Proteasome Activator Blm10 Regulates Transcription Especially During Aging.

Background: Histones are basic elements of the chromatin and are critical to controlling chromatin structure and transcription. The proteasome activator PA200 promotes the acetylation-dependent proteasomal degradation of the core histones during spermatogenesis, DNA repair, transcription, and cellular aging and maintains the stability of histone marks. Objective: The study aimed to explore whether the yeast ortholog of PA200, Blm10, promotes degradation of the core histones during transcription and regulates transcription especially during aging.
Methods: Protein degradation assays were performed to detect the role of Blm10 in histone degradation during transcription. mRNA profiles were compared in WT and mutant BY4741 or MDY510 yeast cells by RNA-sequencing.
Results: The core histones can be degraded by the Blm10-proteasome in the non-replicating yeast, suggesting that Blm10 promotes the transcription-coupled degradation of the core histones. Blm10 preferentially regulates transcription in aged yeast, especially transcription of genes related to translation, amino acid metabolism, and carbohydrate metabolism. Mutations of Blm10 at F2125/N2126 in its putative acetyl-lysine binding region abolished the Blm10-mediated regulation of gene expression.
Conclusion: Blm10 promotes degradation of the core histones during transcription and regulates transcription, especially during cellular aging, further supporting the critical role of PA200 in maintaining the stability of histone marks from the evolutionary view. These results should provide meaningful insights into the mechanisms underlying aging and the related diseases.

INTRODUCTION

Proteasomes are responsible for the selective degradation of most intracellular proteins in eukaryotes and participate in the regulation of almost all cellular activities, including transcription, cell cycle, DNA repair, and apoptosis. Proteasomes are composed of the 20S catalytical core particle and the regulatory particle or proteasome activators, such as 19S/PA700, PA28/REG, or PA200. The 19S regulatory particle promotes the degradation of the polyubiquitinated proteins. Among PA28 activators, PA28α and PA28β participate in the MHC-I antigen presentation [1, 2], and PA28γ mediates the degradation of certain proteins in a manner independent of ubiquitin [3-7]. PA200 promotes degradation of the acetylated core histones during DNA repair, male meiosis, spermiogenesis, transcription and aging [8-11]. In addition, the yeast ortholog of PA200, Blm10, has been reported to maintain mitochondrial and ribosomal homeostasis and to antagonize aging in addition to promoting histone degradation [10, 12-14].

Histones are in the highly dynamic equilibrium, which is strictly and precisely regulated [15]. Otherwise, excess or defective histones result in DNA damage, genomic instability, and abnormal transcription [16-18]. Histones are mainly synthesized in the S phase of the cell cycle, though a small amount might be synthesized in the G1/G0 phase [16]. The compacted structure of chromatin is repressive to transcription. Thus, histones must be disassembled at actively transcribed regions [19, 20]. During active transcription, histone chaperone Spt6 facilitates H3-H4 tetramer evicted from chromatin, while FACT disrupts H2A-H2B dimers [21-23]. The proteasome activator PA200 also maintains the stability of histone marks during transcription and cellular aging [8, 10]. Cellular aging is accompanied by a progressive decline in the function of cells and is a durable cell-cycle arrest of previously replication-competent cells [24]. Here, we show that Blm10 promotes degradation of the core histones during transcription and regulates transcriptome, especially during cellular aging. These results further support the critical role of PA200 in maintaining the stability of histone marks from the evolutionary aspect.

MATERIALS AND METHODS

Yeast Strains Used in this Study

Yeast strains used in this work are listed in Table . Mutant strains were constructed as described [8, 25].

Table 1

Yeast strains used in this study.

Strain	Genotype	Source
BY4741	MATa his3D1 leuD0 met15D0 ura3D0	Wei Li
YHS539	MATa his3D1 leuD0 met15D0 ura3D0(BY4741) yak1-GFP (kan), blm10::Nat hat9	Daniel Finley
BY4741ATG7-KO	MATa BY4741 atg7::hph	This study
BY4741Rpn4-KO	MATa lys2-801 leu2-3,2-112 ura3-52 his3- ∆200 trp1-1 rpn4::Nat	This laboratory
BY4741Blm10-O/E	MATa BY4741 blm10::NAT GPD-HA-Blm10	This laboratory
MDY510	MATa lys2-801 trp1D63 his3D200 leu2D1hht1-hhf1::pWZ405-F2F9-LEU2hht2-hhf2::pWZ403-F4F10-HIS3[pNOY439 (CEN6 ARS4 TRP1 MYC-HHT2-HHF2)]URA3::YIpGAL1/10-HHF1-HHT1 Bar1D::KanR	Oliver Rando
MDY510Blm10-O/E	MATa MDY510 blm10::NAT GPD-HA-Blm10	This laboratory
MDY510Blm10-KO	MATa MDY510 yak1-GFP::Kan blm10∆::NAT	This laboratory

Histone Degradation Assay

Pulse-chase analysis was adapted to determine histone degradation as described previously [10, 26, 27]. Yeast cells were arrested in the G1 phase with alpha factor for 4 h,metabolically labelled with 0.14 mM of azidohomoalanine (Aha, an analog of Met) for 4 h, and then chased in 0.14 mM Met-containing medium for indicated periods of time. DNA content in each group (10000 cells) was analyzed by FACS analysis with propidium iodide staining [28]. The yeast nuclei were extracted and labeled with biotin-alkyne (Invitrogen). Histones were prepared by acid extraction as described [10, 29]. The biotin-alkyne-labeled histones were captured by Dynabeads Streptavidin T1 (Invitrogen), boiled with 1.2 X SDS buffer for 6 minutes at 97°C, and analyzed by immunoblotting.

Quantitative PCR

Quantitative PCR was performed with the SYBR Select Master Mix (Thermo Fisher Scientific) according to the manufacturer’s instructions, and analyzed on the ABI 7500 Real- Time PCR machine. Primers used in this work are listed in Table .

Table 2

Primers used in this study.

Primer	Sequence
HSP12	F: GGTGTCTTCCAAGGTGTCCACGACTCTGR: CATATTCGACGGCATCGTTCAACTTGGA
HSP82	F: AGCAACGACGACGAACAATACATCTGGG R: GGATTGGGTAGGCCACGAACTCAGAATG
SSA4	F: GGAGCCAGTGGAAAAAGTTTTGGCTG R: CACCCGTTAAGATGGCAGCCTGTACG
Tubulin	F: ACAGTTGATCAGTGGTAAGGAGGACGCGR: GACCCTAGACCGGAACCAGTACCACCAC
FEN1	F: TAAGACAGCAAGACGGTGGGCAR: ATCTGGAGGTTTGCCGTCGAAG
GDH1	F: CTCCGCCAAGGGTCCATACAR: ACCCATGTCTAGGCCGGTCA
MEP2	F: GCTGCTTGCGGTGGCTTGACR: CAGATTGGCACGAACCCGGC
SUL2	F: GGCCCGTGGCTGTCATGTCTR: AGAAGCCAACTGCTGCCGAAA
MET3	F: GCCTGCTCCTCACGGTGGTAR: GGATGGTCCACAATGTGCCG
MET5	F: CAAGAAGCCCAGCGTGAAGAAR: TCGTCAAGATCGCGTCCATTG
MET6	F: TTGGAAGCCAAGGAGTTAGGGTR: GTGTATAGAGGCAACAATTGTTCCAA
MET14	F: ACGACGAACGCAAGGCATTGR: CCAAAACGAATGTTGTCACCATCC
MET17	F: AACTACACGCCGGCCAAGAGR: GTTGGGTTTTGGAAACGGGA

RNA-seq Preparation and Data Processing

Yeast RNAs were prepared with hot phenol extraction method [30], and sequenced on Illumina BGISEQ-500 at Beijing Genomic Institution (www.genomics.org.cn, BGI, Shenzhen, China). Clean reads were aligned to the S. cerevisiae genome latest assembly version R64 genome. For gene expression analysis, the matched reads were calculated and then normalized to RPKM using RESM software [31]. The differential expression of genes was defined by the bioinformatics service of BGI according to the combination of the absolute value of log2-Ratio ≥1 and diverge probability≥0.8. Gene Ontology (GO) and pathway annotation/enrichment analyses were based on the Gene Ontology Database (http://www.geneontology.org/) and the KEGG pathway database (http://www.genome.jp/kegg/), respectively.

Replicative Life Span Analysis

Old yeast cells were isolated as described previously [32]. Yeast cells were labelled with EZ Link Sulfo-NHL-LC-LC-Biotin (Thermo Scientific), and captured by Dynabeads Streptavidin T1 (Invitrogen). The mean age of isolated cells was calculated by counting Calcofluor 28-stained bud scars as the replicative life span.

Statistical Analysis

One-way ANOVA was employed to compare values between multiple groups. Two-way repeated ANOVA was employed to compare multiple repeated measurements among groups. p values<0.05 were considered statistically significant.

RESULTS

Blm10 Promotes Degradation of Histones H3 and H4 in the G1-Arrested Yeast

We have recently shown that PA200 promotes degradation of the core histones during transcription and cellular aging [10]. To explore whether it is evolutionally conserved, we attempted to test the role of Blm10 in yeast. To analyze histone degradation during transcription in yeast, we first used the G1-arrested MDY510 yeast. The expression of Flag-tagged H3 was induced by supplying with galactose for 3 h, followed by replacement of galactose with glucose (Fig. and Fig. ). Then, Flag-H3 was analyzed by immunoblotting at various time points of incubation in the regular glucose-containing medium. Flag-H3 was degraded with time after release in glucose in the G1-arrested yeast, and deletion of Blm10 markedly reduced Flag-H3 degradation (Fig. ). To test whether endogenous histones are also degraded during transcription, we metabolically labeled proteins with a substitute of methionine (Met), azidohomoalanine (Aha), which was co-translationally incorporated into proteins and subsequently ligated with biotin. Thus, following replacement with the regular Met-containing medium, old histones with Aha were purified by using streptavidin for analysis of degradation. In the G1-arrested yeast (Fig. ), the levels of histone H4 decreased during chase in regular medium (Fig. ), and deletion of Blm10 dramatically suppressed H4 degradation. Probably due to species difference of the core histones, the degradation rates of Flag-H3 and H4 were slightly varied, though they were generally similar. In comparison, deletion of Rpn4, a key component of the 19S regulatory particle of the 26S proteasome, had almost no effect on H4 degradation. Macroautophagy, which requires the autophagic gene ATG7, has been reported to remove cytosolic soluble histones [33]. We used the acid extraction method to isolate the core histones from the chromatin fraction and to exclude the influence of the cytosolic fraction [29]. Deletion of ATG7 had no effect on the degradation of chromatin histones (Fig. ). Tatehashi 34]. These results demonstrate that the core histones can be degraded by the Blm10-proteasome in the non-replicating yeast, suggesting that Blm10 promotes the transcription-coupled degradation of the core histones.

Fig. (1)

Blm10 promotes degradation of histones H3 and H4 in the G1-arrested yeast. (A) The MDY510 yeast cells were arrested in G1 phase with 4 μg/ml alpha factor for 3.0 h or 4.5 h. DNA content was analyzed by FACS analysis with propidium iodide staining. 10000 cells were collected for analysis in each group. The percentages of G1 phase WT or Blm10Δ cells synchronized for 4.5 h were 74%~ 77% in comparison to 22-23% in unsynchronized cells. There was a sub-G1/G0 peak, whose percentages were less than 5%. (B) The G1-arrested MDY510 yeast cells were induced by 4 μg/ml galactose for 3.0 h, and then chased in the glucose-containing medium. The induced Flag- tagged H3 was analyzed by immunoblotting. (C) The histone levels in (B) were quantified by densitometry (normalized to those of tubulin). * p<0.05, ** p<0.01. (D) BY4741 yeast cells were arrested in G1 phase with alpha factor for 4 h, metabolically labelled with 0.14 mM of Aha for 4 h, and then chased in 0.14 mM Met-containing medium for 2 h. DNA content was analyzed by FACS analysis with propidium iodide staining. 10000 cells were collected for analysis in each group. The percentages of G1 phase WT or Blm10Δ cells following synchronization were 72%~ 76% in comparison to 32-38% in unsynchronized cells. (E) The G1-arrested BY4741 yeast cells were pulse-labeled with Aha, and then chased in the Met-containing medium. Histones were captured by streptavidin beads and analyzed by immunoblotting. (F) The histone levels in (E) were quantified by densitometry (normalized to the corresponding input histones). * p<0.05, ** p<0.01. (A higher resolution / colour version of this figure is available in the electronic copy of the article).

Blm10, but not its BRDL Mutant, Suppresses HSP12 Expression

Upon heat shock treatment, yeast heat shock response gene HSP12 was activated rapidly as reported previously [35] (Fig. ). In order to test whether Blm10 is involved in the transcriptional regulation of HSP12, we performed heat shock treatment of wild type (WT), Blm10-overexpressing (Blm10 O/E), and Blm10-deficient (Blm10 Δ) yeast cells. Overexpression of Blm10 inhibited the expression of HSP12 (Fig. ). Consistent with the RNA-seq data obtained later, the inhibition was observed at 0 point (Fig. ). We showed previously that the bromodomain-like region of Blm10 recognizes acetyl-histones [8]. Mutation of BRDL at F2125S/N2126D abolished the inhibitory effect of Blm10 on HSP12 expression (Fig. ). Accordingly, deletion of Blm10 promoted expression of HSP12 (Fig. ). Then, we analyzed two other heat-responsive genes, and . Blm10 deletion increased the expression levels of , but overexpression of Blm10 had no significant effect on the expression of this gene. Neither deletion nor overexpression of Blm10 influenced the expression of (Fig. and ). In addition, neither overexpression nor deletion of Blm10 had any effect on the expression of Flap structure-specific Endonuclease 1 (FEN1) (Fig. ), which is not differentially expressed in the results obtained later by RNA-sequencing. These results suggest that Blm10 selectively regulates the expression of certain genes in an acetylation-dependent manner.

Fig. (2)

Blm10, but not its BRDL mutant, suppresses HSP12 expression. (A) BY4741 WT yeast cells were stimulated at 39°C for indicated periods of time. HSP12 mRNA levels were analyzed by quantitative PCR (normalized to tubulin). (B) WT, Blm10 O/E, Blm10 O/E (F2125S/N2126D), and Blm10Δ BY4741 yeast cells were stimulated at 39°C for indicated periods of time. HSP12 mRNA levels were analyzed by quantitative PCR (normalized to tubulin). * p<0.05, ** p<0.01. (C) HSP12 mRNA levels were analyzed by quantitative PCR (normalized to tubulin) in WT, Blm10 O/E, Blm10 mutant (F2125S/N2126D), and Blm10Δ BY4741 yeast cells. * p<0.05, ** p<0.01. (D-E) ( (<0.05. ( FEN1 mRNA levels were analyzed by quantitative PCR (normalized to tubulin) in WT, Blm10 O/E, and Blm10Δ BY4741 yeast cells. (A higher resolution / colour version of this figure is available in the electronic copy of the article).

Blm10 Regulates Transcription in G1-arrested Yeast

To systematically analyze the role of Blm10 in regulating gene expression, we performed RNA-sequencing in the G1-arrested WT, Blm10 O/E, and Blm10 Δ BY4741 yeast strain. The matched reads in gene expression analysis were calculated and then normalized to RPKM (Fragments Per Kilobase per Million mapped fragments) using RESM software by the bioinformatics service of BGI [31]. Differential expression of genes was defined by the NoISeq method. In comparison to WT, Blm10 O/E had 48 differentially-expressed genes (DEGs), including 32 up-regulated and 16 down-regulated genes (Fig. ). Based on KEGG (Kyoto Encyclopedia of Genes and Genomes) database, the DEGs were classified through pathway enrichment analysis. The pathways regulated by Blm10 overexpression primarily include pyrimidine metabolism, glucose metabolism, biosynthesis of antibiotics, and metabolism of alanine, aspartate and glutamate Blm10Δ had a total of 92 DEGs with 12 up-regulated and 80 down-regulated genes (Fig. ). The pathways regulated by Blm10 deletion primarily include pyrimidine metabolism, amino acid metabolism, and RNA degradation 25 of them are regulated by both overexpression and deletion of Blm10 (Fig. ). Hierarchical clustering of DEGs in Blm10 O/E or Blm10Δ relative to WT reflected fold changes of these DEGs (Fig. ). Specifically, the expression levels of RNR3, TIR3, DAN1, PAU5, and HUG1 genes are significantly increased in the Blm10 O/E yeast cells but decreased in the Blm10Δ samples. The genes regulated by both overexpression and deletion of Blm10 are primarily involved in ribonucleotide metabolism, amino acid metabolism, anaerobic responses, carbohydrate metabolism, sterol transport, and DNA damage-related checkpoint (Fig. and ).

Fig. (3)

Blm10 regulates transcriptomes in G1-arrested yeast. (A) The numbers of DEGs in Blm10 O/E or Blm10Δ relative to WT BY4741 yeast. DEGs were defined according to the combination of the absolute gene expression of log2FoldChange ≥1 and diverge probability≥0.8. (B) Venn diagram of the common and unique DEGs in Blm10 O/E or Blm10 Δ relative to WT BY4741 yeast. (C) Hierarchical clustering of DEGs in Blm10 O/E or Blm10 Δ relative to WT BY4741 yeast. (D) KEGG pathway enrichment of DEGs in Blm10 O/E or Blm10 Δ relative to WT BY4741 yeast. (E) KEGG pathway classification of the up- or down-regulated DEGs in Blm10 O/E (left panel) or Blm10 Δ (right panel) relative to WT BY4741 yeast. DEGs were defined according to the combination of the absolute value of log2-Ratio ≥1 and diverge probability≥0.8. Coloring indicates the log2 transformed fold change. (A higher resolution / colour version of this figure is available in the electronic copy of the article).

As shown above, Blm10 regulates the expression of genes involved in amino acid metabolism in the BY4741 yeast strain, which is defective in the synthesis of several amino acids, including methionine. Therefore, we employed another strain of yeast, MDY510, which possesses the wild- type genes for methionine synthesis. Compared to wild-type MDY510 yeast, Blm10 O/E had 551 DEGs, including 169 up-regulated and 382 down-regulated genes, while Blm10Δ had a total of 44 DEGs with 16 up-regulated and 28 down-regulated genes (Fig. ). Hierarchical clustering of DEGs in Blm10 O/E or Blm10Δ relative to WT reflected fold changes of these DEGs (Fig. ). Both overexpression and deletion of Blm10 affected expression of the genes involved in amino acid metabolism, sulfur metabolism, and carbohydrate metabolism, including MEP2, DAL3, MET5, MET3, MET6, MET14, MET17/MET15, MET10, GDH1, and SUL2. These DEGs were markedly up-regulated in Blm10 O/E yeast but down-regulated in Blm10Δ yeast (Fig. and ). The genes involved in methionine synthesis were widely regulated. Consequently, Blm10 O/E yeast cells were more sensitive to methionine starvation, while Blm10Δ mutants were more sensitive to excess methionine (Fig. ). Apparently, due to the difference in their genetic backgrounds, many DEGs in the MDY510 yeast strain, including MEP2, DAL3, MET5, MET3, MET6, MET14, MET17/MET15, MET10, GDH1, and SUL2, were not found in BY4741 yeast strains (Fig. ). Taken together, Blm10 regulates the transcription of many genes in yeast transcriptomes, including those involved in methionine synthesis.

Fig. (4)

Blm10 regulates yeast transcriptomes, including genes involved in methionine synthesis, in G1-arrested MDY510 yeast cells. (A) The numbers of DEGs in Blm10 O/E or Blm10Δ relative to WT MDY510 yeast. DEGs were defined according to the combination of the absolute gene expression of log2FoldChange ≥1 and diverge probability≥0.8. (B) Hierarchical clustering of DEGs in Blm10 O/E or Blm10Δ relative to WT MDY510 yeast. (C) KEGG pathway enrichment of DEGs in Blm10 O/E or Blm10Δ relative to WT MDY510 yeast. DEGs were defined according to the combination of the absolute value of log2-Ratio ≥1 and diverge probability≥0.8. Coloring indicates the log2 transformed fold change. (D) Hierarchical clustering of common DEGs in Blm10 O/E or Blm10Δ relative to WT MDY510 yeast. Data represent two independent biological replicates. (A higher resolution / colour version of this figure is available in the electronic copy of the article).

Blm10 Regulates Transcription Preferentially During Cellular Aging

We have recently shown that Blm10 promotes histone degradation during aging and prolongs yeast replicative lifespan [10, 14]. Next, we analyzed the transcriptomes of WT, Blm10 O/E, and Blm10Δ BY4741 yeast cells at various ages. Consistent with our previous data, Blm10 extended yeast replicative lifespan (Fig. ). As reported [36-39], aging was associated with the up-regulation of genes mainly related to carbohydrate metabolism and antibiotics biosynthesis, and down-regulation of genes mainly related to the ribosome, purine metabolism, pyrimidine metabolism, and RNA polymerase (Fig. ). Hierarchical clustering of DEGs in Blm10 O/E or Blm10Δ relative to WT reflected fold changes of these DEGs (Fig. ). The number of DEGs increased dramatically during aging (Fig. ). Either overexpression or deletion of Blm10 affected the expression of far more genes in aged yeast, which were 16 h or 36 h old than that in young yeast. These genes are related to translation, transcription, amino acid metabolism, nucleotide metabolism, carbohydrate metabolism, protein folding/ degradation, and DNA repair. Particularly, translation-related genes are the most prominently affected by both overexpression and deletion of Blm10 at 36 h old. Overexpression of Blm10 resulted in down-regulated expression of 40 genes, whereas deletion of Blm10 caused up-regulated expression of 86 genes. However, both overexpression and deletion of Blm10 led to down-regulation of genes involved in carbohydrate and amino acid metabolism, most prominently at 16 h old. It has been reported that Blm10 represses ribosome gene expression [8]. Accordingly, almost all ribosome genes were up-regulated in Blm10Δ yeast (Fig. ). Thus, Blm10 regulates transcription preferentially in aged yeast.

DISCUSSION

Cellular aging is associated with DNA damage, proteasome dysfunction, histone loss, and histone mark alteration [14, 40, 41]. PA200 in mammals or its ortholog Blm10 in yeast promotes the acetylation-dependent degradation of the core histones during DNA repair or spermiogenesis [8]. We showed recently that loss of PA200 or Blm10 is the leading cause of the decline in proteasome activity during aging, and that yeast cells can antagonize aging by up-regulating transcription of Blm10 [14]. In another recent study, we reported that PA200 promotes the transcription-coupled proteasomal degradation of the core histones and maintains the stability of histone marks during transcription and aging [10, 14]. By using the protein degradation assay with the inducible expression of the Flag-tagged histone H3 or with the metabolic labelling of endogenous proteins, we demonstrate here that Blm10 promotes degradation of the core histones during transcription in yeast. In comparison, deletion of a key component of the 19S regulatory particle of the 26S proteasome had almost no effect on histone degradation. Macroautophagy has been reported to remove cytosolic soluble histones [33]. Deletion of the critical autophagic gene ATG7 could not inhibit the degradation of chromatin histones. Thus, the transcription-coupled histone degradation by the PA200/Blm10-proteasome is conserved evolutionarily.

We showed that Blm10 was critical to stability of transcriptomes, especially during cellular aging of yeast. Either overexpression or deletion of Blm10 regulated expression of far more genes in aged yeast than that in young yeast. These genes are related to transcription, amino acid metabolism, nucleotide metabolism, carbohydrate metabolism, protein folding/degradation and DNA repair. Regulation of amino acid metabolism by Blm10 suggests that Blm10 probably regulates translation. Although we conducted relatively extensive studies on methionine metabolism, the effect of Blm10 was probably not limited to methionine because Blm10 also held the metabolism of other amino acids, 13]. Accordingly, almost all ribosome genes were up-regulated in Blm10-deficient yeast as shown in this study.

CONCLUSION

Blm10 promoted degradation of the core histones during transcription and regulated transcription, especially during cellular aging. These results further support the critical role of PA200 in maintaining the stability of histone marks during transcription and aging from the evolutionary view. The aging-related changes in transcription could be caused by histone loss in yeast [42]. Histones are frequently evicted from the nucleosome and then re-assembled during transcription [28]. Certain mistakes in reassembling might happen during this nucleosome turnover, especially in the aged cells. Like PA200, Blm10 might play a critical role in eliminating the abnormally-assembled histone marks during transcription by promoting proteasomal degradation of the core histones, thus maintaining the stability of the transcriptome. Aging and various diseases are often associated with disrupted histone marks [43, 44]. Although other substrates of Blm10 are possibly involved, degradation of the core histones must play an important role in these Blm10-related activities. The results from this study should provide useful insights into the mechanisms underlying aging and the related diseases.