| Literature DB >> 35222523 |
Ruoyu Dang1, Bojian Qu1,2, Kaimin Guo3, Shuiping Zhou4, He Sun3, Wenjia Wang3, Jihong Han5, Ke Feng5, Jianping Lin1,2, Yunhui Hu3.
Abstract
Background: Coronary artery disease (CAD) exerts a global challenge to public health. Genetic heritability is one of the most vital contributing factors in the pathophysiology of CAD. Co-expression network analysis is an applicable and robust method for the interpretation of biological interaction from microarray data. Previous CAD studies have focused on peripheral blood samples since the processes of CAD may vary from tissue to blood. It is therefore necessary to find biomarkers for CAD in heart tissues; their association also requires further illustration. Materials andEntities:
Keywords: GWAS meta-analysis; WGCNA (weighted gene co-expression network analyses); coronary artery disease; diagnostic biomarkers; heart tissue
Year: 2022 PMID: 35222523 PMCID: PMC8867041 DOI: 10.3389/fgene.2021.818813
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.599
Primer sequences for qRT-PCR analysis
|
|
|
|
|---|---|---|
|
| CTCGGGGGTATTTTGCTGTGT | TCCTCCTGAGGGTAGTTGAGA |
|
| GCTATGTGGAGCACTTGGTTC | CACCCATTGCTTCTCGTCGTT |
|
| AGATTCGCTTTCATTGCAGAGT | GATCCGTCTGTGGGGTAAAAC |
|
| GGGTTATGGACTCTCGGGTGAT | TGGAAGTGGCATGTGCGTTGAC |
|
| TCCTTCTTCGTGGACAACTTCT | AGAGGACACATTCGGTTTCACTA |
|
| TTTGAGGACCTGGGATTGGTA | TTGGCGCTACTGATGACTGTT |
FIGURE 1Identification of significant modules in coronary artery disease (CAD) heart tissue with weighted gene co-expression network analysis (WGCNA). (A) Sample dendrogram and clinical trait heatmap. Fifty samples were clustered according to clinical traits, such as gender, batch, age, and CAD status. Gender: red denotes male; white, female. Age and batch: discrete values are represented with color depth positively correlated with each sample. CAD condition: red represents CAD patients; white represents healthy controls. (B) Cluster dendrogram and gene–trait association heatmap obtained from the transcriptome data of GSE12504 and GSE22253 with average hierarchical linkage clustering. The color row below the dendrogram denotes the assigned modules allocated by dynamic tree cutting and merged module function. Blue and red colors represent a negative and a positive correlation between a gene and clinical features, respectively. (C) Eigengene adjacency heatmap showing extramodular connectivity among all the modules. In the heatmap, each row and column correspond to a module. Cyan to blue denotes lower module connection (<0.5); progressively darker red denotes higher connection (≥0.5). Colored squares along the vertical and horizontal sides correspond to modules. (D) Heatmap showing the module–trait correlation. Hierarchical clustering of eigengenes represents the modules. Each row denotes the module, while each column denotes the feature of CAD. Values in the box represent the correlations and corresponding p-values.
FIGURE 2Genes from the turquoise module mainly enriched in metabolic pathways, oxidative phosphorylation, cardiac muscle contraction, and protein ubiquitination. (A) Gene numbers in all modules. Detailed gene symbols are listed in Supplementary Table S1. (B) Scatter plot showing the gene significance for coronary artery disease (CAD) versus module membership in the turquoise module (correlation coefficient = 0.732, p = 1.6e−9). (C–E) Histogram showing the Gene Ontology (GO) enrichment analysis for the genes in the turquoise module. The terms enriched in the category of molecular function (MF), biological process (BP), and cellular component (CC) are presented. The corresponding terms and adjusted p-values in each category are listed in Supplementary Table S1. (F) Bubble chart showing the enriched pathway terms referring to the Kyoto Encyclopedia of Genes and Genomes (KEGG) database for the genes of the turquoise module. (G) Venn diagram representing the intersection between the differentially expressed genes (DEGs), the turquoise module genes, and the genes of 4 CAD-related pathways. The intersecting 58 hub gene symbols in these three groups are listed in Supplementary Table S1. (H)) Subnetworks constructed by 58 CAD causal genes with protein–protein interaction. Genes were divided into 4 main subnets of biological functions based on the degree of connection.
FIGURE 3Identification and validation of the coronary artery disease (CAD) causal genes. (A,B) Diagram representing mouse ECG (A) and echocardiography (B) at the endpoint of doxycycline (DOX) or isoproterenol (ISO) treatment. (C) Representative pictures of the heart morphology and HE staining. (D) Heatmap generated from the DNA-seq expression profiles showing the Log2FoldChange of the expression of 9 CAD causal genes from the control and ISO- and DOX-treated cardiotoxicity mouse models. (D,E) Heart sections and immunohistochemistry (IHC) staining of RNF181 in the control and DOX- and ISO-treated mice. (F) Statistical analysis results of the immunostained area of RNF181 (percentage). (G) CAD causal genes substantially perturbed by DOX were further confirmed by qRT-PCR. Significant threshold of p = 0.05.
FIGURE 4Identification of risk variants at the RNF181 locus in the cohort and in genome-wide association studies (GWAS). The SNP locus rs6738645 in the RNF181 chromosome region was related to coronary artery disease (CAD). (A) Scattered dot plot displaying Pearson’s correlation between the expression of RNF181 and the CAD risk gene ADAMST7 in the CAD cohort from the PREDICT trail (R 2 = 0.66, p < 9.6E−15). (B) Manhattan plot showing the top 20 SNPs in the CARDIoGRAMplusC4D GWAS results by p-value. (C) Color-coded forest plot showing the normalized effect sizes of heart tissue expression for rs6738645 and the corresponding 95% confidence intervals presented for CARDIoGRAMplusC4D and 8 other CAD meta-analyses. (D) m-values representing the posterior probability of heart tissue-specific expression and their respective p-values. (E) Dot plot of phenome-wide association studies (PheWAS) showing the expression data from GWAS ATLAS for the lead SNP (rs6738645) associated with clinical traits. Genome-wide significant expression p-values are shown for the indicated SNPs. p < 0.05 (Bonferroni corrected).
Lead genome-wide association studies from GWASATLAS for the SNP rs6738645 associated with CAD clinical traits
|
|
|
|
|
|
|
|
| |
|---|---|---|---|---|---|---|---|---|
| 3925 | 28714975 | 2017 | Cardiovascular | Coronary artery disease (SOFT definition including angina) | 3.14E−13 | 148,815 | G | T |
| 4043 | 30124842 | 2018 | Skeletal | Height | 1.2E−11 | 693,529 | G | T |
| 108 | 26343387 | 2015 | Cardiovascular | Coronary artery disease | 5.6E−10 | 184,305 | G | T |
| 3668 | 31427789 | 2019 | Cardiovascular | Chronic ischemic heart disease | 3.102E−09 | 300,791 | G | T |
| 3692 | 31427789 | 2019 | Cardiovascular | Angina pectoris | 6.244E−09 | 244,890 | G | T |
| 3470 | 31427789 | 2019 | Metabolic | Trunk fat-free mass | 2.666E−08 | 379,507 | G | T |
| 3471 | 31427789 | 2019 | Metabolic | Trunk fat-free mass | 3.528E−08 | 379,507 | G | T |
EA, effect allele; NEA, non-effect allele