| Literature DB >> 35194965 |
Laura Le Gall1,2, William J Duddy1, Cecile Martinat3, Virginie Mariot4, Owen Connolly1, Vanessa Milla1, Ekene Anakor1, Zamalou G Ouandaogo2, Stephanie Millecamps5, Jeanne Lainé2, Udaya Geetha Vijayakumar1, Susan Knoblach6, Cedric Raoul7, Olivier Lucas7, Jean Philippe Loeffler8, Peter Bede9,10,11, Anthony Behin12, Helene Blasco13, Gaelle Bruneteau2,11, Maria Del Mar Amador11, David Devos14, Alexandre Henriques8, Adele Hesters11, Lucette Lacomblez10,11, Pascal Laforet15, Timothee Langlet11, Pascal Leblanc16, Nadine Le Forestier11, Thierry Maisonobe11, Vincent Meininger17, Laura Robelin8, Francois Salachas11, Tanya Stojkovic12, Giorgia Querin10,11, Julie Dumonceaux4, Gillian Butler Browne2, Jose-Luis González De Aguilar8, Stephanie Duguez1, Pierre Francois Pradat1,10,11.
Abstract
BACKGROUND: The cause of the motor neuron (MN) death that drives terminal pathology in amyotrophic lateral sclerosis (ALS) remains unknown, and it is thought that the cellular environment of the MN may play a key role in MN survival. Several lines of evidence implicate vesicles in ALS, including that extracellular vesicles may carry toxic elements from astrocytes towards MNs, and that pathological proteins have been identified in circulating extracellular vesicles of sporadic ALS patients. Because MN degeneration at the neuromuscular junction is a feature of ALS, and muscle is a vesicle-secretory tissue, we hypothesized that muscle vesicles may be involved in ALS pathology.Entities:
Keywords: Cell-cell communication; MND; Secreted vesicles; sporadic ALS
Mesh:
Year: 2022 PMID: 35194965 PMCID: PMC8978001 DOI: 10.1002/jcsm.12945
Source DB: PubMed Journal: J Cachexia Sarcopenia Muscle ISSN: 2190-5991 Impact factor: 12.910
Summary of the samples used from different subjects for each type of experiment
| Cell culture | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ALS/healthy | 57 subjects | Age at time of biopsy (years) | Gender | ALS/FRS | Genetics | Muscle testing | Site of onset 1 = upper limb 2 = lower limb; 3 = bulbar; 4 = respiratory | Disease duration (months) | Histology | Electron microscopy | Transcriptome | Immunostaining cell culture | RT‐qPCR | MuVs for proteomic analysis | MuVs for western blot | MuVs treatment MN | MuVs treatment myotubes |
| ALS | 27 ALS patients 8 F, 19 M 57.44 ± 9.47 | 50–59 | F | 38 |
| 130 | 1 | 13 | x | ||||||||
| ALS | 60–69 | M | 45 |
| 146 | 2 | 25.2 | x | x | x | |||||||
| ALS | 50–59 | M | 41 |
| 140 | 2 | 26.7 | x | x | ||||||||
| ALS | 50–59 | F | 39 |
| 146 | 3 | 16.5 | x | x | x | |||||||
| ALS | 50–59 | F | 28 |
| 119 | 3 | 6 | x | x | x | x | x | |||||
| ALS | 60–69 | M | 38 |
| 130 | 2 | 11.3 | x | x | x | |||||||
| ALS | 60–69 | M | 40 |
| 130 | 1 | 39.3 | x | x | x | x | ||||||
| ALS | 70–79 | M | 37 |
| 126 | 3 | 48.3 | x | x | x | x | ||||||
| ALS | 60–69 | M | 33 |
| 123 | 1 | 53.4 | x | x | x | x | x | |||||
| ALS | 70–79 | M | 32 |
| 104 | 1 | 28 | x | x | x | |||||||
| ALS | 60–69 | F | 30 |
| 97 | 1 | 71.6 | x | x | ||||||||
| ALS | 40–49 | M | 31 |
| 90 | 1 | 70 | x | |||||||||
| ALS | 50–59 | F | 23 |
| 103 | 3 | 33 | x | x | ||||||||
| ALS | 60–69 | M | 40 |
| 97 | 1 | 11 | x | x | ||||||||
| ALS | 60–69 | M | 38 |
| 88 | 1 | 52 | x | x | ||||||||
| ALS | 50–59 | M | 31 |
| 94 | 2 | 40 | x | x | x | |||||||
| ALS | 50–59 | M | 37 |
| No data | 0 | 101 | x | |||||||||
| ALS | 30–39 | F | 32 |
| No data | 0 | 85 | x | |||||||||
| ALS | 50–59 | F | 43 |
| 135 | 1 | 33.6 | x | x | x | |||||||
| ALS | 40–49 | M | 41 |
| 111 | 2 | 44.1 | x | x | x | x | ||||||
| ALS | 50–59 | M | 40 |
| 130 | 2 | 17.4 | x | x | x | |||||||
| ALS | 50–59 | M | 37 |
| 145 | 3 | 20.6 | x | x | x | x | ||||||
| ALS | 60–69 | M | 41 |
| 147 | 2 | 28.7 | x | x | x | |||||||
| ALS | 50–59 | M | 36 |
| 139 | 2 | 12 | x | |||||||||
| ALS | 60–69 | M | 43 |
| 149 | 1 | 12 | x | x | x | x | ||||||
| ALS | 30–39 | M | 41 |
| 144 | 1 | 12 | x | x | x | |||||||
| ALS | 50–59 | F | 40 |
| 98 | 3 | 14 | x | |||||||||
| Healthy | 30 healthy 10 F; 20M 51.08 ± 18.40 | 60–69 | M | — |
| — | — | — | x | ||||||||
| Healthy | 70–79 | M | — |
| — | — | — | x | |||||||||
| Healthy | 50–59 | F | — |
| — | — | — | x | |||||||||
| Healthy | 60–69 | F | — |
| — | — | — | x | |||||||||
| Healthy | 50–59 | M | — |
| — | — | — | x | |||||||||
| Healthy | 50–59 | F | — |
| — | — | — | x | x | x | |||||||
| Healthy | 40–49 | F | — |
| — | — | — | x | x | x | |||||||
| Healthy | 50–59 | M | — |
| — | — | — | x | x | ||||||||
| Healthy | 40–49 | M | — |
| — | — | — | x | x | ||||||||
| Healthy | 50–59 | M | — |
| — | — | — | x | x | x | x | ||||||
| Healthy | 50–59 | M | — |
| — | — | — | x | x | x | x | ||||||
| Healthy | 50–59 | F | — |
| — | — | — | x | x | x | x | x | |||||
| Healthy | 40–49 | F | — |
| — | — | — | x | x | x | |||||||
| Healthy | 50–59 | M | — |
| — | — | — | x | x | x | x | x | |||||
| Healthy | 70–79 | M | — |
| — | — | — | x | x | x | x | ||||||
| Healthy | 20–29 | M | — |
| — | — | — | x | |||||||||
| Healthy | 20–29 | M | — |
| — | — | — | x | |||||||||
| Healthy | 50–59 | M | — |
| — | — | — | x | |||||||||
| Healthy | 60–69 | F | — |
| — | — | — | x | |||||||||
| Healthy | 60–69 | M | — |
| — | — | — | x | |||||||||
| Healthy | 20–29 | M | — |
| — | — | — | x | x | x | x | ||||||
| Healthy | 30–39 | M | — |
| — | — | — | x | x | x | x | ||||||
| Healthy | 20–29 | M | — |
| — | — | — | x | x | x | x | x | |||||
| Healthy | 70–79 | M | — |
| — | — | — | x | |||||||||
| Healthy | 70–79 | F | — |
| — | — | — | x | |||||||||
| Healthy | 70–79 | M | — |
| — | — | — | x | |||||||||
| Healthy | 80–89 | M | — |
| — | — | — | x | |||||||||
| Healthy | 20–29 | M | — |
| — | — | — | x | x | ||||||||
| Healthy | 60–69 | F | — |
| — | — | — | x | x | ||||||||
| Healthy | 40–49 | F | — |
| — | — | — | x | x | ||||||||
Subject age at time of biopsy is indicated in the column ‘Age’. All amyotrophic lateral sclerosis (ALS) patients were confirmed to be ALS according to El Escorial. The ALSFRS‐R and Muscle Testing results measured at the time of the biopsies are given. The manual muscle testing score is the sum of 30 measurements (15 muscle groups assessed once on each side of the body), each scored from 0, representing total paralysis, to 5, representing normal strength, according to the Medical Research Council Score.
Figure 2Increased accumulation and secretion of vesicles by amyotrophic lateral sclerosis (ALS) myotubes. (A) Representative electron micrographs of vesicles extracted from the culture medium of ALS or healthy myotubes. Scale bar = 100 nm. The extracted vesicles have the typical cup‐shape of exosomes. (B) NanoSight analysis showing that ALS and healthy vesicle sizes range between 90–200 nm. (C) Representative electron micrographs of vesicle immunostaining showing that both ALS and healthy muscle vesicles (MuVs) express CD63 and CD82. bar = 100 nm. (D) ALS and healthy muscle vesicles are positive for Alix, flotillin, CD63 and CD81, and negative for calnexin. (E) The MuV fraction secreted by ALS myotubes contained 1.7 more protein than healthy MuV fraction. Left panel: schema summarizing the experimental procedure. Briefly, the same number of ALS and healthy myoblasts were differentiated, and after 3 days, the culture medium was harvested to extract the MuVs as described in material and methods. Right panel: protein quantification of MuVs; 800 000 differentiated myoblasts per subject, with n = 4 subjects per group. ** significantly different from healthy myotubes (P < 0.01). Values are means ± SEM. Refer also to Figure S2.
Figure 1Accumulation of extracellular vesicle markers in myotubes and muscle of amyotrophic lateral sclerosis (ALS) patients. (A) Panel showing representative images of CD63 immunostaining performed on cultured myotubes from different patients. (B) Quantification of CD63 fluorescence signal normalized per myonucleus (70–108 myonuclei were analysed per individual, with n = 5 ALS and 6 healthy subjects). *** significantly different from healthy with P < 0.001. (C) mRNA encoding for extracellular vesicle proteins normalized per B2M mRNA level are upregulated in ALS myotubes compared with healthy (n = 7 ALS, 6 healthy). * significantly different from healthy with P < 0.05. (D) Multi‐vesicular bodies that are present in ALS myotubes contain more exosome‐like vesicles than those of healthy controls. Left panel: Representative electron micrographs showing an accumulation of exosome‐like vesicles in multi‐vesicular bodies (MVBs; highlighted in pink—shown without highlight in Figure S1A). Scale bar = 500 nm. Right panel: quantification of the number of exosome‐like vesicles in the MVBs (100 MVBs per condition were analysed). Two sample Kolmogorov–Smirnov test confirmed the visual impression that the MVBs of ALS muscle contain a greater number of exosome‐like vesicles compared with healthy controls (P < 0.05). (E) Representative images of extracellular vesicle markers CD63 and TSG101 immunostaining in ALS and healthy muscle. CD63 green, TSG101 red, and dystrophin blue. Scale bar 50 mm. (F) Quantification of extracellular vesicle markers CD63 and TSG101 in muscle biopsies (Pixel per square millimetre), n = 6 ALS, 5 healthy for CD63, and n = 4 per group for TSG101; * and ** significantly different from healthy subjects, P < 0.05 and P < 0.01, respectively. (G) Western blots showing the expression of CD63 protein in muscle biopsies from ALS and healthy subjects (n = 7 per group). Skeletal alpha actin and Ponceau staining on the membrane are shown as loading controls. (H) Quantification of CD63 protein level normalized per loading control (n = 7 per group). * significantly different from healthy with P < 0.05. Values are means ± SEM. Refer also to Figure S1.
Figure 3Amyotrophic lateral sclerosis (ALS) muscle vesicles induce decreased neurite length and branching, and increased death, of human induced pluripotent stem cells derived motor neurons. (A) Equal quantities of ALS and healthy muscle vesicles (MuVs) are taken up by motor neurons. Red: MuVs labelled with PKH26 and added to the culture medium of iPSC‐derived motor neurons. (B) Neurite lengths of motor neurons are shortened when treated with ALS MuVs compared with healthy MuVs. Left panel: representative images of MuV‐treated motor neurons. Right panel: quantification of neurite length (8 to 15 motor neurons analysed per well, with n = 5 wells per treatment). ** and *** significantly different from ALS values P < 0.01 and P < 0.001, respectively. (C) Neurites of iPSC‐motor neuron (MN) cells have fewer neurite branch‐points following treatment with ALS MuVs compared with treatment with healthy MuVs; two‐sample Kolmogorov–Smirnov test confirmed the visual impression that the number of branches per neurite is decreased (P = 0.011). (D) Neurotoxicity of ALS MuVs is specific to motor neurons. Right panel: representative images of human iPSC‐MN treated with ALS or healthy MuVs. iPSC‐MN are positive for motor neuron marker Islet1/2 (green) and neuronal marker Tuj1 (orange). Right panel: quantification of human iPSC neuron and MN cells (10 frames per well, n = 3 wells per condition). ***P < 0.001 and TTT P < 0.001, significantly different from healthy‐MuV‐treated and non‐treated cells, respectively. (E) Quantification of the death of human iPSC‐motor neurons treated with equal amounts (by protein content: 0.5 μg) of ALS or healthy MuVs. MuVs were extracted from sporadic ALS patients negative for known mutations (each bar represents a different subject: n = 4 subjects per group, each in triplicate). ***P < 0.001, significantly different from healthy values. (F) Motor neuron survival in response to increasing concentrations of muscle vesicles from the muscle cells of ALS or healthy subjects. MuVs from the muscle cells of ALS patients (black bars) or healthy subjects (white bars) were added to cultures of iPSC‐derived MN at concentrations of 0.06, 0.12, 0.25, or 0.5 μg/150 μL. The total number of neurons at 72 h after treatment was counted in each condition and expressed as a percentage of the cell death that was observed in cultures of untreated motor neurons at the same time‐point. ANOVA 2‐factor followed by Bonferroni post‐hoc test was performed. *P < 0.05, **P < 0.01, and ***P < 0.001, significantly different from healthy‐MuV‐treated at that concentration. (G) Pre‐treatment of the ALS MuVs with CD63 antibody significantly decreased iPSC‐motor neuron (MN) cell death. * significantly different from ALS values, P < 0.05. Values are means ± SEM. Refer also to Figure S3.
Figure 4The proteomic content of muscle vesicles is enriched for FUS‐binding and TDP43‐binding proteins.(A) Output of EnrichR tool showing relative enrichment scores of gene ontology molecular functions among peptides that were observed at consistently higher levels in the muscle vesicles (MuVs) of amyotrophic lateral sclerosis (ALS) subjects compared with healthy controls (FDR P value for the RNA‐binding GO term was <1 × 10−7). (B) Whereas only 1.5% of all proteins are known binding partners of FUS and/or TDP43, they represent 13.4% (148 of 1254) of the proteins detected by proteomic analysis of ALS MuVs contents (Fisher's test P < 0.000001). (C) Representative images of Western blot showing the presence of FUS and RPL5 in muscle vesicles. CD81, extracellular vesicle markers. (D) FUS protein level in higher in ALS MuVs. Quantification by Western blot of FUS level in MuVs. **P < 0.01, significantly different from healthy values. n = 15 ALS and 13 healthy. (E) RPL5 protein level in higher in ALS MuVs. Quantification by Western blot of RPL5 level in MuVs. *P < 0.05, significantly different from healthy values. n = 6 subjects per group. Values are means ± SEM. Refer also to Figure S4, Tables S1 and S2.
Figure 5RNA processing is disrupted in amyotrophic lateral sclerosis (ALS) myotubes. (A) Enrichment map representing overlap and clustering of the cellular processes and pathways for which gene expression is dysregulated in ALS myotubes compared with healthy controls (red = upregulated; blue = downregulated). Upper inset: enrichment map showing that genes encoding FUS‐binding and TDP43‐binding proteins are upregulated in ALS myotubes compared with healthy controls, and that these genes are shared with many RNA‐processing pathways that are similarly upregulated (red = upregulated). (B) ALS myotubes present an accumulation of RNA in their nuclei. Left panel: representative images of RNA localization in ALS and healthy myotubes. Right panel: percentage of myonuclei with high levels of RNA, assayed by acridine orange staining (50 myonuclei analysed per subject, with n = 5 subjects per group). ***P < 0.001 significantly different from healthy myotubes. (C) RPL5, a protein involved in RNA transport and stress granules, is granulated in ALS myonuclei. Left panel: representative images of RPL5 localization in ALS and healthy myotubes. Right panel: percentage of myonuclei with RPL5 granules (at least 500 nuclei analysed per subject, with n = 4 subjects per group). **P < 0.01 significantly different from healthy myotubes. (D) ALS MuVs induce an accumulation of RNA in motor neuron (MN) nuclei. Left panel: representative images of RNA localization in MN nuclei. Right panel: percentage of nuclei with accumulations of RNA (150 to 260 nuclei analysed per well, with n = 3 wells per condition). ***P < 0.001 significantly different from healthy myotubes. Values are means ± SEM.
Figure 6The toxicity of amyotrophic lateral sclerosis (ALS) muscle vesicles to healthy motor neurons involves the FUS protein and RNA processing. (A) ALS muscle vesicles induce an accumulation of RNA in motor neuron (MN) nuclei. Left panel: representative images of RNA localization in motor neuron (MN) nuclei. Right panel: percentage of nuclei with accumulations of RNA (150 to 260 nuclei analysed per well, with n = 3 wells per condition). **P < 0.01 and TTT P < 0.001 significantly different from MN treated with healthy MuVs and untreated MN, respectively. (B) Cell death induced by 0.5 μg of ALS MuVs is exacerbated in the presence of over‐expression of FUS. ANOVA 2 factors was performed, showing the effect of ALS MuVs (P < 0.0001), the effect varying due to cell line (P < 0.0002), and an interaction between the two parameters (P < 0.05) (10 frames per well analysed, with n = 3 wells per condition). (C) Percentage of nuclei with RNA accumulation are decreased when ALS MuVs are added to the culture medium of cells deficient for FUS (FUS expression level was reduced by 79.5% ± 4.2% with siRNA strategy, 10 frames per well analysed, with n = 3 wells per condition). ***P < 0.001 ALS MuV‐treated cells. TTT P < 0.001 ALS MuV‐treated scramble‐RNA cells, respectively. (D) RPL5‐aggregates are no longer observed following ALS‐MuV treatment when the recipient cells do not express FUS. Left panel: representative images of myotubes treated with siFUS or siScrambled control, and with addition or not of ALS MuVs. Myotubes are immunostained for RPL5 (green). Right panel: Percentage of myotube nuclei with RPL5 aggregates in untreated (‘No exo.’), ALS‐MuV‐treated with no knockdown (‘No trans’), ALS‐MuV‐treated with siScrambled knockdown (‘Scr.’), or ALS‐MuV‐treated with siFUS knockdown (‘si‐FUS’). Eight hundred to 1000 nuclei were analysed per well, with n = 3 wells per condition. ANOVA 1 factor was performed, showing the effect of ALS MuVs on the two different knock‐down conditions, with ** and TT representing significant difference from ‘No trans.’ and ‘Scr.’, respectively, P < 0.01. (E) Percentage of cell death is decreased when ALS MuVs are added to the culture medium of cells deficient for FUS (FUS expression level was reduced by 79.5% ± 4.2% with siRNA strategy, 10 frames per well analysed, with n = 3 wells per condition). **P < 0.01 ALS MuV‐treated cells, respectively. TT P < 0.01 ALS MuV‐treated scramble‐RNA cells respectively. (F) FUS mRNA level is significantly higher in MN compared with myotubes. **P < 0.01 significantly different from human myotubes (n = 3 per group). Values are means ± SEM. Refer to Figure S5.
| Antibody | Clone | Manufacturer, Catalogue number | Species raised, Isotype | Dilution | Application |
|---|---|---|---|---|---|
| ALIX | 3A9 | Invitrogen, MA1‐83977 | Monoclonal, IgG1 | 1:500 | WB |
| Calnexin | AF18 | Life Technologies, MA3‐027 | Monoclonal, Mouse IgG1 | 1:100 | WB |
| Caprin (GPIP137) | Life Technologies, PA5‐29514 | Polyclonal, Rabbit IgG | 1:200 | ICC | |
| CD63 | BD Pharmingen | Monoclonal, Mouse IgG1 | 1:200 | IHC, ICC | |
| CD63 | TS63 | Life Technologies, 10628D | Monoclonal, Mouse IgG1 | 2 μg/mL | WB |
| CD81 | M38 | Invitrogen, 10630D | Monoclonal, Mouse IgG1 | 1:200 | WB |
| CD82 | Invitrogen, PA5‐27233 | Polyclonal, Rabbit | 1:200 | EM | |
| Dystrophin | 3B7 | DSHB, MANDYS1 | Monoclonal, Mouse IgG2a | 1:200 | ICC |
| Flotillin | Life Technologies, PA5‐18053 | Polyclonal, Goat IgG | 0.3 μg/mL | WB | |
| FUS | Bethyl, A300‐302A | Polyclonal, Rabbit IgG | 1:2000 | ICC | |
| FUS | Life Technologies, PA5‐23696/PA5‐52610 | Polyclonal, Rabbit IgG | 0.4 μg/mL | WB, ICC | |
| H2AX | Cell Signalling, 763J | Monoclonal, Rabbit IgG | 1:50 | ICC | |
| Isl1/2 | 39.4D5 | DSHB | Monoclonal, Mouse IgG2b | 1:100 | ICC |
| Myosin Heavy Chain | MF20 | DSHB | Monoclonal, Mouse IgG2b | 10 μg/mL | ICC |
| RPL5 | Life Technologies, PA5‐26269/PA5‐27539 | Polyclonal, Rabbit IgG | 1:500 | ICC | |
| RPL5 | Cell Signaling, 14568S | Polyclonal, Rabbit IgG | 1:1000 | WB | |
| SOD1 | Bethyl, A303‐812A | Polyclonal, Rabbit | 0.1 μg/mL | WB | |
| TDP43 | Invitrogen, PA5‐17011 | Polyclonal, Rabbit | 1: 1000 | WB | |
| Tsg101 | C‐2 | Santa Cruz, sc‐7964 | Monoclonal, Mouse IgG2a | 1:200 | ICC |
| Anti‐tubulin antibody, beta III isoform | TUJ1 | Millipore, MAB‐1637 | Monoclonal, Mouse IgG1 | 1:250 | ICC |
| Skeletal alpha‐actin | Invitrogen | Polyclonal, Rabbit | 1:1000 | WB |
| Primers | Sequence (5′ → 3′) | |
|---|---|---|
| β2M | Fw Primer | CTCTCTTTCTGGCCTGGAGG |
| Rev Primer | TGCTGGATGACGTGAGTAAACC |
| Sequence (5′ → 3′) | ||
|---|---|---|
| Primers | Rev primer | AGGAAAAGCCAGGTCCGAAC |
| CD81 | Fw primer | TTCCACGAGACGCTTGACTG |
| Rev primer | CCCGAGGGACACAAATTGTTC | |
| CD63 | Fw primer | CAGTGGTCATCATCGCAGTG |
| Rev primer | ATCGAAGCAGTGTGGTTGTTT | |
| CD82 | Fw primer | GCTCATTCGAGACTACAACAGC |
| Rev primer | GTGACCTCAGGGCGATTCA | |
| RAB5b | Fw Primer | TCACAGCTTAGCCCCCATGTA |
| Rev primer | CTTCACCCATGTCTTTGCTCG | |
| TSG101 | Fw primer | GAGAGCCAGCTCAAGAAAATGG |
| Rev primer | TGAGGTTCATTAGTTCCCTGGA | |
| FUS | Fw primer | TGGTCTGGCTGGGTTACTTT |
| Rev primer | TAACTGGTTGGCAGGTACGT |