Literature DB >> 35254125

Nearly Complete Genome Sequence of Cherry Virus A, Isolated from Prunus armeniaca in Jammu and Kashmir, India.

M Salik Noorani1,2, Jawaid Ahmad Khan2, Sheikh Khursheed3, Zahid Hameed Siddiqui4, Zahid Khorshid Abbas4.   

Abstract

A nearly complete genome sequence of cherry virus A (CVA), isolated from the Prunus armeniaca plant, is presented in this publication. The genome is 7,380 bases in length and is divided into two open reading frames, with a 54-nucleotide (nt) 5' noncoding region (NCR) and a 297-nt 3' NCR.

Entities:  

Year:  2022        PMID: 35254125      PMCID: PMC9022571          DOI: 10.1128/mra.01098-21

Source DB:  PubMed          Journal:  Microbiol Resour Announc        ISSN: 2576-098X


ANNOUNCEMENT

Apricot (Prunus armeniaca L.) is a widely cultivated stone fruit plant, having been domesticated in Central Asia and China before spreading to South Asia (1). In India, it is grown in Jammu and Kashmir, Himachal Pradesh, Uttaranchal, and, to a lesser extent, Punjab (2). Cherry virus A (CVA) is a member of the Capillovirus genus in the Betaflexiviridae family. Its genome is composed of a positive-sense RNA that contains two open reading frames (ORFs). ORF1 encodes replicase and coat proteins, whereas ORF2 encodes a movement protein (MP) (3, 4). CVA has been found in all of the world's stone fruit-producing regions (5). Symptoms associated with CVA are unknown or are currently considered latent. However, CVA was isolated in 2015 from an apricot leaf sample demonstrating vein-clearing symptoms (6). In this investigation, infected apricot leaves with chlorotic, short holes and necrotic symptoms were collected in May 2015 in the Srinagar district of Jammu and Kashmir. A nearly complete genome of CVA was amplified using the primer pair (CVAU and CVAL) described by Noorani et al. (7). Total RNA was extracted from 0.1 g of the infected leaves using a conventional cetyltrimethylammonium bromide (CTAB) method (8). A ProtoScript avian myeloblastosis virus (AMV) LongAmp Taq reverse transcription (RT)-PCR kit (New England Biolabs, USA) was used for cDNA synthesis and PCR amplification. PCR amplicons were recovered from the agarose gel using the gel extraction kit. Primer walking (Table 1) was used to sequence the isolated DNA fragments directly using the chain-terminating dideoxynucleotide Sanger sequencing method (9). Multalin (http://multalin.toulouse.inra.fr/multalin), a multiple sequence alignment tool, was used to assemble the complete genome from the individual Sanger reads. A nearly complete genome sequence of CVA was examined using the NCBI BLAST search engine (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and submitted to GenBank. The strain JK2 (GenBank accession number LC422952) was 7,380 nucleotides (nt) long (A, 2,288 [31%]; T, 2,200 [31%]; G, 1,505 [20%]; C, 1,387 [18%]). The NCBI ORFfinder (https://www.ncbi.nlm.nih.gov/orffinder) predicted two ORFs from the CVA complete genome. ORF1, which encoded a 226-kDa replicase protein, spanned from nucleotides 55 to 57 (AUG start codon) to nucleotides 7078 to 7080 (ochre UAA stop codon) and translated into 2,342 amino acids. Subsequently, ORF2 (nucleotides 5400 to 6791), which encoded a 52-kDa putative MP, was predicted. The noncoding regions (NCRs) in the 5′ and 3′ regions included a total of 54 and 297 nt, respectively. A BLASTn search of the NCBI databases revealed that the JK2 strain of CVA shared 82.87% similarity with the type isolate (GenBank accession number X82547) and a maximum of 95.10% with the Canadian isolate 3137 9A1/13TF101_N33 (GenBank accession number KY510892). It also showed 94.92% similarity with the Indian sweet cherry isolate JK. Phylogenetic analysis revealed a close link between JK2 and JK isolates reported from India (Fig. 1).
TABLE 1

Primers used for primer walking

No.Primer namePrimer sequence (5′ to 3′)
1CVAU TCACTTCCATCAATTTCCAAACAC
2CVA558R CAGTCAGGTTTGATGGCTC
3CV1013F TCAAGGGCTACAATATCAGGAC
4CVA1920R AAGCAAGCATTCTTCCTTG
5CVA2751R GTTCAAGGAGCATTCATCCA
6CVA2638F TTCATGACAAAATTGACTCAAG
7CVA4596 R TTGGCGCACATGTCATCACC
8CVA4528F TCCACATTCATGAAGTATGATG
9CVA5400F GGTTTTCCCAGTCACGAC
10CVA6843R CAGGAAACAGCTATGACC
11CVAL AAGGAAAAAGAATAAAAAGTCCTAAAGCAAGGTGC
FIG 1

Neighbor-joining (NJ) phylogenetic analysis of 31 complete deduced nucleotide sequences of CVA with 1,000 bootstrap replicates. Bootstrap values below 70 are not shown. Each terminal node was assigned a GenBank accession number, followed by the isolate's name, host, and geographic location. SoC, sour cherry; SwC, sweet cherry; J.Apricot, Japanese apricot. Strain JK2 is marked with a black square. Apple stem-grooving virus (ASGV) was used as an outgroup. Pairwise, multiple sequence alignments and evolutionary analysis were made in MEGA 11 (10), and the resulting tree was visualized with Tree Explorer.

Neighbor-joining (NJ) phylogenetic analysis of 31 complete deduced nucleotide sequences of CVA with 1,000 bootstrap replicates. Bootstrap values below 70 are not shown. Each terminal node was assigned a GenBank accession number, followed by the isolate's name, host, and geographic location. SoC, sour cherry; SwC, sweet cherry; J.Apricot, Japanese apricot. Strain JK2 is marked with a black square. Apple stem-grooving virus (ASGV) was used as an outgroup. Pairwise, multiple sequence alignments and evolutionary analysis were made in MEGA 11 (10), and the resulting tree was visualized with Tree Explorer. Primers used for primer walking

Data availability.

The complete genome sequence of the CVA strain JK2 has been deposited in GenBank under accession number LC422952.
  8 in total

Review 1.  Family Flexiviridae: a case study in virion and genome plasticity.

Authors:  Giovanni P Martelli; Michael J Adams; Jan F Kreuze; Valerian V Dolja
Journal:  Annu Rev Phytopathol       Date:  2007       Impact factor: 13.078

2.  Complete nucleotide sequence of cherry virus A (CVA) infecting sweet cherry in India.

Authors:  M S Noorani; P Awasthi; Rahul Mohan Singh; Raja Ram; M P Sharma; S R Singh; N Ahmed; V Hallan; A A Zaidi
Journal:  Arch Virol       Date:  2010-10-12       Impact factor: 2.574

3.  Simultaneous detection and identification of four cherry viruses by two step multiplex RT-PCR with an internal control of plant nad5 mRNA.

Authors:  Md Salik Noorani; Prachi Awasthi; Maheshwar Prasad Sharma; Raja Ram; Aijaz Asgar Zaidi; Vipin Hallan
Journal:  J Virol Methods       Date:  2013-05-23       Impact factor: 2.014

4.  DNA sequencing with chain-terminating inhibitors.

Authors:  F Sanger; S Nicklen; A R Coulson
Journal:  Proc Natl Acad Sci U S A       Date:  1977-12       Impact factor: 11.205

5.  Cherry virus A: cDNA cloning of dsRNA, nucleotide sequence analysis and serology reveal a new plant capillovirus in sweet cherry.

Authors:  W Jelkmann
Journal:  J Gen Virol       Date:  1995-08       Impact factor: 3.891

6.  MEGA11: Molecular Evolutionary Genetics Analysis Version 11.

Authors:  Koichiro Tamura; Glen Stecher; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2021-06-25       Impact factor: 16.240

7.  Genetic Structure of a Worldwide Germplasm Collection of Prunus armeniaca L. Reveals Three Major Diffusion Routes for Varieties Coming From the Species' Center of Origin.

Authors:  Hedia Bourguiba; Ivan Scotti; Christopher Sauvage; Tetyana Zhebentyayeva; Craig Ledbetter; Boris Krška; Arnaud Remay; Claudio D'Onofrio; Hiroyuki Iketani; Danilo Christen; Lamia Krichen; Neila Trifi-Farah; Weisheng Liu; Guillaume Roch; Jean-Marc Audergon
Journal:  Front Plant Sci       Date:  2020-05-25       Impact factor: 5.753

8.  First Complete Genome Sequence of Cherry virus A.

Authors:  Hiroaki Koinuma; Takamichi Nijo; Nozomu Iwabuchi; Tetsuya Yoshida; Takuya Keima; Yukari Okano; Kensaku Maejima; Yasuyuki Yamaji; Shigetou Namba
Journal:  Genome Announc       Date:  2016-06-09
  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.