Single-cell transcriptomics reveals expression profiles of Trypanosoma brucei sexual stages.

Early diverging lineages such as trypanosomes can provide clues to the evolution of sexual reproduction in eukaryotes. In Trypanosoma brucei, the pathogen that causes Human African Trypanosomiasis, sexual reproduction occurs in the salivary glands of the insect host, but analysis of the molecular signatures that define these sexual forms is complicated because they mingle with more numerous, mitotically-dividing developmental stages. We used single-cell RNA-sequencing (scRNAseq) to profile 388 individual trypanosomes from midgut, proventriculus, and salivary glands of infected tsetse flies allowing us to identify tissue-specific cell types. Further investigation of salivary gland parasite transcriptomes revealed fine-scale changes in gene expression over a developmental progression from putative sexual forms through metacyclics expressing variant surface glycoprotein genes. The cluster of cells potentially containing sexual forms was characterized by high level transcription of the gamete fusion protein HAP2, together with an array of surface proteins and several genes of unknown function. We linked these expression patterns to distinct morphological forms using immunofluorescence assays and reporter gene expression to demonstrate that the kinetoplastid-conserved gene Tb927.10.12080 is exclusively expressed at high levels by meiotic intermediates and gametes. Further experiments are required to establish whether this protein, currently of unknown function, plays a role in gamete formation and/or fusion.

Introduction

The African tsetse-transmitted trypanosomes are single-celled parasites that cause human and animal diseases, which are a heavy burden for many countries in sub-Saharan Africa. These trypanosomes survive in both the tsetse and mammalian host by taking on distinct morphological forms that suit the diverse metabolic and immune environments they encounter [1]. When blood infected with Trypanosoma brucei is imbibed by the tsetse fly (genus Glossina), trypanosome blood stream forms (BSF) rapidly change their transcriptional profile, including switching off Variant Surface Glycoprotein (VSG) transcription and upregulating expression of other surface proteins such as procyclins [2,3] They also switch their metabolism from dependence on glucose processed via glycolysis in the glycosome to exploitation of amino acids such as proline via the mitochondrial TCA cycle [4]. Trypanosomes then multiply as procyclics in the fly midgut before migrating anteriorly, first colonising the proventriculus or cardia, the valve between the foregut and anterior midgut, and then the paired salivary glands () [5,6]. Here trypanosomes attach and proliferate as epimastigotes characterised by BARP surface proteins [7], before final differentiation into infective metacyclics that are inoculated into a new host via the saliva.

Additionally, the salivary glands are the location of the non-obligatory sexual cycle of T. brucei, which involves meiosis and the production of haploid gametes [8,9]. As trypanosomes are early diverging eukaryotes, their sexual processes are of particular interest because they provide insights into the evolution of sexual reproduction and meiosis. Although the morphologies of the meiotic division stages and gametes have been described [8-10], little is known about the transcriptional dynamics that characterise the sexual stages because these cells are a minority of the heterogenous cell population in the salivary glands. Sexual stages are found during the early phase of establishment of salivary gland infection, with numbers peaking about three weeks after fly infection [8,9]. The sexual cycle appears to be a sideshow in the normal mitotic developmental program, as it occurs in clonal trypanosome lines and does not need to be triggered by external factors such as the presence of another strain.

Single-cell RNAseq opens the door to study heterogenous populations of single-celled parasites by delineating expression patterns of individual cells allowing us to understand continuous developmental processes, cell-type specific patterns of co-expression and bet-hedging strategies [11-17]. Recent studies have profiled T. brucei populations using single-cell droplet-based approaches from BSF culture to profile the development of stumpy forms [18] as well as in vivo salivary gland parasites in order to identify a potential vaccine candidate among mature metacyclics [19] and the dynamics of VSG expression in the developing metacyclic parasites [20]. These studies complement the previous bulk transcriptomic studies in T. brucei that identified the major changes in transcriptional patterns over time and metacyclic development using either whole infected salivary glands or in vitro-derived metacyclics from the RBP6-inducible system [21-28]. Although these studies have been essential to our understanding of the dynamics of gene expression in T. brucei, we still lack an understanding of the molecular processing that characterize meiosis and sexual development in kinetoplastids.

Here we have exploited scRNAseq to investigate transcriptomes of the sexual stages of T. brucei that occur transiently in the heterogeneous trypanosome population in the fly salivary glands. We used a modified Smart-seq2 protocol [12,13,29] to profile T. brucei cells from different tsetse tissues (midgut, proventriculus, salivary glands) at different time points during development. We tied the observed transcriptomic profiles to specific developmental stages, validated by immunofluorescence, and identified cell-type specific markers, which revealed the dynamics of surface protein expression as well as a new candidate gene that may be involved in sexual development.

Results and discussion

Generation of high-quality transcriptomes from in vitro procyclic forms

To confirm that the modified Smart-seq2 protocol produces high-quality data for T. brucei, we initially profiled 46 single-cell transcriptomes from in vitro procyclic forms. We found a mean of 2.6x106 mapped reads per cell and a mean detection of 1756 genes per cell (, which is a greater number of genes per cell than recently published data from Hutchinson et al 2021 [20] that used a droplet-based method on the same parasite stage (1258 genes per cell). This further supports the use of Smart-seq2 to get in depth transcriptomes (high-coverage and full-length) in a low-throughput, targeted fashion compared to droplet-based methods that have fewer genes detected but are higher throughput [12,30]. Additionally, we observed high expression of genes that encode known procyclic surface antigens including GPEET and EP1-3 [2,31] ( These data support the utility of our protocol to profile single-cell expression profiles in kinetoplastids.

Transcriptomes of fly developmental stages

Having confirmed that the modified Smart-seq2 protocol would produce high-quality data from T. brucei in vitro procyclic forms, we profiled parasite transcriptomes isolated from diverse tsetse tissues at different timepoints, and from two T. brucei strains as outlined in . After quality control (, we obtained a total of 388 single-cell parasite transcriptomes: 78 from the midgut, 34 from the proventriculus and 276 from the salivary glands ( Parasites from all three tissues were isolated from flies infected with T. brucei strain 1738 dissected day 21 post infection (pi) and parasites from the salivary glands were additionally isolated at day 24 and 40 pi ( At days 21 and 24 pi, the tissues were incubated in media to release the free-swimming parasites, whereas at day 40 pi the cells were derived from free (spill-out from tissue) or attached (enzymatically disassociated) cell populations to capture metacyclics or attached epimastigotes and premetacyclics, respectively (. On day 24 pi, we aimed to analyse salivary gland parasites from an experimental cross between strains 1738 and J10. We isolated cells from single infections of each strain as well as co-infected tissue that contained both strains as well as a small number of hybrid progeny. We additionally used two cell preservation methods in the collection of these data to allow for more flexibility in processing time. Although small differences were observed in the number of genes detected between preservation methods and live cells, this was confounded by timepoint, preventing us from fully understanding the impact of the preservation and handling techniques alone ().

To understand transcriptional variation at the single-cell level across tissues, strains, and time, we performed dimensionality reduction with all 388 cells using UMAP ( We observed that cells grouped by their tissue of origin, with clusters representing midgut and proventriculus trypanosomes and two groups of salivary gland parasites that we hypothesized could represent different cell-types or stages ( This idea was supported by the distribution of time points across the two salivary gland groups with 21- and 24-day pi cells distributed throughout the two groups, while the 40-day pi cells (squares) occupied the centre and right-hand area; the left-hand area therefore represents early salivary gland developmental stages, such as sexual stages, which are frequent at 21–24 days pi, but are relatively scarce at 40 days pi compared to epimastigotes and metacyclics [9].

We next used consensus clustering to partition the cells into six clusters based on the top average silhouette score in SC3 [32] (. The midgut and proventriculus parasites each formed a single cluster (clusters C1 and C2 respectively), whereas the salivary gland cells divided into four clusters (C3-C6). We identified 238 marker genes across the six clusters allowing us to assign potential cell types (AUROC > 0.75, p < 0.01, . C1 and C5 had very few significant marker genes and C6 had none (hence not included in ). This is likely due to different overall levels of transcriptional activity across the cell types as we observed fewer genes per cell for these clusters (. For further characterization, we additionally identified the top 200 genes expressed in each cluster ( Based on both the cluster markers and top genes of each cluster, we were able to assign putative cell-types. C1 and C2 showed expression patterns consistent with midgut procyclics and proventricular forms, respectively, based on known marker genes and bulk transcriptomic data [21,33] ( C1 was characterized by a single marker gene, FHc (Tb927.3.4500), a fumarate hydratase, which catalyses conversion of fumarate to malate in the TCA cycle ( [4,34]. FHc was also the most significant marker gene for the midgut forms when integrated with T. brucei single-cell data from [20], supporting the cell-type assignment across datasets (. C1 also expressed several genes encoding surface proteins at high levels (EP1: Tb927.10.10260, EP3-2: Tb927.6.520, and EP2: Tb927.10.10250), as well as three Proteins Associated with Differentiation (PAD1: Tb927.7.5930, PAD2: Tb927.7.5940, PAD7: Tb927.7.5990) (, which are implicated as sensors of environmental stimuli and trigger differentiation [35]. C2 had several marker genes associated with transport (e.g. amino acid transporter AATP11 and purine nucleotide transporter NT10, ), both also highly expressed in C1 cells (. Procyclin EP2 was identified as a marker gene for this cluster, though both EP1 and EP3 (Tb927.6.480) were also highly expressed (.

Cluster C3 comprised day 21/24 pi early salivary gland developmental stages () including potential sexual forms. Notably, we observed high expression of the gamete fusion protein HAP2 (Tb927.10.10770), which is known to be expressed in meiotic intermediates and gametes ( [10]. An analogous cluster was also identified by [20], which showed high expression of HAP2 and HOP1 (Tb927.10.5490), a meiosis-specific protein. Integration across these two datasets showed the cells from both studies clustered together at a granular level (). Other notable marker genes for this cluster were two leucine-rich repeat (LRR) protein genes (Tb927.9.14570, Tb927.7.7180), with a third also highly expressed (. Procyclin genes EP1, EP3 and GPEET (Tb927.6.510) ( were highly expressed, together with BARP genes, which is the characteristic surface protein of epimastigotes [7].

Several BARP genes were the prominent marker transcripts in cluster C4 (, identifying this cluster as salivary gland epimastigotes, consistent with previous studies [19,20]. The majority of the later time point (day 40 pi) cells were found in clusters C5 and C6 (), showing that these clusters represent the later salivary gland developmental stages including mature metacyclics and/or their immediate precursors, pre- and nascent metacyclics. However, the identities of these clusters remain unclear. C5 had only three significant marker genes, two of which encode zinc finger proteins and one hypothetical protein, and C6 none (). The zinc finger protein genes, ZC3H11 (Tb927.5.810) and ZC3H45 (Tb927.11.8470) were also identified as biomarkers of pre-metacyclics (Meta 1) in [19], and ZC3H11 was also identified as a highly expressed gene in purified, culture-derived mature metacyclics [27]. Several other highly expressed genes of mature metacyclics ([27]) were also identified in our data for either C5 or C6 (e.g. ZFP2, HSP 110; ). It is noteworthy that cluster C5 is predominantly strain J10, while cluster C6 is predominantly strain 1738 (), and hence these clusters may also represent strain-specific rather than stage-specific expression differences. Additionally, mature and nascent metacyclics both have VSG on the surface [36], and it is reasonable to suppose that pre-metacyclics already transcribe VSGs. In support of this, both previous scRNAseq studies found high levels of expression of VSGs in cells identified as pre-metacyclics (Meta 1, [19]; Pre-metacyclic, [20]). Here, VSGs were not identified as abundant transcripts in either C5 or C6, likely because of poor match between strain 1738/J10 VSG transcripts and the Tb927 reference genome, as VSG repertoires are strain-specific. We next endeavoured to identify the metacyclic VSG repertoire of strains 1738 and J10, in order to confirm the cell-types of C5 and C6.

Expression of mVSG transcripts

Mature metacyclics can be unequivocally identified by their lack of expression of the cell surface proteins GPEET, EP and BARP, replaced by expression of a single mVSG gene in each cell [27], but pre-metacyclics also transcribe mVSGs at high level in [20]. To explore mVSG expression in salivary gland-derived cells, we first needed to identify the mVSG repertoires of strains 1738 and J10, which differ from those of previously published strains. We built a de novo transcriptome assembly based on all reads from the 388 tsetse-derived cells and identified putative mVSGs by comparison of the resulting ORFs to the total VSG repertoire of each strain, previously identified using a Hidden Markov Model on full-genome Illumina sequence data [37]. These assembled mVSG transcripts were then mapped to strain 1738 or J10 contigs to place them in a genomic context. Using this method, we identified 11 mVSGs that were expressed in our dataset all of which contained an upstream mVSG promoter based on the consensus sequence [38,39]. Additionally, downstream telomeric repeats were present in six of these contigs (). Although several ESAGs were found on the contigs, these were up- not downstream of the promotor and therefore not part of the mVSG expression site. The presence of these characteristic features of mVSG gave us further confidence that the identified transcripts were originating from bona fide mVSG. Interestingly, strains J10 and 1738 shared one mVSG (DN18105), suggesting some level of conservation across strains. This is the first identification of the mVSG repertoire in these strains.

Fig 2

mVSG expression in fly-derived trypanosomes.

(A) The genomic context of 11 mVSGs identified in strains 1738 and J10. The rectangles with a solid black outline represent the mVSG and are coloured to match Fig 2D. The sequences of each mVSG can be found in . (B) The transcript abundance of mVSG across 388 fly-derived trypanosome cells on the UMAP coloured by the logged sum of the mVSG counts in each cell and sized by the number of different mVSG detected in that cell. (C) The breakdown of mVSG expression per cluster. C5 had the highest proportion of cells expressing mVSG and the greatest proportion of those cells expressing multiple mVSG. (D) A barchart of all cells expressing mVSG (>1 read) organised by cluster and strain. Strain-specific expression of mVSG was seen at high levels in C5, which is primarily composed of strain J10.

Individual parasite transcriptomes were then mapped to the assembly to generate counts for each putative mVSG. MVSG transcripts were expressed by most cells in cluster C5, followed in order by C4, C6 and C3, with negligible expression in C1 and C2 (). Overall levels of expression were highest in cluster C5 (), with 38% (16/42 cells) expressing more than one mVSG (). Multiple mVSGs were also expressed by 38% (6/16) and 21% (4/19) cells in clusters C4 and C6 respectively, and a single cell in C3 (). Recent work by [20] confirmed expression of two mVSGs in pre-metacyclics using single molecule mRNA-FISH and put forward a model where multiple mVSGs are transcribed at low levels initially, with a single mVSG dominating expression in the mature metacyclic forms. Based on this model, C4, C5 and C6 all contain a high proportion of pre-metacyclics, as well as some mature metacyclics. The mVSGs expressed varied over development and between strains, with DN1222 being the dominant transcript in C5, which were primarily strain J10 cells, and DN16022 being the dominant transcript in C6, which were primarily strain 1738 cells (). Observed expressed mVSGs are largely consistent with the VSGs present in their strain (when there is sufficient read depth), but low read count and partial coverage result in ambiguous assignment due to sequence conservation between VSGs.

Pseudotime analysis of salivary gland development

To understand fine-scale changes in expression patterns during development of salivary gland parasites, we focused on the 161 salivary gland cells of strain 1738 collected over three time points (day 21, 24, 40 pi). The UMAP projection of these cells showed a general correspondence with the clusters identified in , with the left-hand group of cells representing clusters C3 and C4 (day 21/24 pi, early and late epimastigotes) and the right-hand group predominantly representing cluster C6 which included most of the day 40 pi transcriptomes (). The small branch connecting these two groups contained many cells collected from the dissociated salivary gland tissue, which likely represent attached epimastigotes and premetacyclics. Although we cannot rule out that these parasites were trapped unattached cells, their enrichment at this bottleneck in the UMAP indicates their importance in the developmental transition to metacyclics ().

Pseudotime trajectory analysis of developing salivary gland parasites.

Strain 1738 parasites collected from the salivary gland at day 21, 24 and 40 pi were used to map fine-scale changes in gene expression over development. (A-D) A UMAP of the 161 strain 1738 salivary glands parasites coloured by global cluster assignment from (A), day PI (B), attachment treatment (C) and pseudotime assignment (D). (E) A heatmap of 20 clusters of genes differentially expressed over the pseudotime trajectory from (D).

We next used Slingshot [40] to temporally order these cells in pseudotime, revealing a trajectory running from left to right from gametes and early epimastigotes to metacyclics (). We discovered 691 genes that were differentially expressed over this trajectory () and used hierarchical clustering to identify modules of co-expressed genes. Modules expressed early in development were enriched for genes involved in negative regulation of mitotic cell cycle and ATP metabolism (modules 2 and 13, ), while middle-late modules were enriched for genes involved in translation and the ribosome, perhaps necessitated by the changes in surface proteins and metabolism associated with differentiation from epimastigotes to metacyclics ().

Identification of hybrid progeny and strain-specific expression

To investigate potential cell-types and cell-type specific responses that could be involved in sexual reproduction at day 24 post-infection, we collected strains J10 and 1738 parasites from both single-strain infected and co-infected tsetse. In the co-infected treatment, we sorted cells from both strains based on fluorescence (strain 1738 GFP+, strain J10 RFP+), and sorted a small number of RFP+/GFP+ potential hybrid parasites (16 sorted, 14 passed QC). To confirm strain assignment, we used Souporcell to cluster different genotypes based on SNPs in the RNA-seq reads [41]. The two genotype clusters identified were each composed of one of the strains based on fluorescent identification with FACS (strain 1738 GFP+ = cluster 0; strain J10 RFP+ = 1), and the potential hybrid progeny were identified as inter-genotypic doublets (clusters 0/1 and 1/0), with alleles present from both strains (. This confirmed that six of the RFP+/GFP+ cells were genuine hybrids, while a further three hybrid cells were identified from the RFP-/GFP+ or RFP+/GFP- groups; as the GFP and RFP genes are present on only one homologue, four hybrid genotypes with respect to fluorescent protein genes are expected [42]. Looking at a UMAP of all day 24 pi cells, we observed some separation of strain in both the early and late epimastigote clusters (C3 and C4) and clusters C5 and C6 (). However, we did not see clear clustering based on the infection treatment (co- vs single-infection), suggesting that there is no strong transcriptomic response to presence of another parasite strain (). In order to understand if the observed strain-specific clustering was a result of different cell-type composition or differential expression between strains within a cell-type, we integrated the data across strains using Seurat v3 [43]. Using this method, we were able to co-cluster the early epimastigote cells and identify 11 genes differentially expressed between the two strains (). However, the later stage cells seen in strain J10 had no representation of strain 1738, suggesting this cell-type is unique to this strain at day 24 pi, which could be observed if the strains have different developmental rates ().

Classification of hybrid progeny.

Souporcell was used to assign genotypes based on SNPs found between the two strains. The two genotype assignments (0,1) were each primarily composed of one of the strains based on fluorescent identification with FACS (strain 1738 GFP+/RFP- = cluster 0; strain J10 GFP-/RFP+ = 1), and the potential hybrid progeny were classified as inter-genotypic doublets (clusters 0/1 and 1/0). The likelihood ratio of cluster 0 assignment is shown for each of the three sorted populations (A). The UMAP of day 24 mixed- and single-infection experiments coloured by strain assignment and shaped by cell cluster assignment (B) and infection treatment (C).

Transcript levels of procyclin and candidate novel sexual stage genes correlate with protein expression in vivo

A primary aim of this study was to identify the sexual stages of T. brucei and our results support the hypothesis that cluster C3 () represents meiotic intermediates and gametes, which are abundant around day 21 pi [8-10]. Looking at expression of genes encoding proteins known to be essential for sexual reproduction, we found high levels of expression of HAP2 and also GEX1 in cluster C3, with some signal from the meiosis-specific genes DMC1 and HOP1 (). Surprisingly, these cells also expressed the procyclin gene GPEET, which is considered to be a marker of early procyclics in the tsetse midgut, replaced by EP procyclins in late procyclics [31,44]. GPEET, EP1, HAP2 and GEX1 all have the highest expression in cluster C3 (). We used immunofluorescence to tie these observations to specific morphological forms and to validate the presence of GPEET on the surface of salivary gland parasites (). We found that GPEET, together with EP and BARP were present in >90% of the meiotic dividers (2K1N cell with large posterior nucleus and two flagella) and gametes (1K1N or 2K1N cells with small pear-shaped body and relatively long anterior flagellum) [9], and as expected absent in metacyclics (). Epimastigotes showed a similar pattern to the sexual forms but lower total proportions (). Additionally, we looked at proventricular parasites (mesocyclics) and found expression of EP and GPEET but no BARPs, further confirming our gene expression data is matched at the protein level for these markers ().

Expression of surface antigens and genes involved in sexual reproduction throughout development in the tsetse fly.

We observed co-expression of procyclic surface antigen genes and HAP2 in early parasite development in the salivary glands (A) and this general pattern of expression was also seen in proventricular forms (mesocyclics) (C2) as well as putative epimastigotes (C4) that also had high expression of BARPs (B). Immunofluorescence assays confirmed that these surface proteins corresponded to their transcriptional profiles and were present on the epimastigote and sexual stages (C).

Although previous work has shown that GPEET and EP transcripts are present in salivary gland parasites, expression of the corresponding proteins have not been demonstrated [45]. Instead, BARPs have been considered the major surface proteins in non-metacyclic, salivary gland forms [7]. Our data support a model where epimastigotes and sexual forms are expressing a diversity of surface proteins at high levels including BARPs, GPEET and EP. Additionally, the expression of these procyclins outside the midgut indicates they might play a functional role in these stages as well, and further experiments are needed to understand if they are required for development or interactions of meiotic dividers and gametes.

Cluster C3 was additionally characterised by strong and unique expression of Tb927.10.12080 (Figs ), and we hypothesized that this gene may play a role in sexual development. It encodes a hypothetical protein devoid of recognisable functional domains that is well-conserved in other trypanosomes including T. congolense, T. vivax, T. cruzi and T. grayi, and the C-terminal domain in more distantly related members of the trypanosomatid family such as Leishmania spp. The gene falls upstream of two RNA binding proteins (Tb927.10.12090 (RBP7a); Tb927.10.12100 (RBP7b)) and the recently identified long non-coding RNA, grumpy, which all play a role in stumpy form differentiation [46,47]. Along with Tb927.10.12080, this genomic region could potentially act as a hotspot for differentiation and developmental processes across the parasite life cycle. Localisation data for Tb927.10.12080 from Tryptag.org [48,49] is equivocal, showing punctate cytoplasmic fluorescence for the N-terminal tagged protein and a mitochondrial location in a proportion of cells for the C-terminal tagged protein. To investigate expression of this protein during development in the tsetse fly, we used the 3’ UTR to regulate expression of GFP driven by the procyclin promotor (). At 20–22 days pi, there was very little detectable expression in midgut procyclics or proventricular forms, but strong expression in salivary gland trypanosomes (). Overall, of the parasites from the salivary gland scored, 39% (182/464) showed expression (. These included meiotic intermediates and both 1K1N and 2K1N gametes but not metacyclics or unattached epimastigotes (). Cell types involved in the early stages of meiosis, such as meiotic dividers and 3N cells with one diploid and two haploid nuclei [10], had lower percentages of cells expressing (10% and 50% respectively) than did those involved in the later stages of meiosis and in gametes (77–80%; ). At 37–38 days pi, the percentage of fluorescent trypanosomes dropped (103/682; 15%) and these cells were misshapen with no recognisable gametes or sexual intermediates. Further experiments are needed to understand the functional role of Tb927.10.12080 in meiosis and sexual development; however, it’s unique pattern of transcript and protein expression indicate it could play a vital role in processes that allow for genetic exchange in T. brucei and perhaps more broadly in kinetoplastids.

Expression of Tb927.10.12080 coincides with sexual forms.

(A) Co-expression of Tb927.10.12080 with genes encoding HAP2 and GEX1, proteins associated with gamete and nuclear fusion in eukaryotes, and the surface antigen genes GPEET and EP1; co-expression is seen in a subset of cells from C3 (Fig 1D). (B) T. brucei strain 1738 GFP::Tb927.10.12080–3’UTR transcribed from the procyclin promotor in the salivary gland (SG) and proventricular forms (PV). (C) Diagram showing major cell types observed during meiosis in T. brucei (adapted from [10]); nuclei are shown in black (4C or 2C DNA contents) or grey (1C, haploid) and kinetoplasts are shown as smaller black dots. Values beneath are the numbers and percentages of cells recorded for each cell type; both 1K1N and 2K1N gametes are included in the gamete total. Full data are presented in . (D) Trypanosomes from tsetse fly salivary gland spill-out 16–21 days pi with T. brucei strain 1738 expressing GFP::Tb927.10.12080–3’UTR transcribed from the procyclin promotor. Left to right: phase contrast, DAPI, GFP::Tb927.10.12080–3’UTR. The scale bar represents 10 μm.

Fig 1

scRNAseq analysis of trypanosome developmental stages in tsetse.

(A) A schematic of the trypanosome life cycle and collections of the single parasite transcriptomes from midgut (MG; blue), proventriculus (PV; turquoise) and salivary glands (SG; pink) from different time points and strains. The number of parasites that passed QC at each collection is shown in parentheses. Trypanosomes show two conformations: trypomastigote with kinetoplast (small black dot) posterior to nucleus (e.g. bloodstream form, procyclic, metacyclic) and with kinetoplast anterior to nucleus (e.g. epimastigote). (B) A UMAP of the 388 cells that passed QC across collections, coloured by tissue of origin. (C) The UMAP coloured by cluster assignment. (D) A heatmap of the top significant marker genes from each of the five clusters that had marker genes (AUROC >0.75 & adjusted p-value < 0.01).

Conclusion

Here we applied single-cell RNA sequencing to explore the heterogeneous trypanosome populations in the tsetse fly. These data provide a resource for the parasitology community, which we have made available via an interactive website (http://cellatlas.mvls.gla.ac.uk/). Additionally, this data set allowed us to elucidate the transcriptional profiles of key life cycle stages in the salivary glands including the sexual stages. From this mixture of cell types, we were able to identify a cluster of cells that shared a particular transcriptomic profile characterized by high expression of the gene encoding the gamete fusion protein HAP2, together with several unstudied genes. One of these was a kinetoplastid-conserved gene Tb927.10.12080, which was exclusively expressed at high levels by meiotic intermediates and gametes. We speculate that this protein, currently of unknown function, plays a role in gamete formation and/or fusion, but further experiments are needed to test this hypothesis.

Materials and methods

Data collection

Trypanosome culture and tsetse infection

The following tsetse-transmissible strains of Trypanosoma brucei brucei were used: T. b. brucei strain J10 (MCRO/ZM/73/J10) and strain 1738 (MOVS/KE/70/EATRO 1738); each was genetically modified to express a fluorescent protein gene (strain J10 RFP, strain 1738 GFP). Mating between these strains has been demonstrated previously [42] and strain 1738 reliably produces large numbers of gametes around day 21 post-infection [9]. Procyclic form (PF) trypanosomes were grown in Cunningham’s medium (CM) [50] supplemented with 15% v/v heat-inactivated foetal calf serum, 5 μg/ml hemin and 10 μg/ml gentamycin at 27°C. Tsetse flies (Glossina pallidipes) were infected with PF trypanosomes, maintained and dissected as described previously [8].

Parasite isolation from tsetse tissues for scRNAseq

Free swimming parasites were obtained from G. pallidipes by separately pooling tissues into CM (5 midguts in 500 μl CM; 5 proventriculi in 50 μl CM; 20 sets of salivary glands in 50 μl CM). Tissues were incubated at room temperature (RT) for 10 minutes prior to filtration through a 100 μm filter. Cells were washed once with 1 ml CM prior to preservation or sorting. At day 40 pi, the parasites attached to the salivary glands were isolated by disassociation of the tissue after the 10-minute incubation period. Forceps were used to transfer the tissue to an enzymatic solution consisting of 200 μl Collagenase IV (1 mg/ml) and 25 μl of Elastase (4 mg/ml). The sample was then incubated at 30°C for 40 min with shaking at 300 rpm. During the incubation, the tissue was disrupted by pipetting up and down 40 times every 15 minutes at first with a p1000 pipette set to 150 μl and then with a p200 set to 100 μl once the tissue started to break up.

Cell preservation

A subset of cells was preserved prior to cell sorting to allow for greater flexibility in the time between collections and FACS. The day 40 pi salivary glands parasites (attached and free) cells were fixed by adding 200 μl of dithio-bis(succinimidyl propionate) (DSP; Lomant’s reagent) dropwise to the cell pellet as described in [51]. DSP fixed samples were incubated at room temperature for 30 minutes prior to adding 4 μl 1 M Tris-HCl pH 7.5. Samples were then stored at 4°C for up to 24 hours. Prior to sorting, DTT was added to a final concentration of 50 mM. The day 24 pi salivary gland parasites (cross vs single infection) were preserved by resuspending the cell pellet in 200 μl Hypothermosol-FRS (BioLifeSolutions) [52]. Samples were then stored at 4°C for 5 hours prior to sorting. Live cells were stored at 4°C after collection from the tsetse tissue for up to 5 hours prior to sorting.

Cell sorting, library preparation and sequencing

All parasite cells were sorted within 24 hours of collection on an Influx cell sorter (BD Biosciences) with a 200 μm nozzle or a Sony SH800 with 100 μm chip. Parasites were sorted based on RFP and/or GFP fluorescence into nuclease-free 96 well plates containing lysis buffer as described previously [12]. Sorted plates were spun at 1000 g for 10 seconds and immediately placed on dry ice. Reverse transcription, PCR, and library preparation were performed as described in [12]. Cells were multiplexed to 384 and sequenced on a single lane of Illumina HiSeq2500 v4 with 75 bp paired-end reads.

Immunofluorescence

Salivary glands, proventriculi and midguts from infected flies (20–22 days pi) were pooled separately into CM and incubated at RT for 10 minutes (to allow trypanosomes to swim out of tissue) and then filtered through a 100 μm filter with PBS. Trypanosomes were pelleted by centrifugation and resuspended in 100 μl PBS. Cells were fixed overnight at 4°C by adding 100 μl 6% paraformaldehyde, 0.1% glutaraldehyde in PBS, and then washed twice with PBS before resuspension in 50 μl PBS. Cell suspensions were pipetted onto 2 x 10 mm coverslips, allowed to settle for 20 mins in a humid chamber, and then liquid was removed and replaced by 2% BSA in PBS. After 30 mins liquid was removed and cells incubated with 2% BSA in PBS containing diluted antibody for 30 mins at RT. Rabbit anti-GPEET (1:1000) and rabbit anti-BARP (1:1000) were a kind gift from Isobel Roditi, University of Bern, Switzerland; mouse anti-EP mAB (1:100) was from Cedarlane. Cells were washed three times with PBS and incubated with 2% BSA in PBS containing anti-rabbit FITC (1:1000) and anti-mouse TRITC (1:1000) for 30 mins at RT. Cells were washed three times with PBS, briefly air dried, stained with DAPI in VECTASHIELD mounting medium (Vector Laboratories) and viewed using a DMRB microscope (Leica) equipped with a Retiga Exi camera (QImaging) and Volocity software (PerkinElmer). The whole area of the coverslip was scanned systematically from top to bottom, capturing FITC, TRITC, DAPI and phase contrast images of each trypanosome. Digital images were analysed using ImageJ (http://rsb.info.nih.gov/ij).

Tb927.10.12080 gene expression

The 3’ UTR of Tb927.10.12080 was amplified from genomic DNA of strain 1738 using the primers 5’- GATCCTCGAGTAGTGGCGAGTGTTTACAACAGTGTC and 5’-GATCGGGCCCCTTGTGCGGATCCAAACAA, and inserted immediately downstream of a GFP gene driven by the procyclin promotor from plasmid backbone pHD449, which is designed for insertion into the tubulin locus () [53,54]. The plasmid construct was used for stable transfection of procyclic strain 1738 and following hygromycin selection, clones were tsetse fly transmitted as described by [8,9]. Flies were dissected 10–40 days pi and organs viewed by fluorescence microscopy and imaged live or fixed in 2% paraformaldehyde and stained with DAPI in VECTASHIELD mounting medium (Vector Laboratories).

scRNAseq data analysis

Mapping and generation of expression matrices

Nextera adaptor sequences were trimmed from fastq files using trim_galore (-q 20 -a CTGTCTCTTATACACATCT—paired—stringency 3—length 50 -e 0.1) (v 0.4.3) [55]. Trimmed reads were mapped using HISAT2 (hisat2—max-intronlen 5000 -p 12) (v 2.1.0) [56] to the T. b. brucei 927 genome. The GFF was converted to GTF using the UCSC genome browser tool [57]. Reads were then summed against genes using HTseq (htseq-count -f bam -r pos -s no -t CDS) (v 0.7.1) [58].

Assembly of VSG transcripts

Because there is a lack of conservation of VSGs across T. brucei strains, we built a de novo transcriptome assembly to identify the mVSG transcripts expressed in strains 1738 and J10. First, we merged the BAM files across the 388 cells and converted to FASTQ using bedtools (v. 2.29.2) [59]. Using Trinity (v. 2.1.1) [60] to assemble the transcripts from this merged file, we detected 53521 ‘genes’ with a mean contig length of 800 bp. We then mapped each cell to this assembly using RSEM (v. 1.3.3) to generate a counts matrix and used Transdecoder (v. 5.5.0) to detect open reading frames [61]. BLASTp (v. 2.9.0) was used to match to putative VSGs that had been curated independently from whole genome data as described below. Transcripts with >90% identity were used for further analysis.

Genomes for the parent strains J10 and 1738 were assembled from 76 bp paired read Illumina data from [62] using SPADES under default parameters [63]. Predicted mVSGs were identified to genomic loci, using BLAST against the assembled contigs with a percent identity across the entire transcript >95%, alignments of a raw score of greater than 1000 were further investigated. Additional open reading frames were identified by BLAST alignment of the curated 927 annotated CDS set. Nhmmer was used to identify putative mVSG promoters from the alignments [38,39].

Quality control and normalization

Quality control and visualisation was performed in Scater (v. 1.12.2) [64]. Cell quality was assessed based on the distribution of genes detected per single-cell transcriptome. Cells with fewer than 40 genes or more than 3000 genes detected were removed, as well as cells that had fewer than 1000 total reads. These QC thresholds allowed us to keep more cells in the analysis that are likely to be less transcriptionally active such as mature metacyclics. Out of 515 parasites isolated from tsetse tissue that were sequenced, 388 passed quality control and were used for downstream analyses. Raw count data was normalized using a deconvolution size factor in Scran (v. 1.16.0) [65] to account for differences in overall level of expression between cell-types.

Cell clustering, projection, and marker genes

In order to unbiasedly group transcriptomes based on similar expression profiles, 388 cells collected from the tsetse were clustered using K-means clustering in SC3 (v. 1.12.0) [32]. Dimensionality reduction was performed in Scater (v. 1.12.2) [64] using UMAP with the top 200 most variable genes and n_neighbors = 5, min_dist = 1, spread = 3. Marker genes were identified for each cluster using SC3 (AUROC >0.75 & adjusted p-value < 0.01).

Identification of hybrid parasites and data integration

To select different parasite genotypes (strains J10, 1738, or J10x1738 cross) in the mixed infection treatment, we first FACS sorted based on GFP+ (strain 1738), RFP+ (strain J10), or GFP+/RFP+ (hybrid) expression. We then used souporcell (-k 2 -p 2) (v2.0) [41] to confirm genotype assignment based on SNP profiles from the scRNAseq reads. Souporcell uses mixture model clustering to identify genotypes and potential cell doublets after SNPs are called and counted with freebayes and vartrix, respectively [41,66,67]. We identified hybrid parasites as those that were categorised as doublets (containing alleles from both strains).

To identify genes that were differentially expressed between the two strains, we used Seurat (v3.1.5) to integrate the data by identifying anchors with the FindIntegrationAnchors() and IntegrateData() functions. The data was then clustered using FindNeighbors() with the top 30 principal components and FindClusters() with a resolution of 0.5. Differential expression was performed using the FindMarkers() function (adjusted p-value < 0.001). The same integration methods were used to compare the data to [20] except that the top 20 principal components were used, the cluster resolution was 0.8 and the FindConservedMarkers() function identified markers found in both studies (max p-value < 0.001).

Pseudotime and differential expression

To assess developmental progression in strain 1738 salivary gland parasites from day 21-, 24-, and 40-days pi, Slingshot (v. 1.8.0) was used to estimate pseudotime by first inferring the global lineage structure of the cells and then fitting a smooth curve to infer the pseudotime variables for cells along that lineage [40]. Input clusters (k = 4) and the UMAP reduction were initially identified in SC3 and scater, respectively [32,64]. Genes differentially expressed over this trajectory were identified using the associationTest() function in TradeSeq (v. 1.4.0) [68].

Quality assessment and expression of marker genes in procyclic culture singe-cell transcriptomes.

Forty-eight transcriptomes were generated using Smart-seq2 from parasites in a procyclic culture including a no cell and ten cell control. (A) The distribution of the total counts and total features (genes) detected in these 48 transcriptomes. (B) The total features plotted against total counts for the 46 single-cell transcriptomes shows a plateau as features and counts increase, suggesting that sequencing was saturated for these cells. We detected a mean of 2.6x106 reads and 1756 features per single-cell transcriptome. (C) Expression of procyclic surface antigen genes GPEET (Tb927.6.510), EP1 (Tb927.10.10260), EP2 (Tb927.10.10250), EP3_1 (Tb927.6.520), EP3_2 (Tb927.6.480).

(TIF)

Click here for additional data file.

Quality control of insect stage parasites.

The distribution of genes detected (left) and counts (right) in each cell across the three insect tissues: midgut (MG), proventriculus (PV), and salivary glands (SG). Cells with fewer than 40 or more than 3000 genes per cell were removed. Additionally, cells with fewer than 1000 reads were removed. Cut-offs are represented by the red vertical lines in each histogram. After QC we detected a mean of 889 genes per cell and 1.1x105 counts per cell.

(TIF)

Click here for additional data file.

Assessment of preservation methods of salivary gland parasites.

The distribution of features detected in salivary gland cells across the two preservation treatments (DSP and hypothermosol) compared to live parasites. Although there were slight differences in detection between the different treatments, caution must be taken in interpreting these differences as the fixation methods are confounded with the different timepoints collected (DSP: day 40; hypothermosol: day 24; live: day 21).

(TIF)

Click here for additional data file.

Integration with Hutchinson dataset.

All 388 tsetse transcriptomes were integrated with the Hutchinson dataset collected from salivary glands [20] using Seurat’s data integration function. Plots show the UMAP of integrated data coloured by study (A), cluster identity from the different studies (paper_id) (B), integrated cluster assignment (C), or gene of interest (D-F). FHc (Tb927.3.4500) was the top marker gene (based on adjusted p-value) for the midgut and proventricular form cluster 4 (D). Tb927.7.380 (hypothetical protein, conserved) was the top marker gene for cluster 3 which contained gamete and epimastigote forms. HAP2 (Tb927.10.10770) (F) was not a marker gene for the gamete cluster likely because of its ubiquitous expression across non-metacyclic forms. Although we were able to identify conserved marker genes across the two studies, separation remained in the UMAP for all cell-types (A-B) and only the non-metacyclic forms co-clustered across the two studies and only at a granular level. The metacylic forms likely did not cluster together because of different VSG repertoires, and the separation across other cell-types may be due to time point, strain-specific expression patterns, or collection methods. Conserved marker genes for clusters 3 and 4 can be found in

(TIF)

Click here for additional data file.

Strain-specific gene expression (A). A UMAP of the day 24 SG parasites integrated by strain (1738 and J10). Points are coloured by strain and shaped by cluster. (B). The integrated UMAP coloured by new cluster from the integration analysis. Cluster 0 has a representation of both strains, whereas cluster 1 and 2 are composed primarily of strain 1738 or J10, respectively. (C) Differential expression was performed between strains within cluster 0. The ten genes differentially expressed between the two strains are displayed on a heatmap.

(TIF)

Click here for additional data file.

Plasmid map for GFP::Tb927.10.12080–3’UTR construct.

Life cycle selective expression of Tb927.10.12080 was investigated through a reporter construct where the expression of GFP was controlled by ~500 bp of UTR downstream of the gene. For this study a stable transformant line was generated in strain 1738 using the 3’ UTR from its endogenous gene and integrated into the tubulin locus.

(TIF)

Click here for additional data file.

Marker genes from Fig 1.

(XLSX)

Click here for additional data file.

Top 200 genes expressed in each cluster from Fig 1.

(CSV)

Click here for additional data file.

Marker genes from integration with Hutchinson dataset.

(XLSX)

Click here for additional data file.

Genes differentially expressed over pseudotime (corresponding to Fig 3).

(XLSX)

Click here for additional data file.

Genes differentially expressed between strains (corresponding to S5 Fig).

(CSV)

Click here for additional data file.

Surface protein expression of trypanosomes from salivary glands from tsetse dissected 19–21 days post infected feed, using immunofluorescence.

(DOCX)

Click here for additional data file.

Cell types recovered from tsetse salivary gland exudate 16–21 days post infection with T. brucei strain 1738 expressing GFP::Tb927.10.12080–3’UTR scored for GFP fluorescence.

(DOCX)

Click here for additional data file.

Fasta file of mVSG sequences.

(TXT)

Click here for additional data file.

3 Dec 2021

Dear Dr Howick,

Thank you very much for submitting your manuscript "Single-cell transcriptomics reveals expression profiles of Trypanosoma brucei sexual stages" for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. The reviewers appreciated the attention to an important topic. Based on the reviews, we are likely to accept this manuscript for publication, providing that you modify the manuscript according to the review recommendations.

I am returning your manuscript with three reviews. After reading the manuscript and the reviews, all the comments can be addressed without further experimentation. However, several points highlighted by the reviewers must be addressed.

-Please pay particular attention to the language used to describe the role of Tb927.10.12080.

-Please consider the addition of data mentioned in the materials and methods to Figure 6 to further strengthen the interpretation of the role of Tb927.10.12080.

-All three reviewers have highlighted sections in the text that need to be expanded for clarity or typos addressed

Please prepare and submit your revised manuscript within 30 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to all review comments, and a description of the changes you have made in the manuscript.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Thank you again for your submission to our journal. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Lucy Glover

Guest Editor

PLOS Pathogens

David Horn

Section Editor

PLOS Pathogens

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

​orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************

I am returning your manuscript with three reviews. After reading the manuscript and the reviews, all the comments can be addressed without further experimentation. However, several points highlighted by the reviewers must be addressed.

Please pay particular attention to the language used to describe the role of Tb927.10.12080.

Please consider the addition of data mentioned in the materials and methods to Figure 6 to further strengthen the interpretation of the role of Tb927.10.12080.

All three reviewers have highlighted sections in the text that need to be expanded for clarity or typos addressed

These revisions must be addressed in order to prepare this manuscript for publication.

Reviewer Comments (if any, and for reference):

Reviewer's Responses to Questions

Part I - Summary

Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.

Reviewer #1: The manuscript by Howick et al., “Single-cell transcriptomics reveals expression profiles of Trypanosoma brucei sexual stages”, is an important contribution to the field of trypanosome development in the tsetse vector. The authors define and characterize different life-cycle stages transcriptomes, and, combined with previous studies using scRNAseq improve our understanding of the intricate development of T. brucei. The available repertoire of metacyclic VSGs (mVSGs) is expanded by 11 new genes which the authors identified in the cell lines used. The focus of the study is the sexual development of T. brucei, a process which is still not well understood mechanistically. A new marker for meiotic stages was identified and verified using a fluorescent reporter. The manuscript is well-written and is an important step to understanding meiosis and sexual reproduction in T. brucei, as well as its evolution in eukaryotes.

Reviewer #2: In this manuscript, Howick et al use single cell transcriptomics to study sexual recombination in African trypanosomes. The authors obtained single cell transcriptomes for trypanosomes from the midgut (MG), proventriculus (PV) and salivary gland (SG) of infected tsetse flies, covering the major stages of development in the insect host. The range of data, covering three organs, attached and free SG parasites, multiple strains, experimental crosses, assembly of metacyclic VSG expression sites, and the first description of the surface coat of meiotic and gamete cells is impressive.

These data therefore go further than the recent salivary gland single cell transcriptomes from Vigneron et al (2020) and Hutchinson et al (2021), which focused on the salivary glands only. The focus on sexual stages in this manuscript gives important novelty over these previously published transcriptomes.

This manuscript should be published without further experimentation. It will catch the attention not only of parasitologists, but also of people interested in the history of sexual recombination. We believe it could benefit from the addition of some data (from existing experiments but not shown), and of a more elaborate discussion. This one is a bit short but this is probably a consequence of the results and discussion being combined in a single section.

Reviewer #3: The manuscript describes single cell transcriptomes of trypanosomes from the salivary glands of tsetse flies. The findings are interesting and are confirmed by both the know biology in the salivary gland and by experimentation. A good read.

**********

Part II – Major Issues: Key Experiments Required for Acceptance

Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.

Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".

Reviewer #1: Major points:

My main concern stems from the use of the following phrases to describe Tb927.10.12080:

p. 35 “We speculate that this protein… plays a role in gamete formation and/or fusion.”

p. 369 “…we hypothesized that this gene may play a role in sexual development.”

p. 394 “…it could play a vital role in processes that allow for genetic exchange in T. brucei…”

p. 421 “We speculate that this protein… plays a role in gamete formation and/or fusion.”

The results presented clearly demonstrate that the protein is expressed and likely functions during these developmental stages. However, speculating that this gene plays a direct role in the process is not justified. To demonstrate a functional role for Tb927.10.12080 in the sexual development of T. brucei the authors can use the same plasmid vector they used for the fluorescent reporter, but instead of the reporter, have a long hairpin construct for RNAi targeting the gene transcript. Constitutive expression should not be a problem because the protein does not seem to be expressed in other life-cycle stages in the fly. If RNAi against Tb927.10.12080 interferes with meiosis, scored by cell morphology/KN counts, the authors will have a very strong case for a direct role of this gene in T. brucei sexual development.

Alternatively, the language can be changed to indicate that there is a distinction between “functioning during” and “playing a role in”.

With the identification of additional 11 mVSG sequences to complement the set of already available metacyclic VSGs from different T. brucei cell lines, have the authors identified any features that distinguish these VSGs from the ones found in bloodstream expression sites? It is an important general question that still awaits clarification. The predominant current view is that they are indistinguishable from each other, however, it is important to comment on this point.

There should be a slightly expanded discussion/interpretation of the results indicating that GPEET procyclin is highly expressed in meiotic intermediates and gametes. GPEET is a presumed marker for early procyclics, as the authors point out. Or is this notion incorrect, according to the results presented here?

Reviewer #2: No new experiments required

Reviewer #3: In places the manuscript will be difficult to follow without knowledge of the software, the are a couple of instances of software being used without providing a few words on what type of analysis it does. It could be made more accessible for a wider audience.

Could the authors provide an estimate of the time from removing the cells from their natural habitats and lysing / fixing them for RNA preparation? As the mean half life of mRNAs is ~20 minutes in trypanosomes, a consideration of / comment on any possible effect of the cell handling on transcriptome would be helpful.

**********

Part III – Minor Issues: Editorial and Data Presentation Modifications

Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.

Reviewer #1: Minor point:

1. In Fig. 2A, the color of the VSG box on the left and the colors of the VSG boxes in the contigs should be synchronized. They should either be all white (the color is perhaps not needed in this panel), or the one on the left should reflect the range of colors used.

2. “as LRRs are protein recognition motifs, this could be significant in gamete interactions.” This is highly unlikely because published data indicate that these specific proteins are highly enriched in the nucleus.

Reviewer #2: Main comments

The discussion of the sexual recombination between strains 1738 and J10 is somewhat brief, with several unanswered questions:

1) at which point in the Pseudotime analysis are the hybrid transcriptomes found? Can we reliably obtain a temporal order of events from these data, i.e., does gametocytogenesis precede epimastigote attachment to the epithelium?

2) Were the authors able to understand how meiotic recombination alters the distribution of SNPs throughout the chromosomes of the hybrids?

The expression analysis of Tb927.10.12080 is interesting and seems solid. The experimental design could impact interpretation, since a procyclin promoter is used to drive expression of the GFP reporter. We believe that from the description of the experiment in the materials and methods, the authors have images of midgut parasites showing that GFP is not expressed. These are an important control to illustrate that the regulation observed is indeed controlled by the 3´ UTR rather than the procyclin promoter and could be added to strengthen Figure 6.

Minor comments

Line 103 and legend figure S1. Is it 46 or 48 cells? The number differs at several places of the text. Please correct.

Line 117. “A further 62 1738 parasites” is a bit confusing. We would suggest using “strain 1738” or “strain J10” throughout the manuscript.

Line 130-140, the description of the number of transcriptomes was a little hard to follow. Could the authors inset a table into Fig 1A to help the reader?

Figure 1. The clusters at Fig. 1D are difficult to follow, especially since they are not presented in the same order as at Fig. 1C, which is a bit confusing. We suggest adding extra labels or keeping the same order.

Page 13: morphological features used for gamete identification were not very clear. Presumably, this is based on previous papers, but we could not find information in the manuscript.

Give a reference to the TrypTag paper for readers not specialised in trypanosomes (Halliday et al MBP2019).

Figure S3, should the x-axis label be “Genes detected”?

Line 239 “HMM” acronym not described

Line 290, no citation for Slingshot (though it appears in M&M)

The code used to analyze the data is not available at the stated URL.

Sebastian Hutchinson and Philippe Bastin, ESPCI & Institut Pasteur, Paris

Reviewer #3: There are a small Huber of typos, eg line 100 should be RBP6 not RBP 6

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Sebastian Hutchinson and Philippe Bastin, ESPCI & Institut Pasteur, Paris

Reviewer #3: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

References:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

28 Jan 2022

Submitted filename: ResponseToReviews.docx

Click here for additional data file.

6 Feb 2022

Dear Dr Howick

We are pleased to inform you that your manuscript 'Single-cell transcriptomics reveals expression profiles of Trypanosoma brucei sexual stages' has been provisionally accepted for publication in PLOS Pathogens.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens.

Best regards,

Lucy Glover

Guest Editor

PLOS Pathogens

David Horn

Section Editor

PLOS Pathogens

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

​orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************************************************

Reviewer Comments (if any, and for reference):

3 Mar 2022

Dear Howick,

We are delighted to inform you that your manuscript, "Single-cell transcriptomics reveals expression profiles of Trypanosoma brucei sexual stages," has been formally accepted for publication in PLOS Pathogens.

We have now passed your article onto the PLOS Production Department who will complete the rest of the pre-publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Pearls, Reviews, Opinions, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens.

Best regards,

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

​orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064