consistent with the idea that TLCD3B functions as a ceramide synthase, in Tlcd3b mice, the levels of Cer16:0, Cer18:0, and Cer20:0 ceramides were significantly reduced compared to the wild-type control (Fig. 6). rAAV8-Tlcd3b–mediated gene therapy at a dosage of 1.03 × 1012 g.c./mL led to a significant increase in the total ceramide level of AAV-injected RE retinas to approximately 90% of that of wild-type control. Specifically, when comparing the treated REs to the PBS-injected LE retina of Tlcd3b mice, we observed a significant increase in the level of Cer16:0, Cer18:0, and Cer20:0 ceramides to a level comparable to that of the control. Additionally, exogenous TLCD3B expression did not affect the level of sphingosine as well as other ceramide subtypes, indicating that rAAV8-Tlcd3b gene therapy specifically targets Cer16–20 and restores their normal level in the retina.
Figure 6.
Mass spectrometric analyses of ceramide species and sphingosine in the retina of Tlcd3b mice that were treated with rAAV8-Tlcd3b gene therapy. All retinas were collected when the P21-injected mice reached 3 months old. Noninjected wild-type mice were used as the external control. The level of sphingolipids was normalized to the total protein content in each sample. All values are mean ± SEM, and significance was determined by Student's t-test. *P < 0.05, **P < 0.005, ***P < 0.001.
Mass spectrometric analyses of ceramide species and sphingosine in the retina of Tlcd3b mice that were treated with rAAV8-Tlcd3b gene therapy. All retinas were collected when the P21-injected mice reached 3 months old. Noninjected wild-type mice were used as the external control. The level of sphingolipids was normalized to the total protein content in each sample. All values are mean ± SEM, and significance was determined by Student's t-test. *P < 0.05, **P < 0.005, ***P < 0.001.
Discussion
Our results demonstrated that rAAV8-Tlcd3b–mediated gene replacement therapy alleviated both impaired retinal function and photoreceptor degeneration. In addition, preservation of ERG responses and increased photoreceptor survival were observed in mice up to 1 year of age after just one round of treatment at P21 or P120, indicating that this treatment is effective over a wide treatment time window, even after a prolonged period of time. This strong effect of rAAV8-Tlcd3b gene therapy can likely be attributed to the high transduction rate, robust expression, and proper localization of rAAV8-Tlcd3b in the photoreceptors. Taken together, our study provides strong preclinical evidence for the feasibility of using gene replacement therapies to treat TLCD3B patients by targeting photoreceptor cells.In contrast to endogenous TLCD3B expression, which is throughout the retina, exogenous rAAV8-Tlcd3b is only expressed in photoreceptor cells. Nevertheless, we observed substantial rescue of retinal degeneration for both treatment time points (P21 and P120) at two observation time points (7M and 12M), as demonstrated by the preservation of photoreceptor structure and function in mutant mice after the gene therapy. Therefore, photoreceptor cell–specific expression of Tlcd3b was sufficient to rescue the degenerative phenotypes presented by Tlcd3b mice, indicating that the primary function of Tlcd3b is in photoreceptors while rod-bipolar cell dysfunction might be secondary of photoreceptor degeneration.Tlcd3b mice were treated at two different time points, P21 and P120. The two time points are both before the degeneration onset at 7 months old. Nevertheless, compared to P120 treatments, P21 treatments have better therapeutic effects, both in terms of photoreceptor survival and retinal function improvement, which are more evident after a prolonged period. This observation could be explained by the fact that mild regional photoreceptor degeneration starts to present around 4 months old (data not shown), despite significant reductions in ONL thickness, and cone cells are not observed in Tlcd3b mice before 7 months old. As a result, a minority of photoreceptors that are already in their degenerative phase will have a comparatively worse condition to start with and hence end up with a more impaired function and morphology compared to the majority of cells that move slowly into degeneration and/or be less responsive to the gene replacement therapy given their disrupted local environment.,, It is also likely that it is harder to infect the photoreceptors of middle-aged mice (P120) than young mice (P21).In this study, we also validated TLCD3B's role as a ceramide synthase in vivo, as Tlcd3b mice demonstrated a significant reduction in the levels of C16-, C18-, and C20-ceramides, which agrees with what was shown by the in vitro TLCD3B study. TLCD3B has been demonstrated to be the most highly expressed ceramide synthase in the retina relative to other six canonical ceramide synthases, and the importance of ceramide homeostasis in retinal neurons has been implicated in several studies.– Here, we demonstrated that a reduction in ceramide levels also triggers photoreceptor cell death, leading to retinal degeneration. The photoreceptor degeneration phenotype is sensitive to the ceramide levels as stronger rescue is observed when a higher dosage of rAAV8-Tlcd3b is used. The downregulation of TLCD3B, aside from leading to a reduced level of ceramides in general, also contributes to a shift in the retinal ceramide species ratio, further disrupting sphingolipid homeostasis in the retina. Acting as a metabolic hub within the highly complex network of interconnected sphingolipid metabolism pathways, ceramide occupies a central position in both biosynthesis and catabolism. The disruption of ceramide profiles in the retina may lead to complicated downstream impact in terms of different sphingolipids involved, such as sphingosine-1-phosphate, ceramide-1-phosphate, and sphingomyelin, and the downregulation or upregulation of each sphingolipid species has its specific impact. Future studies will examine the role of TLCD3B in ceramide and sphingolipid synthesis pathways and its involvement in the maintenance of photoreceptor function and survival.In conclusion, our results highlight the success of the first rAAV8-Tlcd3b–based gene therapy in Tlcd3b mouse models of retinopathy. In particular, Tlcd3b mice showed preservation of the photoresponses as well as a higher survival rate of photoreceptor cells, at both 7 months and 1 year old, demonstrating the prolonged effectiveness of rAAV8-Tlcd3b treatment. Findings from this study show that gene replacement therapy in the retina with rAAV8-Tlcd3b can improve photoreceptor function in Tlcd3b mice, extend survival of photoreceptors in vivo, and be potentially used as a therapeutic target for the treatment of patients with retinopathies.
Authors: Richard G Weleber; Mark E Pennesi; David J Wilson; Shalesh Kaushal; Laura R Erker; Lauren Jensen; Maureen T McBride; Terence R Flotte; Margaret Humphries; Roberto Calcedo; William W Hauswirth; Jeffrey D Chulay; J Timothy Stout Journal: Ophthalmology Date: 2016-04-19 Impact factor: 12.079
Authors: Lihong Zhao; Stefka D Spassieva; Thomas J Jucius; Leonard D Shultz; H Elizabeth Shick; Wendy B Macklin; Yusuf A Hannun; Lina M Obeid; Susan L Ackerman Journal: PLoS Genet Date: 2011-05-19 Impact factor: 5.917
Authors: Laurence M Occelli; Christian Schön; Mathias W Seeliger; Martin Biel; Stylianos Michalakis; Simon M Petersen-Jones Journal: Hum Gene Ther Date: 2017-12 Impact factor: 5.695
Authors: Marija Mihelec; Rachael A Pearson; Scott J Robbie; Prateek K Buch; Selina A Azam; James W B Bainbridge; Alexander J Smith; Robin R Ali Journal: Hum Gene Ther Date: 2011-08-10 Impact factor: 5.695