Nasir Uddin Ahmed1, Abul Khair1,2, Jayedul Hassan3, Md Abu Hadi Noor Ali Khan4, A K M Anisur Rahman1, Warda Hoque5, Mustafizur Rahman5, Nobumichi Kobayashi6, Michael P Ward7, Md Mahbub Alam1. 1. Department of Medicine, Faculty of Veterinary Science, Bangladesh Agricultural University, Mymensingh, Bangladesh. 2. IUBAT-International University of Business Agriculture and Technology, Dhaka, Bangladesh. 3. Department of Microbiology and Hygiene, Faculty of Veterinary Science, Bangladesh Agricultural University, Mymensingh, Bangladesh. 4. Department of Pathology, Faculty of Veterinary Science, Bangladesh Agricultural University, Mymensingh, Bangladesh. 5. Infectious Diseases Division, Virology Laboratory, icddr,b, Mohakhali, Dhaka, Bangladesh. 6. Department of Hygiene, School of Medicine, Sapporo Medical University, Sapporo, Japan. 7. Sydney School of Veterinary Science, The University of Sydney, Camden, New South Wales, Australia.
Abstract
Bovine rotavirus (BRV) is considered the leading cause of calf diarrhea worldwide, including Bangladesh. In this study we aimed to identify risk factors for BRV infection and determine the G and P genotypes of BRV strains in diarrheic calves. Fecal samples were collected from 200 diarrheic calves in three districts between January 2014 and October 2015. These samples were screened to detect the presence of BRV using rapid test-strips BIO K 152 (RTSBK). The RTSBK positive samples were further tested by polyacrylamide gel electrophoresis and the silver staining technique to detect rotavirus dsRNA. Risk factors were identified by multivariable logistic regression analysis. The G and P genotypes of BRV were determined by RT-PCR and sequencing. A phylogenetic tree was constructed based on the neighbor-joining method using CLC sequence viewer 8.0. About 23% of the diarrheic calves were BRV positive. The odds of BRV infection were 3.8- (95% confidence interval [95% CI]: 1.0-14.7) and 3.9-times (95% CI:1.1-14.2) higher in Barisal and Madaripur districts, respectively, than Sirrajganj. The risk of BRV infection was 3.1-times (95% CI: 1.5-6.5) higher in calves aged ≤ 5 weeks than those aged >5 weeks. Moreover, the risk of BRV infection was 2.6-times (95% CI:1.1-5.8) higher in crossbred (Holstein Friesian, Shahiwal) than indigenous calves. G6P[11] was the predominant genotype (94.4%), followed by G10P[11] (5.6%). The BRV G6 strains were found to be closest (98.9-99.9%) to Indian strains, and BRV G10 strains showed 99.9% identities with Indian strain. The VP4 gene of all P[11] strains showed >90% identities to each other and also with Indian strains. The most frequently identified BRV genotype was G6P[11]. About 23% of calf diarrhea cases were associated with BRV. To control disease, high-risk areas and younger crossbred calves should be targeted for surveillance and management. The predominant genotype could be utilized as the future vaccine candidate or vaccines with the dominant genotype should be used to control BRV diarrhea in Bangladesh.
Bovine rotavirus (BRV) is considered the leading cause of calf diarrhea worldwide, including Bangladesh. In this study we aimed to identify risk factors for BRV infection and determine the G and P genotypes of BRV strains in diarrheic calves. Fecal samples were collected from 200 diarrheic calves in three districts between January 2014 and October 2015. These samples were screened to detect the presence of BRV using rapid test-strips BIO K 152 (RTSBK). The RTSBK positive samples were further tested by polyacrylamide gel electrophoresis and the silver staining technique to detect rotavirus dsRNA. Risk factors were identified by multivariable logistic regression analysis. The G and P genotypes of BRV were determined by RT-PCR and sequencing. A phylogenetic tree was constructed based on the neighbor-joining method using CLC sequence viewer 8.0. About 23% of the diarrheic calves were BRV positive. The odds of BRV infection were 3.8- (95% confidence interval [95% CI]: 1.0-14.7) and 3.9-times (95% CI:1.1-14.2) higher in Barisal and Madaripur districts, respectively, than Sirrajganj. The risk of BRV infection was 3.1-times (95% CI: 1.5-6.5) higher in calves aged ≤ 5 weeks than those aged >5 weeks. Moreover, the risk of BRV infection was 2.6-times (95% CI:1.1-5.8) higher in crossbred (Holstein Friesian, Shahiwal) than indigenous calves. G6P[11] was the predominant genotype (94.4%), followed by G10P[11] (5.6%). The BRV G6 strains were found to be closest (98.9-99.9%) to Indian strains, and BRV G10 strains showed 99.9% identities with Indian strain. The VP4 gene of all P[11] strains showed >90% identities to each other and also with Indian strains. The most frequently identified BRV genotype was G6P[11]. About 23% of calf diarrhea cases were associated with BRV. To control disease, high-risk areas and younger crossbred calves should be targeted for surveillance and management. The predominant genotype could be utilized as the future vaccine candidate or vaccines with the dominant genotype should be used to control BRV diarrhea in Bangladesh.
Rotaviruses are recognized as the major causative agent of severe diarrhea in infants and children, and the young of a variety of mammalian and avian species throughout the world [1, 2]. Bovine rotavirus (BRV) is the leading cause of calf diarrhea worldwide [3]. Among all causal agents of diarrhea, BRV alone is responsible for 62.5% of diarrhea outbreaks in beef and dairy herds [4]. Globally, >30% of all rotavirus-related deaths occurs in India, Bangladesh and Pakistan [5].The rotavirus (RV) genome consists of 11 segments of double-stranded RNA and encodes six structural (segments 1–4 encode VP1-VP4 proteins, segment 6 encodes VP6 protein, and segment 9 encodes VP7 protein) and six nonstructural (NSP1-NSP6) proteins. Segments 5, 7, 8 and 10 encode nonstructural protein NSP1, NSP3, NSP2 and NSP4, respectively. However, segment 11 encodes NSP5 or NSP 6. These viruses have been classified into 10 genetically distinct groups (A-J) [6]. The electrophoretic migration pattern of the eleven RNA segments in polyacrylamide gel (RNA pattern) is specific to each rotavirus group. Groups A, B, C, and H infect both humans and animals, while Groups D, E, F, and G infect animals and birds [3]. Group A rotaviruses are members of the genus Rotavirus, family Reoviridae [7]. They are classified based on antigenic and genetic differences of the outer capsid antigens, VP7 and VP4 and the inner capsid protein, VP6. Two viral surface proteins, VP4 (a protease-cleaved, or P protein) and VP7 (a glycoprotein, or G protein) are the targets of neutralizing antibodies. These proteins may mediate protection induced by rotavirus vaccines. The antigenicity of group A rotavirus strains has been described by the dual classification system with G-type and P-type. At least 41 G-types and 57 P-types, based on the nucleotide sequences of VP7 and VP4 genes, have been described to date in rotaviruses from humans and various animal species (https://rega.kuleuven.be/cev/viralmetagenomics/virus-classification/rcwg). In human rotaviruses, the major genotypes are G1, G2, G3, G4 and G9, which are combined with P[4], P[6], and P[8] [8]. Although at least six P genotypes—(P6[1], P7[5], P8[11], P11[14], P[17] and P[21]) and 8 G genotypes—(G1, G3, G5, G6, G7, G8, G10, and G15) have been reported among bovine RV-group A [9, 10], only G6, G10 and G8 combined with P[5], P[11], and P[1] are considered epidemiologically important [4]. The most common worldwide BRVA genotypes are considered to be G6 (range, 39.8–78.3%), followed by G10 (21%) in the Americas, Europe, Asia and Australia, and G8 (3%) in Africa. Regarding P type, P[5] strains (range, 37.1–50.0%) are the most prevalent in Europe, the Americas, Asia, and Australia followed by P[11] (range, 15.4–34.8%) and P[1] (2%). A total of 20 individual G and P combinations have been described so far and three combinations, G6P[5], G6P[11] and G10P[11], are predominant (combined prevalence, 40%) in many areas of the world [11]. Surveillance of BRV is very important for disease prevention and more specifically for the development of a vaccine. Continuous monitoring of emerging and re-emerging BRV strains is essential for a better understanding of the viral ecology within a region, and to improve the implemented vaccination programs by updating vaccine strains.The prevalence of rotavirus infection varies according to risk factors such as herd size, and the timing and amount of colostrum feeding. The prevalence was reported to be relatively higher in small scale farms than medium and large scale farms in Ethiopia [12]. In contrast, the prevalence of calf scour in general was reported to be higher in larger farms than medium sized farms in Argentina [13]. The feeding of colostrum within one hour of calving has been reported to have a protective effect on rotavirus infection [12]. One study revealed that none of the calves were infected with BRV in herds in which > 2 liters colostrum were provided [12]. There are few reports on the prevalence of bovine rotavirus in Bangladesh [14-17]. Human G and P genotypes have been described in Bangladesh [18, 19], but there is only one report on bovine G and P genotypes [20]. Knowledge of risk factors and circulating bovine G and P genotypes will help in the selection of vaccine candidate strains in the future. Hence the objectives of this study were to identify the risk factors for bovine rotavirus infection, determine the distribution of bovine rotavirus G and P genotypes and understand the genetic diversity of bovine rotaviruses prevalent in diarrheic calves in Bangladesh dairy farms.
Materials and methods
Ethics statement
The study protocol was approved by the Animal Welfare and Experimentation Ethical Committee (AWEEC) of Bangladesh Agricultural University (AWEEC/BAU/2013/01). Oral consent was taken from the owner of the calves before sampling.
Sample and data collection
Fecal samples were collected from 0–3 month old diarrheic calves. A total of 200 samples were collected by convenience sampling from Barishal, Madaripur, and Sirajgonj districts of Bangladesh during 2014–2015. A single sample was collected from each herd. More than two thirds of the herds were from subsistence managment system and the remaining were from large dairy herds. The samples were aseptically collected in sterile plastic bottles and transported to the laboratory in an icebox. Data on age, sex, breed and location of the calves were recorded using a questionnaire during sampling. Fecal samples were preserved at -20°C until further examination. The age of the calf was determined from the herd record book.
Detection of BRV by rapid detection kit BIO K 152
Fecal samples were screened for the presence of bovine rotaviruses (BRV) by rapid detection kit BIO K 152 (Bio-X Diagnostics, Belgium) following manufacturer’s instructions. This is a chromatographic lateral flow immunoassay coated with monoclonal antibodies specific for rotavirus and colored gold colloidal reagents labeled with monoclonal antibodies specific for rotavirus. Briefly, a spoonful of liquid fecal sample was homogenized carefully to prevent foam formation. Solid feces were initially diluted with a dilution solution and similarly homogenized. A test strip was placed in the homogenized solution, and results were recorded after 10 minutes. The appearance of red color at both the C and T line of the strip was considered a positive result.
Ribonucleic acid polyacrylamide gel electrophoresis (RNA-PAGE)
Fecal samples were diluted with 10% sterile Phosphate Buffered Saline (PBS, pH 7.2). Supernatants from the suspension were collected by centrifugation at 15,000 rpm for 15 minutes. The supernatant was used for the extraction of viral RNA following the protocol described previously [21]. The extracted RNA was subjected to RNA-PAGE for the detection of 11 segments of rotaviral dsRNA as described previously [21, 22]. RNA was resolved in 10% polyacrylamide gels and stained by silver nitrate [21].
Identification of risk factors
The data on study area, age, sex, season and disease status were entered into Microsoft Excel 2015 and transferred to R 3.5.0 [23] for statistical analysis. Age was converted to a categorical variable based on median age. Months were converted to three seasons. Calves positive in either RTSBK or PAGE-SS was considered to be BRV infected and used as the outcome variable (positive, negative). District, age, breed, sex and season were used as explanatory variables. The Pearson chi-square test was used to assess the association between BRV infection status and explanatory variables. The R functions “table” and “chisq.test” were used to construct contingency tables and to perform chi-square tests, respectively. Any explanatory variable associated with BRV infection with a p-value of ≤ 0.20 was included in multivariable logistic regression analysis. Collinearity among explanatory variables was assessed by Cramer’s phi-prime statistic (R package “vcd,” “assocstats” functions). A pair of variables was considered collinear if Cramer’s phi-prime statistic was >0.70 [24]. Stepwise multivariable logistic regression was used to identify risk factors for BRV infection. The final multivariable model was automatically selected based on the lowest Akaike’s information criterion value. We used the Hosmer-Lemeshow goodness-of-fit test [25] using the “hoslem.test” function of the R package “ResouceSelection” [26] to assess the overall model fit. Confounding was checked by observing the change in the estimated coefficients of the variables in the final model by adding a non-selected variable to the model. If the inclusion of this non-significant variable led to a change of > 25% of any parameter estimate, that variable was considered to be a confounder and kept in the model [27]. The two-way interactions of all variables remaining in the final model were assessed for significance based on AIC values, rather than significance of individual interaction coefficients [27]. The data used for the identification of risk factors is presented in S1 File.
RNA extraction for reverse transcription polymerase chain reaction (RT-PCR)
Initially, 5% fecal suspension was prepared in sterile PBS and centrifuged at 12,000 rpm for 1 min. The supernatant was used for RNA extraction using QIAamp® RNA Mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions.
RT-PCR of the bovine rotavirus
RT-PCR targeting the genes—VP7 and VP4 were used to detect BRV. Full-length VP7 gene product was indicated by 1062 amplicon base pair (bp) size, while 877 bp product showed the presence of partial length VP4 gene segment. PCR amplification of the whole length VP7 gene (1062 bp) was performed using generic primers Bov9Com5 and Bov9Com3 (Table 1) according to the conditions described previously [28]. The PCR products were further checked for the VP7 subtypes (G6, G8, and G10) by a second-round PCR using Bov9Com5 as forward and either of the primers specific for G6, G8 or G10 as the reverse primers, respectively [29]. P typing was performed through the amplification of partial length VP4 gene (877 bp) using primers Con3-5’ end and Con2-3’ end (Table 1). Similar to that of G typing, a second PCR with the amplified PCR products was performed to determine VP4 gene subtypes (P1, P5, and P11) using the respective primers (Table 1) as described previously [4]. These PCR products of VP7 and VP4 genes were sequenced to determine G and P genotypes and construct a phylogenetic tree.
Table 1
Oligonucleotide primers used in RT-PCR assay and sequencing of the PCR products.
Primers
Sequences (5’-3’)
Location
Product size
Reference
Bov9Com5
GGCTTTAAAAGAGAGAATTTCCGTTTGG
1–28
1062 bp
[29]
Bov9Com3
GGTCACATCATACAACTCTAATCT
1039–1062
G6
CTAGTTCCTGTGTAGAATC
499–481
500 bp
G8
CGGTTCCGGATTAGACAC
273–256
274 bp
G10
TTCAGCCGTTGCGACTTC
714–697
715 bp
VP4 typing primers for RT-PCR and P typing of BRV:
Con3-5’end
TGG CTT CGC TCA TTT ATA GAC A
11–32
877bp
[4]
Con 2–3’end
ATT TCG GAC CAT TTA TAA CC
868–887
P1 K- P1
ACC AA C GAA CGC GGG GGT G
264–282
624bp
P5 K- P5
RCC AGG TGT CRC ATC AGA G
336–354
552bp
pB223- P11
GGA ACG TAT TCT AAT CCG GTG
574–594
314bp
Sequencing for G and P genotyping and phylogenetic analysis
Sequences of BRV genes encoding VP7 and VP4 were determined directly with RT-PCR products amplified with Bov9Com5, Bov9Com3, and Con3-5’end, Con2-3’end, respectively. PCR products were purified using ExoSAP-IT (USB Corp, Cambridge, MA). Nucleotide sequencing was carried out in an automated ABI3500 xL Genetic Analyzer (Applied Biosystem, Foster City, CA) and Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystem), as per kit protocol. The electropherogram files were inspected using Chromas 2.23 (Technelysium Pty Ltd, Unit 406, 8 Cordelia St, South Brisbane QLD 4101, Australia). Genetyx-WIN Version 5.1 (Software Development, Tokyo, Japan) was used to perform pairwise alignment and calculate sequence identity of VP7 and VP4 genes from different strains. All amplicons were further verified using Sanger sequencing. An automated genotyping based on VP7 and VP4 sequences was performed using Rota C v2.0 web-based tool for rotavirus classification (http://rotac.regatools.be). The gene sequences obtained were submitted to GenBank (Table 2) and were also confirmed by BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi) through which G and P types were determined and aligned nucleotide sequences were downloaded from three GenBank database. Sequences showing >90% homology with >90% query coverage were aligned and a neighbor-joining tree was constructed using CLC sequence viewer 8.0 (Qiagen Aarhus, Denmark).
Table 2
Profiles of bovine rotavirus analyzed genetically and their gene sequences in a study of diarrheic calves in Bangladesh.
Sample ID
Location (District)
Age (Days)
Rotavirus test strip (BIO K 152) result
Genotype
Accession numbers
VP7
VP4
BAU-1
Barisal
27
+
G6P[11]
MH140436
MH140452
BAU-2
Barisal
7
+
ND
BAU-3
Barisal
7
+
ND
BAU-4
Barisal
28
+
ND
BAU-5
Barisal
90
+
ND
BAU-6
Barisal
60
+
G6P[11]
MH140442
MW075227
BAU-7
Madaripur
45
+
ND
BAU-8
Madaripur
45
+
ND
BAU-9
Barisal
45
+
ND
BAU-10
Sirajganj
45
+
G6P[11]
MH140437
MH140455
BAU-11
Sirajganj
60
+
ND
BAU-12
Sirajganj
60
+
G6P[11]
MH140451
MH140456
BAU-13
Madaripur
90
+
ND
BAU-14
Barisal
75
+
XP[11]
BAU-15
Madaripur
60
+
XP[11]
BAU-16
Madaripur
15
+
ND
BAU-17
Madaripur
12
+
XP[11]
MH140464
BAU-18
Madaripur
90
+
G6P[11]
MH140438
MH140457
BAU-19
Barisal
30
+
ND
BAU-20
Barisal
60
+
ND
BAU-21
Madaripur
4
+
ND
BAU-22
Madaripur
90
+
ND
BAU-23
Barisal
90
+
ND
BAU-24
Barisal
27
+
G6P[11]
MH140439
MH140458
BAU-25
Madaripur
10
+
ND
BAU-26
Madaripur
45
+
ND
BAU-27
Madaripur
27
+
G6P[11]
MW075223
MW075224
BAU-28
Madaripur
66
+
G6P[11]
MH140440
MH140453
BAU-29
Madaripur
22
+
G6P[11]
MH140441
MH140454
BAU-30
Barisal
2
+
ND
BAU-31
Madaripur
8
+
G6P[11]
MW075225
MW075226
BAU-32
Madaripur
42
+
ND
BAU-33
Madaripur
50
+
G6P[11]
MH140443
MH140459
BAU-34
Madaripur
34
+
G6P[11]
MH140444
MW075228
BAU-35
Barisal
35
+
ND
BAU-36
Madaripur
20
+
G6P[11]
MH140445
MH140460
BAU-37
Madaripur
45
+
XP[11]
MH140461
BAU-38
Madaripur
60
+
G6P[11]
MH140446
MH140466
BAU-39
Madaripur
37
+
G6P[11]
MH140449
MH140465
BAU-40
Madaripur
60
+
G6P[11]
MH140450
MH140467
BAU-41
Madaripur
20
+
G6P[11]
MH140447
MH140462
BAU-42
Barisal
60
+
ND
BAU-43
Barisal
19
+
ND
BAU-44
Barisal
90
+
XP[11]
MH140468
BAU-45
Barisal
17
+
G6P[11]
MH140448
MH140463
ND: Not determined, X: G non-typable.
ND: Not determined, X: G non-typable.
Results
Prevalence and risk factors for bovine rotavirus
The prevalence and distribution of rotavirus diarrhea in calves is shown in Table 3. The overall prevalence of bovine rotavirus was 22.5% (45/200) (95% Confidence Interval (CI): 17.0−29.0) based on the RTSBK test. District, season, breed and age of calves were associated with BRV (P<0.20; Table 3) and therefore included in multivariable logistic regression modelling.
Table 3
Contingency tables and Pearson’s Chi-square test conducted to evaluate the association between explanatory variables and rotavirus diarrhea in calves in Barisal, Madaripur and Sirajganj districts in Bangladesh, 2014−2015.
Variables
Category
Positive/Tested
Prevalence (95% Confidence Interval)
P-value
District
0.04
Barisal
18/68
26.5 (16.8−38.8)
Madaripur
24/92
26.1 (17.7−36.5)
Sirajganj
3/40
7.5 (1.9−21.5)
Age (weeks)
0.02
Up to 5 (median)
31/100
31.0 (22.3−41.1)
> 5
14/100
14.0 (8.1−22.7)
Sex
0.39
Male
22/111
19.8 (13.1−28.7)
Female
23/89
25.8 (17.4−36.4)
Breed
<0.001
Indigenous
30/163
18.4 (12.9−25.4)
Cross (Holstein: 10/25; Shahiwal:5/12)
15/37
40.5 (25.2−57.8)
Season
0.05
Summer (March to June)
17/56
30.4 (19.2−44.3)
Rainy (July to October)
10/74
13.5 (7.1−23.9)
Winter (November to February)
18/70
25.7 (16.3−37.8)
Overall
45/200
22.5 (17.0−29.0)
Variables identified as risk fasctos using multivariable logistic regression analysis are presented in Table 4. The odds of BRV infection were 3.8- (95% CI: 1.0–14.7) and 3.9-times (95% CI:1.1–14.2) higher in Barisal and Madaripur districts, respectively, than Sirrajganj. The risk of BRV infection was 3.1-times (95% CI: 1.5–6.5) higher in calves aged ≤ 5 weeks than those aged >5 weeks. In addition, the risk of BRV infection was 2.6-times (95% CI:1.1–5.8) higher in crossbred than indigenous calves (Table 4).
Table 4
Risk factors identified in the final multivariable logistic regression analysis for rotavirus infection in diarrheic calves in Bangladesh.
Variables
Category
Estimate
SE
Adjusted Odds ratio (95% Confidence Interval)
District
Barisal
1.34
0.68
3.8 (1.0−14.7)
Madaripur
1.35
0.66
3.9 (1.1−14.2)
Sirajganj
-
-
Reference
Age (weeks)
Up to 5 (median age)
1.14
0.37
3.1 (1.5−6.5)
> 5
-
-
Reference
Breed
Indigenous
-
-
Reference
Cross
0.95
0.41
2.6 (1.1, 5.8)
Characteristics of the rotavirus genotypes
According to the serial interpretation of RTSBK and RNA-PAGE, 15% (30/200) samples were found positive for BRV. PAGE analysis of the RTSBK positive samples revealed a typical migration pattern of 11 segments of rotavirus-A. All the positive samples showed a long pattern of electrophoreses and classified into a single pattern (Fig 1).
Fig 1
Electropherogram of rotavirus strains isolated from diarrhoeic calf samples in Bangladesh.
1–11, segments of RNA. The genomic RNA segments migration pattern of 4:2:3:2, typical of group A rotavirus was observed in polyacrylamide gel, where segments 7, 8, and 9 moved in a triplet. Segments 1–4, respectively, encode structural protein VP1-VP4, Segemnts 6 and 9 encode structural protein VP6 and VP7, respectively. Segments 5, 7, 8 and 10 encode nonstructural protein NSP1, NSP3, NSP2 and NSP4, respectively. Segment 11 encodes NSP5 or NSP 6. Lane A-H, Rotavirus strains isolated from diarrheic calf samples.
Electropherogram of rotavirus strains isolated from diarrhoeic calf samples in Bangladesh.
1–11, segments of RNA. The genomic RNA segments migration pattern of 4:2:3:2, typical of group A rotavirus was observed in polyacrylamide gel, where segments 7, 8, and 9 moved in a triplet. Segments 1–4, respectively, encode structural protein VP1-VP4, Segemnts 6 and 9 encode structural protein VP6 and VP7, respectively. Segments 5, 7, 8 and 10 encode nonstructural protein NSP1, NSP3, NSP2 and NSP4, respectively. Segment 11 encodes NSP5 or NSP 6. Lane A-H, Rotavirus strains isolated from diarrheic calf samples.RT-PCR was applied to determine the distribution of G and P serotypes of bovine rotaviruses prevalent in Bangladesh (Table 4). In this study, VP7 gene (G type) could be amplified from 18 out of 30 rotavirus positive samples (Fig 2a). Based on the subtype-specific RT-PCR and web-based analysis, among the 18 amplicons evaluated, 17 were BRV G6 (94.4%) and 1 BRV G10 (5.6%). This indicates that G6 is the predominant genotype (Table 2). The VP7 gene from the remainder of the 12 rotavirus positive samples could not be amplified with the primers used in this study, classifying them as untypable G types. The gene encoding for VP4 (P type) could be amplified from 23 of the positive samples (Fig 2b). Type-specific RT-PCR and web-based analysis revealed that all the P genotypes belonged to BRV P[11]. Genotyping analysis of bovine rotavirus (G and P) indicated that G6P[11] was the most prevalent genotype (94.4%) followed by G10P[11] (5.6%).
Fig 2
Representative photographs of RT-PCR amplification of VP7 (a) and VP4 (b) genes.
Lanes: 1–5, suspected diarrheic stool samples. Successful amplification of VP7 and VP4 genes is seen in lane 1, 3, 5, (a) and lane 1, 3, 4, 5 (b), respectively; M, 100 bp DNA ladder (Promega, USA); The product lengths of VP7 and VP4 genes were 1062 and 877 bp, respectively.
Representative photographs of RT-PCR amplification of VP7 (a) and VP4 (b) genes.
Lanes: 1–5, suspected diarrheic stool samples. Successful amplification of VP7 and VP4 genes is seen in lane 1, 3, 5, (a) and lane 1, 3, 4, 5 (b), respectively; M, 100 bp DNA ladder (Promega, USA); The product lengths of VP7 and VP4 genes were 1062 and 877 bp, respectively.
Phylogenetic analysis
All the strains examined in this study clustered with the cattle rotavirus isolates reported in Bangladesh and India (Figs 3–5). BRVs from 17 calves exhibited extremely high sequence similarities in the VP7 gene (>90%) and were clustered with many strains from Asian countries. VP7 genes of the 17 Bangladeshi BRV G6 strains were the closest to those from India and Iran along with other Asian countries, showing >90% homology (Fig 3).
Fig 3
The evolutionary relationship of G6-VP7 genes of bovine rotaviruses detected in the present study (red rectangle).
The tree was constructed with the aligned sequences downloaded through BLAST search. The relationship was inferred using the Neighbor-Joining method and the ecleotide distances were measure using Kimura 80 model on CLC Sequence viewer 8.0. The scale bar at the bottom indicates nucleotide substitutions per site.
Fig 5
The evolutionary relationship of P11-VP4 genes of bovine rotaviruses detected in the present study (red rectangle).
The tree was constructed with the aligned sequences downloaded through BLAST search. The relationship was inferred using the Neighbor-Joining method and the nucleotide distances were measure using Kimura 80 model on CLC Sequence viewer 8.0. The scale bar at the bottom indicates nucleotide substitutions per site.
The evolutionary relationship of G6-VP7 genes of bovine rotaviruses detected in the present study (red rectangle).
The tree was constructed with the aligned sequences downloaded through BLAST search. The relationship was inferred using the Neighbor-Joining method and the ecleotide distances were measure using Kimura 80 model on CLC Sequence viewer 8.0. The scale bar at the bottom indicates nucleotide substitutions per site.
The evolutionary relationship of G10-VP7 genes of bovine rotaviruses detected in the present study (red rectangle).
The tree was constructed with the aligned sequences downloaded through BLAST search. The relationship was inferred using the Neighbor-Joining method and the ecleotide distances were measure using Kimura 80 model on CLC Sequence viewer 8.0. The scale bar at the bottom indicates nucleotide substitutions per site.
The evolutionary relationship of P11-VP4 genes of bovine rotaviruses detected in the present study (red rectangle).
The tree was constructed with the aligned sequences downloaded through BLAST search. The relationship was inferred using the Neighbor-Joining method and the nucleotide distances were measure using Kimura 80 model on CLC Sequence viewer 8.0. The scale bar at the bottom indicates nucleotide substitutions per site.One G10 BRV from a calf showed >90% identities with Indian strains (Fig 4).
Fig 4
The evolutionary relationship of G10-VP7 genes of bovine rotaviruses detected in the present study (red rectangle).
The tree was constructed with the aligned sequences downloaded through BLAST search. The relationship was inferred using the Neighbor-Joining method and the ecleotide distances were measure using Kimura 80 model on CLC Sequence viewer 8.0. The scale bar at the bottom indicates nucleotide substitutions per site.
A total of 21 P[11] Bangladeshi strains exhibited >90% VP4 gene sequence identity with each other and also with Indian strains (Fig 5). This result suggests that Bangladeshi BRVs might be of the same origin as those in India.
Discussion
About 23% of diarrheic calves were found to be positive for BRV. The prevalence of BRV infection varied significantly between regions, breed and age of calves. We have reported the BRV genotypes for the second time in Bangladesh. High-risk areas and crossbred calves ≤ 5 weeks should be targeted for future surveillance and control decisions. The predominant genotype could be utilized as a future vaccine candidate or vaccines with the dominant serotypes should be used to control BRV calf diarrhea in Bangladesh.
Epidemiology of bovine rotavirus
The overall prevalence of BRV among diarrheic calves (22.5%) is consistent with previous findings of rotaviral infection in various parts of the world. For instance in India, 22% of bovine samples were reported to be positive [30]. Similarly, another study reported 22.7% prevalence in diarrheic calves [29]. In Bangladesh, one study reported 18.3% prevalence of group A rotavirus infections in calves in Dhaka (capital and central) and Mymensingh districts (central north) [16]. In Dhaka district of Bangladesh, the prevalence of rotavirus infection in faeces varied from 7.2% in diarrheic and 6.3% in non-diarrheic calves [14]. Samad and Ahmed [31] reported 12% and 3% prevalence in diarrheic and non-diarrheic calves, respectively in Mymensingh [central-north]. Similarly, 6.2% prevalence of rotaviral infection in diarrheic calves was estimated recently in Netrokona (central north), Dinajpur (north west), and Chattogram (south east) [20]. The overall prevalence of rotavirus in calves, irrespective of diarrheic or non-diarrheic status, was reported to be 5.1% in Chattogram, Cox’s Bazar and Rangamati districts (south-east) [32]. Remarkably, the prevalence of this viral infection was found to be much higher in other countries compared to our study, e.g. 63% in Argentina [4], 79.9% in Australia [33], 32.5% in Sudan [34] and 36% in Iraq [35]. Different spatial, temporal and management-related factors might influence the prevalence of BRV infection. The prevalence of BRV infection might also vary due to differences in study design, sample size, analytical strategy and sensitivity of the diagnostic tests used. In this study, the prevalence of BRV infection was significantly higher in Barishal and Madaripur than Sirajgonj district. This might be due to differences in geographic area, nutritional status of the calves, type of animal rearing, application of hygienic measures in animal sheds and management of the dairy farm.Calves ≤5 weeks of age are at higher risk for BRV infection compared to those aged > 5 weeks. Similar findings have also been reported by other authors [36, 37]. Age-specific differences in infection are probably due to loss of receptors on enterocytes. The reason for the high occurrence of rotaviral diarrhea under 4–8 weeks of age could be due to a less-developed immune system in neonates and the lack of adequate amounts of maternal antibodies in the colostrum.Crossbred calves are at higher risk for BRV infection than indigenous calves. The breed of the animal is an important host determinant that influences the immune response and disease severity [27]. Generally, calf diseases are reported to be significantly higher in crossbred than indigenous animals [38]. Although statistically non-significant, the prevalence of BRV infection was 2.4 times higher in crossbred than indigenous calves in Bangladesh [20].
Genotyping of bovine rotavirus
In this study, 30 bovine positive rotavirus samples were used for genotyping. Out of 30 samples, 18 (60%) were typed as G (VP7) types. Among the G types, 17 (94.4%) and 1 (5.6%) were identified as G6 and G10, respectively. G6 and G10 are the most common G-types reported throughout the world [4, 10, 39]. Many studies have shown that the G6 strain is prevalent in different countries [10, 11, 40, 41]. In contrast to our results, G8 (17.9%) followed by G10 (8%) and G6 (1.6%) were reported as the most prevalent G-genotype of RVA in calves and goats in Bangladesh and India [20, 42]. This difference might be due to the differences in sample sizes and geographic locations of the study.In this study, 23 (76.7%) of the 30 samples were typed as P (VP4) types and all were P[11]. In contrast, P[1] (11.3%) was reported as the most frequent P-genotype followed by P[11] (3.2%) and P[15] (1.6%) in another study from Bangladesh [20].Similar to our findings, P[11] was also reported as the most prevalent (93.9%, 31/33) genotype in India [43]. However, P[5] was identified as the predominant (66%) serotypes in one study [10].
Genetic evolution of bovine rotaviruses
The phylogenetic analysis of the viruses detected in this study indicated that Bangladeshi and Indian isolates are clustered in the same lineage and distantly related with another lineage. G6 (VP7) genotype was highly identical to each other and also with Indian strains. In the case of G10 (VP7), Bangladeshi and Indian strains were identical. For the P[11] genotype, all Bangladeshi and Indian isolates were grouped within the same lineage. Bangladeshi and Indian isolates showed >90% identities at both nucleotide and amino acids levels. In addition, it was observed that all three Bangladeshi isolates have maximum identities of up to 98% at nucleotide and amino acids levels with the Indian isolates. Bangladesh and India share the fifth longest international land border (about 4,096 kilometers, including Assam, Tripura, Mizoram, Meghalaya and West Bengal). The West Bengal–Bangladesh border alone is 2,217 km. Legal and illegal movement of rotavirus-infected animals from India to Bangladesh might be frequent [44]. Therefore, the relatedness of Bangladeshi isolates with the Indian isolates is expected due to transboundary spread of the viruses.A limitation of this study was that we included only three out of 64 districts which represent only 5% of Bangladesh. We identified G6 and P[11] strains as prevalent genotypes whereas another study determined G8 and P[1] as prevalent genotypes [20]. This indicates that genetic diversity of BRV in calves exists in Bangladesh. Ongoing surveillance of BRV is required to understand the true prevalence and dominant genotypes in Bangladesh.
Conclusion
The most frequently identified bovine rotavirus genotype in Bangladesh was G6P[11]. About a quarter of the calf diarrhea cases was associated with BRV. High-risk areas and younger crossbred calves should be targeted for future surveillance and control decisions. The predominant genotype could be utilized as a future vaccine candidate or vaccines with the dominant genotype should be used to control BRV calf diarrhea in Bangladesh.
Data used for the identification of risk factors of bovine rotavirus infection in diarrheic calves.
(CSV)Click here for additional data file.(PDF)Click here for additional data file.6 Dec 2021
PONE-D-21-31987
Risk factors for bovine rotavirus infection and genotyping of bovine rotavirus in diarrheic calves in Bangladesh
PLOS ONE
Dear Dr. Alam,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Please submit your revised manuscript by Jan 20 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.We look forward to receiving your revised manuscript.Kind regards,Vibhav GautamAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf.2. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service.Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website (http://learn.aje.com/plos/) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services. If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free.Upon resubmission, please provide the following:● The name of the colleague or the details of the professional service that edited your manuscript● A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file)● A clean copy of the edited manuscript (uploaded as the new *manuscript* file).3. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.4. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.5. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.6. Please include your full ethics statement in the ‘Methods’ section of your manuscript file. In your statement, please include the full name of the IRB or ethics committee who approved or waived your study, as well as whether or not you obtained informed written or verbal consent. If consent was waived for your study, please include this information in your statement as well.7. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.8. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.Additional Editor Comments (if provided):Dear Dr. Alam,Please check the attached comments. As you can see that both the reviewers have suggested minor comments for the improvement of your manuscript.Thanks[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions
Comments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: PartlyReviewer #2: Yes********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: YesReviewer #2: Yes********** 3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: YesReviewer #2: Yes********** 4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: YesReviewer #2: Yes********** 5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Minor commentsAbstract1. The age of the calves should be preferably in weeks over months.2. Crossbred calves details like types, distribution among types, etc. missing.3. Comparison to Indian strain of G6 and G10 w.r.t. specific locations in genotype should be elaborated.Introduction1. There are lot of lines where space between words are missing. For example, Line 50. "Bovinerotavirus" should be "Bovine rotavirus"; Line 100. "...,breedand location..." should be "..., breed and ..."; Line 108. "..placedin.." should be "...placed in...". Similarly for Line 116. 153. 162. 171. 200. 201. 202. 214. 226. 258. 304.2. Line 52. RV is not abbreviated before.3. The flow of introduction should be re-looked.4. Line 166. Details of Chromas 2.23 required.5. Line 178. "ND: Note determined" should be "Not Determined"6. Table 3. Age should be presented in weeks instead of month. Breed details are required. Are Cross Breed unique or represent non-indigenous as a whole?7. Line 244. "This result...vice-versa" suggests transit of BRVs via established routes. Please revise the sentence appropriately.8. Line 224. "Blast" should be "BLAST"9. Line 314. "Legal and illegal...frequent". The author may substantiate this statement with reference.10. What is the detection limit of the PCR-test used.11. Different vaccines have been developed and deployed across the world. Serum Institute of India has made bovine rotavirus vaccine as well. The authors may comment upon the utility of known vaccines on the cohort tested.12. What is the vaccination status of the cohort and that of the herd from which the calves were selected? What criteria was used to determine selection of calves in the herd?13. How does the data correlate with Indian rotaviral reports like that of Tatte et a. 2019 (PMID: 30879319) and Kumar et al 2018 (PMID: 29464925), Chitambar 2011 (PMID: 20880637)?14. Have the authors identified any similarities with the human rotaviruses?Reviewer #2: In the present study, Ahmed et al. has tried to identify G and P genotypes of bovine rotavirus (BRV) strains in diarrheic calves as well as the major risk factors of BRV infection. In this study, Ahmed et al. noticed the predominant role of G6P[11] genotype (94.4%), followed by G10P[11] (5.6 %) in BRV infection. Further, their experimental evidence suggested age and breed of claves as major risk factors for the BRV infection.Comments:1. Authors should also discuss the impact of other factors particularly, season and sex in the abstract.2. In the introduction section, authors have discussed more about the genotypes of BRV; it will be good, if they will reduce this part and include a paragraph on the impact of different parameters (such as Herd size, colostrum feeding, colostrum timing and colostrum amount) on the rate of BRV infection in calves.3. If possible, authors should also examine the impact of other factors on BRV infection, which are also identified as one of the potential factors (such as Herd size, colostrum feeding, colostrum timing and colostrum amount) for BRV infection.4. In this study, author found that female calves are more susceptible for BRV infection while studies have also shown that male calves are more susceptible for BRV infection, what could be the possible reason; please discuss this in to the discussion section.6. Discuss the principle of rapid detection kit BIO K 152 behind the detection of BRV in the materials and methods.7. Authors should elaborate the methods used in the study for better understanding of the readers.8. In figure 1, authors have mentioned 11 RNA fragments but in the figure only 10 RNA segments are visible, 8th RNA segment in all groups is not visible. Please justify this. It will be good if authors will mention about the encoded proteins of different RNA fragments in figure as well as in the discussion section.9. In figure 2, label the name of gene (VP7 and VP4) along with product length.10. Author have stated two contradictory statements, Page 3, line No 3-4, and Page 12, line No 201-203, please clarify this.11. The pattern of cited references in the list is not consistent, please do the needful corrections.12. There are few grammatical and typographical mistakes in the manuscript, so authors should carefully read the manuscript and do the needful corrections.********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: NoReviewer #2: Yes: Dr. Ajay Kumar, Assistant Professor, Department of Zoology, Institute of Science, Banaras Hindu University, Varanasi-221005[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
Submitted filename: Reviewer comments.docxClick here for additional data file.29 Dec 2021We thank both reviewers for their valuable comments to improve the manuscript. The changes made in the revised manuscript were shown as blue font.Reviewer #1: Minor commentsAbstract1. The age of the calves should be preferably in weeks over months.Response: The Age was categorized to weeks as suggested. Lines 36 and Tables 2 and 3.2. Crossbred calves details like types, distribution among types, etc. missing.Response: The details of crossbred calves have been given in Table 2.3. Comparison to Indian strain of G6 and G10 w.r.t. specific locations in genotype should be elaborated.Response: Elaborated as suggested by the reviewer. Lines 39-40.Introduction1. There are lot of lines where space between words are missing. For example, Line 50. "Bovinerotavirus" should be "Bovine rotavirus"; Line 100. "...,breedand location..." should be "..., breed and ..."; Line 108. "..placedin.." should be "...placed in...". Similarly for Line 116. 153. 162. 171. 200. 201. 202. 214. 226. 258. 304.Response: Sorry for this unintentional mistake. They were corrected in the revised manuscript.2. Line 52. RV is not abbreviated before.Response: RV was elaborated at line 55.3. The flow of introduction should be re-looked.Response: The flow of the introduction was relooked.4. Line 166. Details of Chromas 2.23 required.Response: The details of the Chromas 2.23 were added in line 184.5. Line 178. "ND: Note determined" should be "Not Determined"Response: Corrected as Not Determined.6. Table 3. Age should be presented in weeks instead of month. Breed details are required. Are Cross Breed unique or represent non-indigenous as a whole?Response: Age was presented as weeks instead of months in the Table 3. The composition of cross breed calves was also provided in the Table 3.7. Line 244. "This result...vice-versa" suggests transit of BRVs via established routes. Please revise the sentence appropriately.Response: This sentence was revised as suggested by the reviewer. Lines: 267-268.8. Line 224. "Blast" should be "BLAST"Response: Blast was replaced by BLAST.9. Line 314. "Legal and illegal...frequent". The author may substantiate this statement with reference.Response: A reference was added to support this statement. Reference number 44.10. What is the detection limit of the PCR-test used?Response: We used conventional PCR so the detection limit is not applicable.11. Different vaccines have been developed and deployed across the world. Serum Institute of India has made bovine rotavirus vaccine as well. The authors may comment upon the utility of known vaccines on the cohort tested.Response: Serum Institute, India developed reasserted bovine pentavalent vaccine by using human G1, G2, G3, G4, and G9 serotypes in the genetic background of bovine rotavirus. This vaccine is intended for human use only. Although the name of the vaccine is bovine rotavirus pentavalent vaccine but principally this is not for animal use. We have mentioned in the submitted manuscript that the available vaccines having dominant genotypes in Bangladesh can also be used for our cattle population.12. What is the vaccination status of the cohort and that of the herd from which the calves were selected? What criteria was used to determine selection of calves in the herd?Response: Vaccination against rotavirus calf diarrhea has not yet initiated in Bangladesh. The calves were selected from the herd by a convenience sampling technique as we mentioned in the matherials and methods section. Line: 105.13. How does the data correlate with Indian rotaviral reports like that of Tatte et a. 2019 (PMID: 30879319) and Kumar et al 2018 (PMID: 29464925), Chitambar 2011 (PMID: 20880637)?Response: Tatte et al., reported 27.3% G10, while we detected only 3.3% G10. In addition the authors also reported P[6] and P[8] while we detected only p[11]. Similarly, Chitambar et al., 2011 reported G8P[14] which we did not detect. . Kumar et al., 2018 reported an unusual bovine rotavirus strain having similarly with human rotavirus which is not similar to our results. We have added this information in the discussion section.14. Have the authors identified any similarities with the human rotaviruses?Response: No, the bovine rotavirus genotypes we reported in this manuscript were not similar with human rotaviruses.Reviewer #2: In the present study, Ahmed et al. has tried to identify G and P genotypes of bovine rotavirus (BRV) strains in diarrheic calves as well as the major risk factors of BRV infection. In this study, Ahmed et al. noticed the predominant role of G6P[11] genotype (94.4%), followed by G10P[11] (5.6 %) in BRV infection. Further, their experimental evidence suggested age and breed of claves as major risk factors for the BRV infection.Comments:1. Authors should also discuss the impact of other factors particularly, season and sex in the abstract.Response: Season and sex were not significantly associated with BRV infection. So we did not add them in the abstract.2. In the introduction section, authors have discussed more about the genotypes of BRV; it will be good, if they will reduce this part and include a paragraph on the impact of different parameters (such as Herd size, colostrum feeding, colostrum timing and colostrum amount) on the rate of BRV infection in calves.Response: We have reduced the introduction section in relation to the BRV genotypes and added one paragraph about the effect of herd size, colostrum feeding, timing and amount. Lines: 87-94.3. If possible, authors should also examine the impact of other factors on BRV infection, which are also identified as one of the potential factors (such as Herd size, colostrum feeding, colostrum timing and colostrum amount) for BRV infection.Response: Thank you very much for this comment. It could be valuable if these variables were included in the analysis. However, we don’t have data for these variables.4. In this study, author found that female calves are more susceptible for BRV infection while studies have also shown that male calves are more susceptible for BRV infection, what could be the possible reason; please discuss this in to the discussion section.Response: As mentioned in the response to a previous comment of the reviewer that sex was not statistically associated with BRV infection. So we did not describe it in the manuscript.6. Discuss the principle of rapid detection kit BIO K 152 behind the detection of BRV in the materials and methods.Response: The principle of rapid detection kit BIO K 152 was added in the materials and method section as suggested by the reviewer. Lines: 113-116.7. Authors should elaborate the methods used in the study for better understanding of the readers.Response: We have elaborated risk factor identification methods. Lines: 144-151.8. In figure 1, authors have mentioned 11 RNA fragments but in the figure only 10 RNA segments are visible, 8th RNA segment in all groups is not visible. Please justify this. It will be good if authors will mention about the encoded proteins of different RNA fragments in figure as well as in the discussion section.Response: In figure 1, segments 8 and 9 are fused together while segment 7 is separate. So, it appears that there are 10 segments. The gene segments encoded proteins were mentioned in Figure 1 and also in the introduction.9. In figure 2, label the name of gene (VP7 and VP4) along with product length.Response: In figure 2, we have added the name of the genes with their product length. This has also been described in lines 161-162 and 166-167,10. Author have stated two contradictory statements, Page 3, line No 3-4, and Page 12, line No 201-203, please clarify this.Response: We did not find any contradictory statement in the mentioned places. However, we have rearranged lines 3-4 in page 3.11. The pattern of cited references in the list is not consistent, please do the needful corrections.Response: We have corrected the reference lists.12. There are few grammatical and typographical mistakes in the manuscript, so authors should carefully read the manuscript and do the needful corrections.Response: We have carefully read the revised manuscript and corrected the typographical mistakes. The grammatical mistakes were corrected by a native English speaking co-author.Submitted filename: Response to Reviewers.docxClick here for additional data file.26 Jan 2022
PONE-D-21-31987R1
Risk factors for bovine rotavirus infection and genotyping of bovine rotavirus in diarrheic calves in Bangladesh
PLOS ONE
Dear Dr. Alam,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Please submit your revised manuscript by Mar 12 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:
If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.We look forward to receiving your revised manuscript.Kind regards,Vibhav GautamAcademic EditorPLOS ONEJournal Requirements:Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.Additional Editor Comments (if provided):Dear Dr. Alam:I have received the reports from our advisors on your manuscript, "Risk factors for bovine rotavirus infection and genotyping of bovine rotavirus in diarrheic calves in Bangladesh.Based on the advice received, I have decided that your manuscript could be reconsidered for publication should you be prepared to incorporate major revisions. When preparing your revised manuscript, you are asked to carefully consider the reviewer comments which are provided below, and submit a list of responses to the comments.I look forward to receiving your revised manuscript.Sincerely yours,Vibhav Gautam[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions
Comments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: (No Response)Reviewer #2: (No Response)Reviewer #3: (No Response)********** 2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: YesReviewer #2: PartlyReviewer #3: Yes********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: YesReviewer #2: YesReviewer #3: N/A********** 4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: YesReviewer #2: YesReviewer #3: Yes********** 5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: NoReviewer #2: YesReviewer #3: Yes********** 6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: All previous comments have been answered except for minor language corrections and need of citation at one place. Please refer to details here.line 128 - centrification - should be centrifugation.line 163 - Rephrase to "RT-PCR targeting the genes - VP7 and VP4 were used to detect BRV."lines 216-7 - age is represented as months here while in previous sentences ages is mentioned in weeks. Please rectify.line 232 - Correct "segemnts" to "segments".Line 238-41 - Rephrase to "Based on the subtype-specific RT-PCR and we-based analysis, among the 18 amplicons evaluated, 17 were BRV G6 (94.4%) and 1 BRV G10 (5.6%). This indicates that G6 is the predominant genotype."Line 345 - What percentage of the total land of the nation, do the 3 districts cover?Line 346 - Give reference of the "another study".Reviewer #2: Authors have not performed the suggested experiments and have also not properly modified the manuscript as per the suggestion. More so, they have not well responded to the comments.Reviewer #3: Comments:1) In the present study authors focused only on three districts, what was the status of diarrheic calves in other districts of Bangladesh?2) As authors said they used BRV rapid detection kit_which only provides the information about the presence and absence of infection, what was the percentage of infection does any other method or technique to calculate the % of infection?3) In the present study authors find the G and P genotypes in diarrheic calves, if authors prefer the HRM (high resolution melting) analysis in control and infected calves to find out the SNP (single nucleotide polymorphism) which is responsible for the diarrheic condtion??4) In figure 2a lane no. four there is light amplified product , what represent this band??Minor comments:Line no.116,153,171,200,201,258,294 and 304 two-three words are combined ,this might be due to mac or windows please once check it.********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: NoReviewer #2: NoReviewer #3: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
6 Feb 2022We thank all reviewers for their valuable comments to improve the manuscript further. The changes we made in the revised version were shown in blue font.Reviewer #1: All previous comments have been answered except for minor language corrections and need of citation at one place. Please refer to details here.line 128 - centrification - should be centrifugation.Response: centrification was changed to centrifugation in line 128.line 163 - Rephrase to "RT-PCR targeting the genes - VP7 and VP4 were used to detect BRV."Response: Rephrased as suggested by the reviewer.lines 216-7 - age is represented as months here while in previous sentences ages is mentioned in weeks. Please rectify.Response: Age was converted to weeks according to the suggestion of a reviewer. However, we forgot to replace this in lines 216-217. Now, we have replaced months by weeks in lines 216-217.line 232 - Correct "segemnts" to "segments".Response: “Segemnts” was corrected to “segments” in line 232.Line 238-41 - Rephrase to "Based on the subtype-specific RT-PCR and web-based analysis, among the 18 amplicons evaluated, 17 were BRV G6 (94.4%) and 1 BRV G10 (5.6%). This indicates that G6 is the predominant genotype."Response: Rephrased as suggested by the reviewer in lines 238-241..Line 345 - What percentage of the total land of the nation, do the 3 districts cover?Response: It represents only 5% of Bangladesh. We have added this in lines 353-353..Line 346 - Give reference of the "another study".Response: We have added one reference in line 354.Reviewer #2: Authors have not performed the suggested experiments and have also not properly modified the manuscript as per the suggestion. More so, they have not well responded to the comments.Response: In fact, it is not clear what the reviewer means by “not performed the suggested experiments and have also not properly modified the manuscript as per the suggestion. The reviewer also mentioned that we did not respond properly to his comments”. As the reviewer did not make any specific comment, we are not able to address to the specific point in the revised manuscript. However, we have attached our response again to every comment of the reviewer in the first revision.=====================================================================Reviewer comments and response were in the first revision:1. Authors should also discuss the impact of other factors particularly, season and sex in the abstract.Response: Season and sex were not significantly associated with BRV infection. So we did not add them in the abstract.2. In the introduction section, authors have discussed more about the genotypes of BRV; it will be good, if they will reduce this part and include a paragraph on the impact of different parameters (such as Herd size, colostrum feeding, colostrum timing and colostrum amount) on the rate of BRV infection in calves.Response: We have reduced the introduction section in relation to the BRV genotypes and added one paragraph about the effect of herd size, colostrum feeding, timing and amount. Lines: 87-94.3. If possible, authors should also examine the impact of other factors on BRV infection, which are also identified as one of the potential factors (such as Herd size, colostrum feeding, colostrum timing and colostrum amount) for BRV infection.Response: Thank you very much for this comment. It could be valuable if these variables were included in the analysis. However, we don’t have data for these variables.4. In this study, author found that female calves are more susceptible for BRV infection while studies have also shown that male calves are more susceptible for BRV infection, what could be the possible reason; please discuss this in to the discussion section.Response: As mentioned in the response to a previous comment of the reviewer that sex was not statistically associated with BRV infection. So we did not describe it in the manuscript.6. Discuss the principle of rapid detection kit BIO K 152 behind the detection of BRV in the materials and methods.Response: The principle of rapid detection kit BIO K 152 was added in the materials and method section as suggested by the reviewer. Lines: 113-116.7. Authors should elaborate the methods used in the study for better understanding of the readers.Response: We have elaborated risk factor identification methods. Lines: 144-151.8. In figure 1, authors have mentioned 11 RNA fragments but in the figure only 10 RNA segments are visible, 8th RNA segment in all groups is not visible. Please justify this. It will be good if authors will mention about the encoded proteins of different RNA fragments in figure as well as in the discussion section.Response: In figure 1, segments 8 and 9 are fused together while segment 7 is separate. So, it appears that there are 10 segments. The gene segments encoded proteins were mentioned in Figure 1 and also in the introduction.9. In figure 2, label the name of gene (VP7 and VP4) along with product length.Response: In figure 2, we have added the name of the genes with their product length. This has also been described in lines 161-162 and 166-167,10. Author have stated two contradictory statements, Page 3, line No 3-4, and Page 12, line No 201-203, please clarify this.Response: We did not find any contradictory statement in the mentioned places. However, we have rearranged lines 3-4 in page 3.11. The pattern of cited references in the list is not consistent, please do the needful corrections.Response: We have corrected the reference lists.12. There are few grammatical and typographical mistakes in the manuscript, so authors should carefully read the manuscript and do the needful corrections.Response: We have carefully read the revised manuscript and corrected the typographical mistakes. The grammatical mistakes were corrected by a native English speaking co-author.====================================================================Reviewer #3: Comments:1) In the present study authors focused only on three districts, what was the status of diarrheic calves in other districts of Bangladesh?The status of BRV infection in diarrheic calves in other districts of Bangladesh was discussed in the discussion section of the first revision. We have highlighted those in lines: 293-301.2) As authors said they used BRV rapid detection kit which only provides the information about the presence and absence of infection, what was the percentage of infection does any other method or technique to calculate the % of infection?Response: Initially, we screened all samples by BRV rapid detection kit. The rapid test positive samples were further confirmed by PAGE. So, the percentage of infection according to the serial interpretation of both tests will be 15% (30/200). We have now added this result in the result section. Lines: 223-224.3) In the present study authors find the G and P genotypes in diarrheic calves, if authors prefer the HRM (high resolution melting) analysis in control and infected calves to find out the SNP (single nucleotide polymorphism) which is responsible for the diarrheic condition?Response: In our study, all the fecal samples were collected from diarrheic calves, showing symptoms of diarrhea. Sample was not taken from healthy cows. Therefore, comparison of Rotavirus genes between diarrheic cows and healthy cows was not possible, and SNP in VP7 and VP4 was not revealed in our study design.4) In figure 2a lane no. four there is light amplified product, what represent this band??Response: We consider that this band was nonspecific amplicon, because the size was a little larger than expected and faint. In the revised manuscript, additional description was inserted to legend of Fig.2 as follows (underlined). “……Lanes: 1-5, suspected diarrheic stool samples. Successful amplification of VP7 and VP4 genes is seen in lane 1, 3, 5 (a) and lane 1, 3, 4, 5 (b), respectively.”Minor comments:Line no.116,153,171,200,201,258,294 and 304 two-three words are combined ,this might be due to mac or windows please once check it.Response: Sorry for this unintentional mistake. We have checked the manuscript and corrected all combined words.Submitted filename: Response to reviewers.docxClick here for additional data file.14 Feb 2022Risk factors for bovine rotavirus infection and genotyping of bovine rotavirus in diarrheic calves in BangladeshPONE-D-21-31987R2Dear Dr. Alam,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,Vibhav GautamAcademic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:16 Feb 2022PONE-D-21-31987R2Risk factors for bovine rotavirus infection and genotyping of bovine rotavirus in diarrheic calves in BangladeshDear Dr. Alam:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Vibhav GautamAcademic EditorPLOS ONE
Authors: Feray Alkan; Aykut Ozkul; Tuba C Oguzoglu; Mehmet O Timurkan; Elvin Caliskan; Vito Martella; Ibrahim Burgu Journal: Vet Microbiol Date: 2009-09-26 Impact factor: 3.293
Authors: Alice Fernandes Alfieri; Amauri Alcindo Alfieri; Marco Antônio Bacellar Barreiros; José Paulo Gagliardi Leite; Leonardo José Richtzenhain Journal: Vet Microbiol Date: 2004-04-19 Impact factor: 3.293
Authors: Md Nazimul Islam; Mohammad Kamruzzaman Khan; Mohammad Ferdousur Rahman Khan; Polychronis Kostoulas; A K M Anisur Rahman; Md Mahbub Alam Journal: PLoS One Date: 2021-02-26 Impact factor: 3.240
Authors: Yashpal S Malik; Kuldeep Sharma; Nirupama Vaid; Somendu Chakravarti; K M Chandrashekar; Sanjay S Basera; Rashmi Singh; Gaya Prasad; Baldev R Gulati; Kiren N Bhilegaonkar; Awadh B Pandey Journal: J Vet Sci Date: 2012-09 Impact factor: 1.672