Literature DB >> 35192647

Identification of a biological form in the Anopheles stephensi laboratory colony using the odorant-binding protein 1 intron I sequence.

Jehangir Khan1,2,3,4, Saber Gholizadeh5,6, Dongjing Zhang1,2,4, Gang Wang1,2,4, Yan Guo1,2, Xiaoying Zheng1,2,4, Zhongdao Wu1,2,4, Yu Wu1,2,4.   

Abstract

BACKGROUND: Anopheles stephensi Listen (1901) is a major vector of malaria in Asia and has recently been found in some regions of Africa. The An. stepehnsi species complex is suspected to have three sibling species: type, intermediate, and mysorensis, each with its own vector competence to the malaria parasite and ecology. To identify the members of the species complex in our An. stephensi insectary colony, we used the morphological features of eggs and genetic markers such as AnsteObp1 (Anopheles stephensi odorant binding protein 1), mitochondrial oxidases subunit 1 and 2 (COI and COII), and nuclear internal transcribed spacer 2 locus (ITS2).
METHODS: Eggs were collected from individual mosquitoes (n = 50) and counted for the number of ridges under stereomicroscope. Genomic DNA was extracted from female mosquitoes. After the amplification of partial fragments of AnsteObp1, COI, COII and ITS2 genes, the PCR products were purified and sequenced. Phylogenetic analysis was performed after aligning query sequences against the submitted sequences in GenBank using MEGA 7.
RESULTS: The range of ridges number on each egg float was 12-13 that corresponds to the mysorensis form of An. stephensi. The generated COI, COII and ITS2 sequences showed 100%, 99.46% and 99.29% similarity with the sequences deposited for Chinese, Indian and Iranian strains of An. stephensi, respectively. All the generated AnsteObp1 intron I region sequences matched 100% with the sequences deposited for An. stephensi sibling species C (mysorensis form) from Iran and Afghanistan.
CONCLUSIONS: This manuscript precisely describes the morphological and molecular details of the 'var mysorensis' form of An. stephensi that could be exploited in elucidating its classification as well as in differentiation from other biotypes of the same or other anopheline species. Based on our findings, we recommend AnsteObp1 as a robust genetic marker for rapid and accurate discrimination (taxonomic identification) of the An. stephensi species complex, rather than the COI, COII, and ITS2 marker, which could only be utilized for interspecies (Anopheles) differentiation.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35192647      PMCID: PMC8863247          DOI: 10.1371/journal.pone.0263836

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

A wide variety of medically important insects belong to cryptic species complexes, which are morphologically identical (isomorphic), but reproductively isolated and have different seasonal prevalence, host preference, infection rates, resting habits, and biting cycles [1-3]. For instance, around 70 out of 482 species of anopheline mosquitoes act as vectors for malaria parasites and nearly 30 complexes of these have been identified so far in the world [4-6]. Because of the discovery of new biological species, the number of Anopheles vector species is rapidly rising [4-8]. The available information regarding the biology and distribution of An. gambiae, An. culicifacies, and An. dirus complexes in Africa, India, and Thailand, respectively, has demonstrated the importance of identifying the members of these species complexes [5]. Failure to discriminate among the vector and non-vector sibling species of anopheline species complexes may seriously mislead the malaria epidemiological mapping and the subsequent vector control strategies [5]. Lack of adequate knowledge about vector species complexes is playing a significant role in the current worsening scenario of human malaria in the Asian-Pacific area [9], with worldwide malaria cases rising from 217 million in 2016 to 219 million in 2017 and around 229 million in 2019 [10]. An. stephensi is one of the dominant malaria vectors in Middle East, the Indian subcontinent, Iran, Iraq, Bangladesh, south China, Myanmar, Thailand and Ethiopia [9,11,12]. Based on egg morphometric analysis, An. stephensi has three biological forms i.e. mysorensis, intermediate and type form [3] and these were identified as sibling species as Species C, Species B and Species A respectively [3,5]. The type biological form is an efficient vector of malaria in urban areas [13] whereas mysorensis is a poor vector (highly zoophilic) and limited only to rural areas, although it is susceptible to Plasmodium vivax (VK210B) [3,8,14]. The intermediate biological form is reported from rural and peri-urban areas with very little information about its vectorial capacity [6,15]. Despite efficient controlling strategies for malaria, An. stephensi is increasing in its geographic range [6]. Thus, there is a dire need for the precise identification of members of the Anopheles stephensi and also for the members of the other Anopheles complexes which is crucial in malaria surveillance, effective control, and elimination strategies [5,15]. Information regarding population genetics of An. stephensi is still limited [16,17]. The mitochondrial oxidases subunit 1 and 2 (COI and COII), ribosomal internal transcribed spacer 2 (rDNA-ITS2) and domain-3 (D3) loci are the common molecular markers used, but none of them have distinguished accurately the biological forms of An. stephensi [15,17,18]. Alternatively, intron I sequences of Odorant-binding protein 1 has been recently shown to be potential genetic marker to differentiate members of the An. stephensi complex [15]. Accurate identification, the spatial distribution and population dynamics of cryptic species of the An. stepehnsi complex has major human health implications since it directly impacts the vector control and disease management strategies [4,5]. Consequently, this study was designed with the following objectives: (i) to assess the potential of COI and COII, and ITS2 (routinely used markers) genes variations for reconstructing the phylogeny and recognition of cryptic species of An. stephensi in our insectary (ii) to demonstrate (as a secondary evidence) the AnsteObp1 intron I sequence a robust marker for rapid and accurate identification of An. stephensi and (iii) finally to introduce an optimized and easy protocol for sibling species identification of An. stephensi, based on the current molecular and morphological data. It is indispensable to accurately characterize the insectary colony that could be used in vector control strategies such as Wolbachia-based, and gene drive, etc. These developing technologies are becoming more popular and important for vector population replacement/suppression, but they are highly species-specific. The preliminary sequence data (associated with mysorensis) generated through this study may contribute well to the knowledge and reliable identification (taxonomic and phylogenetics) of the mysorensis form of An. stephensi.

Material and methods

Colony maintenance

The colony of An. stephensi (Hor strain) has been maintained over 6 years in the insectary in 30×30×30 cm cages at Sun Yat-sen University, Guangzhou, Guangdong Province of China. Originally, this species was obtained with the courtesy of Wen-Yue Xu from Department of Pathogenic biology, Third Military Medical University, Chongqing China [19]. The rearing conditions were 28 ± 2°C, 70 ± 5% RH, and a 12:12 (L: D) h photoperiod with a 10% (W/V) sugar solution. Plastic trays (30 × 40 × 8 cm) were used for larvae rearing with deionized water and fed with IAEA 2 larval food in accordance with the standard explained procedure [20].

Mosquito feeding, collection and morphological study of eggs

After 5–7 days of adult emergence, the female mosquitoes were allowed to feed on anesthetized white mice (Kunming strain) for 30 minutes to start egg development. After blood feeding, about 50 engorged females were randomly isolated and kept in individual properly labeled plastic tubes (50 mL) (one mosquito/tube) with a dump paper at the bottom of each tube for eggs collection. The tubes were provided with cotton soaked in 10% sugar solution. After three days, the adult females were processed further for molecular analysis. About 50 eggs were mounted on slide (each time) with a drop of water and examined under stereomicroscope with 40 × (bright field illumination) magnification to count the number of ridges on eggs (one side) as described previously [3,16]. In addition, scanning electron microscopy image was taken to clearly show the egg form.

DNA extraction and PCR

After egg laying process, individual female mosquito from each tube was processed for DNA extraction using Dongsheng Biotech DNA extraction kit according to the manufacturer’s instructions. Briefly, one mosquito was taken in 1.5 mL tube containing around 500 μL STE buffer and a small steel ball, and homogenized (50 Hzs for 30–60 seconds). Then 5 μL of this grinding solution (for each sample) was mixed with 18 μL of DNA extraction solution in a PCR tube, mixed well and incubated for 2 minutes at room temperature. Samples were processed for PCR with thermal condition at 95°C for 10 minutes. Afterwards, 2 μL of neutralizing fluid was added to each PCR product, mixed well and incubated for several minutes at room temperature. Finally, the extracted DNA was either kept at -20°C or immediately processed for further amplification of target gene.

Amplification of COI, COII, ITS2, and AnsteObp1 fragments

PCR was performed for individual mosquito (n = 50) to amplify COI, COII, ITS2 and AnsteObp1 partial genes. The PCR reactions were carried out in a 25 μL volume and the details of used primers and PCR conditions for each marker are presented in Table 1. Double distilled H2O was used as negative control instead of template DNA in PCR reactions. The PCR products were purified by using TaKaRa agarose Gel DNA extraction Kit (Japan) and the amplicons were subsequently sequenced bi-directionally (both directions) using Sanger sequencing technology.
Table 1

Primers detail and their respective thermal profiles in PCR amplification.

Primer NameSequence 5–3Size (bp)Thermal ProfileReference
COIF TTGATTTTTTGGTCATCCAGAAGT 877DT: 94°C (4 min), 94°C(1m),AT: 55°C (1m)ET: 72°C (2m), 72°C for (7m). 32 cyclesChavshin et al., 2014 [39]
COIR TAGAGCTTAAATTCATTGCACTAATC
COII F ATGGCA ACATGAGCAAATT 640
COII R CCACCCTTTCTGAACATTGACC
ITS2 5.8s F ATCACTCGGCTCGTGGATCG 650DT: 95°C (2m) 95°C (30s),AT: 50°C (30s), ET: 72°C (1m), 72°C (5m). 30 cyclesCarter et al., 2018; [40]Djadid et al., 2006 [2]
ITS2 28s R ATGCTTAAATTTAGGGGGTAGTC
ANSTEOBP1 F CGTAGGTGGAATATAGGTGG 845DT: 95°C (5m), 95°C (1m)AT: 60°C (1.20m), ET: 72°C for 1.20m and further 10 m. 30 cyclesGholizadeh et al., 2018 [1]
ANSTEOBP1 R TCGGCGTAACCATATTTGC

F: Forward, R: Reverse, DT: Denaturation Temperature, AT: Annealing Temperature, ET: Extension Temperature. m: Minute, s: Second.

F: Forward, R: Reverse, DT: Denaturation Temperature, AT: Annealing Temperature, ET: Extension Temperature. m: Minute, s: Second.

Sequence analysis and phylogenetic tree construction

The sequences were trimmed to remove any primer or other nucleotide contamination and double checked with Chromas software version 2.31 (www.technelysium.com.au/chromas.html). The final sequences were aligned using ClustalW [21] with the homologous sequences downloaded from GenBank and phylogenetic trees were constructed using distance Neighbor-joining and maximum likelihood Methods based on the Tamura–Nei model in MEGA7 [22]. A 120 bp fragment of AnsteObp1 intron I region from sequenced specimens selected from 845 bp sequenced region was used for analysis. An. stephensi sibling species sequences, A (KJ557463), B (KJ557452), C (KJ557455) [15] were used as representative for sequence comparisons and phylogenetic tree construction.

Results

Morphological analysis of the eggs

A total of 500 eggs were examined. We detected uniformity in all the observed eggs with ridges number 12–13 per egg (Fig 1). Based on the previously reported range of egg ridges, our laboratory mosquito colony was identified as the mysorensis biological form of An. stephensi. The previously defined criteria for identifying these three biological forms on the basis of ridges on floating eggs are about 10–15 (mysorensis), 15–17 (intermediate) and 17–22 egg ridges (type form) [3,23].
Fig 1

Scanning electron micrograph of Anopheles stephensi ‘mysorensis’ form egg: (a) Ventral aspect showing deck area (scale bar: 100 μm); (b) Lateral aspect showing floats and ribs (scale bar: 50 μm); (c) Lateral aspect (scale bar: 50 μm).

Scanning electron micrograph of Anopheles stephensi ‘mysorensis’ form egg: (a) Ventral aspect showing deck area (scale bar: 100 μm); (b) Lateral aspect showing floats and ribs (scale bar: 50 μm); (c) Lateral aspect (scale bar: 50 μm).

Molecular sequence analysis

Phylogenetic analysis of mitochondrial oxidase subunit I (COI)

Among 50 samples randomly selected for DNA extraction, 38 samples were sequenced; 9 samples for each of COI and COII, 7 for ITS2 while 13 samples were for AsteObp1. The size of sequenced COI (MW012492 and MZ269698-MZ269705) (S1 Table) region of the lab strain was 839 bp and trimmed to 758 bp with GenBank sequences and used for analysis and phylogenetic tree construction. There are 101 sequences of An. stephensi COI gene submitted to GenBank, of them, seven sequences (from Iran, India, China and Brazil) were compatible with our lab strain and included in the sequence analysis (Figs 2 and S1). Multiple sequence alignment showed that the similarity between lab strain COI sequence and GenBank sequences was 99.87–100%. There were 7 mismatches in COI sequences as a transversion and 6 transitions (Figs 2 and S1). Interestingly, a sequence directly submitted from China [24] was 100% similar to our lab strain COI sequence (Fig 2). Interestingly, COI sequence of An. stephensi from Iran, India, Brazil and China distributed in three different clades in a phylogenetic tree (S1 Fig) (it will be because the sequences were from An. stephensi sensu lato). Our lab strain sequence was placed with Chinese An. stephensi sequence in the same clade.
Fig 2

Phylogeny of COI sequence from lab strain.

Bootstrap values >70 shown at nodes. Nodes without numbers had a value <70. Final ML Optimization Likelihood: -1252.592081.

Phylogeny of COI sequence from lab strain.

Bootstrap values >70 shown at nodes. Nodes without numbers had a value <70. Final ML Optimization Likelihood: -1252.592081.

Phylogenetic analysis of mitochondrial oxidase subunit II (COII)

The COII sequences of An. stephensi (n = 24) extracted from GenBank were compared with our lab strain sequences (n = 9). Four sequences were excluded because of shorter sequence size. COII sequences (560bp; MW431057, and MZ420723-MZ420730) (S1 Table) of lab strain showed 99.82–100% similarity within nine sequences. A limited variation was because of two mismatches in 195 (C/T), 215 (A/G) and 523 (T/A) nucleotides as transition and transversion, respectively (S2 Fig). The similarities between our sequences and 20 An. stephensi COII sequences available in GenBank deposited from different countries were 98.75–99.82% (Figs 3 and S2). Less than 2% variation was because of 13 mismatches as transition (n = 11) and transversion (n = 2) (Figs 3 and S2). Interestingly, mismatches in 195, 454, and 547 positions were specific to lab strain (S2 Fig). Phylogenetic tree constructed based on An. stephensi COII sequences categorized the sequences in 3 clades (Fig 3). Lab strain sequence was placed in a separate clade together with An. stephensi COII sequences from India and Iran (Fig 3).
Fig 3

Phylogeny of COII sequence from lab strain.

Bootstrap values>70 shown at nodes. Nodes without numbers had a value <70. Final ML Optimization Likelihood: -1252.592081.

Phylogeny of COII sequence from lab strain.

Bootstrap values>70 shown at nodes. Nodes without numbers had a value <70. Final ML Optimization Likelihood: -1252.592081.

Phylogenetic analysis of nuclear internal transcribed spacer 2 locus (ITS2)

After BLAST, An. stephensi rDNA-ITS2 sequences were extracted from GenBank (n = 118). These sequences were previously submitted from Iran, India, Iraq, Saudi Arabia and Sri Lanka. Eleven sequences from Sri Lanka were partial and therefore, excluded from the study. Finally, 37 representative rDNA-ITS2 sequences from GenBank and sequences obtained in the current study (n = 7; MW017363 and MW017364, MZ269267- MZ269271) (470bp) (S1 Table) were used for analysis and phylogenetic tree construction (Figs 4 and S3). Comparisons of our new lab strain sequences showed 98.71% similarity with each other, while they were randomly selected from the same colony. BLAST analysis of obtained sequences showed 97.63–100% similarities with sequences reported from Iran, India, Iraq and Saudi Arabia (Fig 4). Interestingly, a sequence from India, HQ703001, showed 82.19–82.97% similarity with other rDNA-ITS2 sequences of An. stephensi, while its similarity with AY702482 from Iran was 98.28–99.79% (Figs 4 and S3). The similarity among Lab sequences with others was 97.63–99.57% (Fig 4). The topology of phylogenetic tree based on rDNA-ITS2 sequences of An. stephensi was similar to COI and COII having 3 clades with lower bootstrap values for clades (S3 Fig).
Fig 4

Phylogeny of rDNA-ITS2 sequences from lab strain.

Bootstrap values >70 shown at nodes. Nodes without numbers had a value <70. Final ML Optimization Likelihood: -1104.708501.

Phylogeny of rDNA-ITS2 sequences from lab strain.

Bootstrap values >70 shown at nodes. Nodes without numbers had a value <70. Final ML Optimization Likelihood: -1104.708501.

Phylogenetic analysis of An. stephensi odorant binding protein 1 (AnsteObp1)

Multiple sequence alignment showed 100% similarity of AnsteObp1 intron I sequence among thirteen An. stephensi specimens (MW013512-MW013520 and MZ420719-MZ420722) (S1 Table). They were 100% similar with An. stephensi sibling C (mysorensis) (from Iran and Afghanistan), while their similarity with An. stephensi sibling A and B was 85% and 75.65%, respectively (Fig 5). The AnsteObp1intron I sequences obtained in this study were clustered in a separate clade together with An. stephensi sibling C (mysorensis) in a based phylogenetic tree (Fig 6). As shown previously [15,16], An. stephensi sibling species A and B were placed in the separate clades (Fig 6).
Fig 5

Multiple sequence alignment of AnsteObp1 partial sequence of lab strain with three known biological forms of An. stephensi.

Fig 6

Phylogenetic three constructed based on AnsteObp1 intron I region of An. stephensi sequences from Lab strain China and representative sequences from GenBank.

Discussion

Traditionally, An. stephensi was classified into two races based on the number of egg ridges [23], the ‘mysorensis’ and ‘type’, which were considered as sub-species [25,26] or sympatric species [27,28]. Later studies used different methods to give specific taxonomic status to these three ecological/biological forms that differed in ridges number on the eggs, namely genetic crosses [3,16], cuticle hydrocarbons [29], chromosome karyotypes [30-33], spiracular index [34,35], differences in mating characteristics and behavior [5], cytogenetic properties [30,31], and molecular markers (ITS2, D3 loci, CO1 and COII) [18]. But none of these methods could clearly differentiate and give species status to the biological forms of An. stephensi [17,18,26]. Recently, AnsteObp1 is reported as a new marker for identification of the Asian main malaria vector, An. stephensi [15]. In the current study, we assessed the effectiveness of commonly used (COI, COII, and ITS2) and novel (AnsteObp1) markers, as well as morphological features (egg ridge counts), in identifying the biological form of An. stephensi. The extensive morphological analysis of our mosquito eggs showed that ridges number in the range 12-13/egg corresponds to the mysorensis form of An. stephensi [3,23]. Our results are in accordance with the previously reported range of ridges number (mysorensis) i.e. 11 to 14 [35], 13–14 [36], 10–14 [3]. Similarly, the phylogenetic analysis (Fig 6) of AnsteObp1 sequences of our mosquito strain showed 100% similarity with sibling species C reported from Iran and Afghanistan (the neighboring country of China). The current study has some limitations. First, the test was limited to a single laboratory colony (wild mosquitoes were not available because of strict vector control measures in China). Second, we have not developed a rapid PCR-based test and identification of the biological form requires sequencing, which is both labor-intensive and time-consuming. Third, only a single (the last) SNP discriminates all three forms: "C" in mysorensis, "T" in intermediate, and "G" in type. Other polymorphisms are shared between at least two forms. However, in a previous study [16], the entire wild collection of three strains of An. stephensi was successfully discriminated using AnsteObp1. This identification was attributed to the form specific/associated mutations (4–15%) within the intron region of AnsteObp1 between biological forms but no significant variation was noticed within the biological forms [16]. There was 99–100% similarity in the amino acids sequences of AnsteObp1 among these members, with a single substitution (non-synonymous) in the type form [16]. Taking together, our mysorensis associated preliminary sequence data may be exploited as representative/reference sequences for sequence comparisons and phylogenetic tree construction in similar studies in the future. Finally, our investigations, based on egg morphology and sequence analysis, endorse the use (independent) of the AnsteObp1 intron I sequence as a suitable molecular tool for quick and reliable identification of An. stephensi mysorensis form. Vector control is fundamental for preventing the spread of malaria. Understanding population genetic structure of mosquito is imperative for shaping prevention strategies, particularly Wolbachia-based, gene drive, etc. The level of gene flow between mosquito populations can be predicted using population genetics research [37]. There are conflicts in the results regarding intra-species cross mating experiments. For example, reciprocal crosses between mysorensis and type strains reported a definite incompatibility [28]. Others demonstrated variations in the reproductive capacity within An. stephensi [38]. In contrast, no hybrid sterility was reported during a type-mysorensis cross experiments [27]. Subbarao et al (1987) did not find sterility in crossing experiments between the laboratory strains of the three ecological forms/biological forms [3]. As a result, these experiments provide perplexing results, which should be repeated after precise recognition of members of this species complex using effective genetic marker, such as AnsteObp1, and following the techniques outlined here (Table 1). Further, there is a dire need to see whether pre-mating (reproductive isolation) barriers exist among these forms in the field. Accurate identification and exploring mating compatibility/incompatibility of the wild populations with the released (lab) strain is essential for the successful operation and field application of new emerging technologies i.e. Wolbachia-based that has been implemented for the suppression/replacement of wild Aedes mosquito population in a dozens of countries to control dengue and Zika viruses [39]. If both the wild and lab (Wolbachia infected) mosquito populations are compatible, this approach could be used to eradicate malaria vectors in the wild. Regarding the suitability of ITS2, COI and COII for distinguishing the biotypes of An. stephensi, our current observations and previous studies [17,18] confirm that these markers are not the suitable markers (based on high sequence similarity). In contrast, a new study reports both COI and COII (gene variation) as suitable markers to recognize the complexes of An. gambiae and An. albitarsis [40]. Yet our BLAST searches at GenBank database for either of ITS2, COI and COII sequences once again revealed them inappropriate for distinguishing our species strain. Our results are in accordance with [13,18,41,42]. Here, the phylogenetic analysis for COI, COII and ITS2 indicated our species 100%, 99.46% and 99.29% similar to other Chinese, Indian and Iranian strains of An. stephensi (Figs 2–4). Consequently, this indicates that aforesaid markers could be recommended only for identifying the species of An. stephensi (interspecies of Anopheles mosquito). Thus the independent use of AnsteObp1 and associated protocols mentioned in this study are recommended to be used in future investigations that involve distinguishing the members of An. stephensi (intra-species variation).

Conclusion

This study finds AnsteObp1 as a robust genetic marker for the identification of members of the An. stephensi complex. We support the hypothesis based on the inability of COI, COII, and ITS2 to identify An. stephensi’s sibling species. This study provides important information on morphological and molecular characterization of mysorensis biological form and the associated protocols. Conducting comprehensive entomological surveillance with precise identification of sibling species of An. stephensi complex contribute significantly to the ongoing malaria control strategies. Consequently, we urge more research on the An. stephensi complex’s bionomics, seasonal abundance, host and habitat preferences, plasmodium parasite susceptibility, biting cycle, and response to vector control strategies.

Multiple sequence analysis of COI sequence from lab strain.

Bootstrap values >70 shown at nodes. (DOCX) Click here for additional data file.

Multiples sequence analysis of COII sequence from lab strain.

Bootstrap values >70 shown at nodes. (DOCX) Click here for additional data file.

Multiples sequence analysis of rDNA-ITS2 lab strain.

Bootstrap values >70 shown at nodes. (DOCX) Click here for additional data file.

GenBank accession numbers of COI, COII, ITS2 and AnsteObp1 sequences obtained during the current study and the publicly available sequence that showed highest similarity (>96% similarity) to these sequences.

(DOCX) Click here for additional data file. 18 Jan 2022
PONE-D-21-36790
Speculation on the possibility for introducing Anopheles stephensi as a species complex: secondary evidence based on odorant-binding protein 1 intron I sequence
PLOS ONE Dear Dr. Khan, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.
 
Please address all the comments from both reviewers. Especially include the limitations of your study as indicated by reviewer 2. Make sure that the accession numbers are working. They are not searchable now. Also, consider modifying the title as the correct title is similar to the one in the previously published paper: https://doi.org/10.1186/s12936-018-2523-y. Please submit your revised manuscript by Mar 03 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Igor V. Sharakhov Academic Editor PLOS ONE Journal Requirements: 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2.  Thank you for stating in your Funding Statement: ( This study is supported by the National Research and Development Plan of China (No. 2016YFC1200500) and 111 project (B12003). Prof Wu Zhongdao has received this funding.) Please provide an amended statement that declares *all* the funding or sources of support (whether external or internal to your organization) received during this study, as detailed online in our guide for authors at http://journals.plos.org/plosone/s/submit-now.  Please also include the statement “There was no additional external funding received for this study.” in your updated Funding Statement. Please include your amended Funding Statement within your cover letter. We will change the online submission form on your behalf. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Partly ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: N/A Reviewer #2: N/A ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: No ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Page 3: Authors claim "AnsteObp1 as a robust genetic marker for rapid and accurate discrimination (taxonomic identification) of the An. stephensi species complex". Page 11: " Finally, our investigations, based on egg morphology and sequence analysis, endorse the use (independent) of the AnsteObp1 intron I sequence as a new molecular tool for quick and reliable identification of all the three biological forms of An. stephensi." First: this claim had been proposed before on 2015, so this is not a "new" molecular tool. Second: In this study only An. stephensi mysorensis lab strains were used. No wild anopheles and no type and intermediate forms were used. Third: how would you use this marker to separate Type and Intermediate forms from Mysorensis? The answer to this question is not clearly mentioned in the manuscript. Phylogenetic trees in Fig.2-3 -4: Comparison between sequences is not clearly mentioned in the phylogenetic tree by name/region. Reviewer #2: The manuscript by Jehangir Khan and coauthors tested the application of SNPs in the Anste Obp1 gene described in previous work for identification of biological form in the laboratory colony from China. The study is well done but it has quite a limited scope since it focuses only on one mosquito colony. The title is not appropriate for this work as it does not introduce a new marker for species discrimination. I suggest changing the title to “Identification of a biological form in the Anopheles stephensi laboratory colony using the odorant-binding protein 1 intron I sequence.” The authors should clearly state the limitations of their work. First, the test was limited to a single laboratory colony. Second, the authors have not developed a rapid PCR-based test and identification of the biological form requires sequencing, which is labor- and time-consuming. Third, only a single (the last) SNP discriminate all three forms: “C” in mysorensis, “T” in intermediate, “G” in type. Other polymorphisms are shared between at least two forms. The authors wrote that they counted for the number of ridges under stereomicroscope, however Figure 1 shows a scanning electron micrograph. Please, clarify and correct this, and also provide scale bars. Please, correct the following: Abstract: An. stepehnsi species complex - change to - The An. stephensi species complex vector competence (malaria) and ecology - change to - vector competence to the malaria parasite and ecology. To identify the species complex of our An. stephensi insectary colony - change to - To identify the members of the species complex in our An. stephensi insectary colony Eggs were collected from individual mosquito - change to - Eggs were collected from individual mosquitoes sequences in GenBank using MEGA vx. - change to - sequences in GenBank using MEGA 7. An. stephensi sibling C - change to - An. stephensi sibling species C Main text: Despite efficient controlling strategies for malaria, An. stephensi is increasing in its geographic range (add reference) chromosome karyotypes [30,31,32,33], cytogenetic properties [30,31]. Recently, AnsteObp1 is reported as a new marker for identification of the Asian main malaria vector, An. stephensi (add reference) amino acids sequences of AnsteObp1among these members - change to - amino acids sequences of AnsteObp1 among these members Wolbachia-based, Gene drive etc. - change to - Wolbachia-based, gene drive, etc. Others demonstrated variations in the reproductive capacity within these biological forms of An. stephensi [34]. - change to - Others demonstrated variations in the reproductive capacity within An. stephensi [34]. Table 1: Size of ANSTEOBP1 is 900 bp, but it should be 845 bp. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. Submitted filename: PONE-D-21-36790.pdf Click here for additional data file. 25 Jan 2022 Dear Editor, We have addressed all the points raised by the reviewers. The corrections and modifications in the manuscript have been made accordingly. Furthermore, after publication, the sequences of our manuscript will be publicly available (with working accession numbers) at NCBI. The responses to each reviewer's individual points are listed below. Reviewer #1: Page 3: Authors claim "AnsteObp1 as a robust genetic marker for rapid and accurate discrimination (taxonomic identification) of the An. stephensi species complex". Page 11: " Finally, our investigations, based on egg morphology and sequence analysis, endorse the use (independent) of the AnsteObp1 intron I sequence as a new molecular tool for quick and reliable identification of all the three biological forms of An. stephensi." First: this claim had been proposed before on 2015, so this is not a "new" molecular tool. Reply: We have replaced the word ‘new’ with ‘suitable’. Second: In this study only An. stephensi mysorensis lab strains were used. No wild anopheles and no type and intermediate forms were used. Reply: We have replaced the ‘three biological forms of An.stepehnsi’ with ‘An. stephensi mysorensis’. Third: how would you use this marker to separate Type and Intermediate forms from Mysorensis? The answer to this question is not clearly mentioned in the manuscript. Reply: This question has already been addressed in the manuscript in the discussion, such as ‘This identification was attributed to the form specific/associated mutations (4-15%) within the intron region of AnsteObp1 between biological……… [16]’. Moreover, we have cited the relevant study by Gholizadeh et al. (2015) [16] and further details may be seen by readers. Phylogenetic trees in Fig.2-3 -4: Comparison between sequences is not clearly mentioned in the phylogenetic tree by name/region. Reply: Comparison between sequences is now clearly mentions the phylogenetic tree by name/region. Reviewer #2: The title is not appropriate for this work as it does not introduce a new marker for species discrimination. I suggest changing the title to “Identification of a biological form in the Anopheles stephensi laboratory colony using the odorant-binding protein 1 intron I sequence.” Reply: We have changed the title as suggested. The authors should clearly state the limitations of their work. First, the test was limited to a single laboratory colony. Second, the authors have not developed a rapid PCR-based test and identification of the biological form requires sequencing, which is labor- and time-consuming. Third, only a single (the last) SNP discriminate all three forms: “C” in mysorensis, “T” in intermediate, “G” in type. Other polymorphisms are shared between at least two forms. Reply: The limitations have been included now. The authors wrote that they counted for the number of ridges under stereomicroscope, however Figure 1 shows a scanning electron micrograph. Please, clarify and correct this, and also provide scale bars. Reply: We counted the number of ridges under stereomicroscope according to the previously published protocols (common methods) [3, 16] but we used scanning electron microscopy to present a clearer image. Now, we have added this sentence “In addition, a scanning electron microscopy image was taken to clearly show the egg form” in the concerned section. Moreover, the scale bar values are added (mentioned) now in the figure legend. Please, correct the following: Abstract: 1. An. stepehnsi species complex - change to - The An. stephensi species complex Reply: Corrected. 2. vector competence (malaria) and ecology - change to - vector competence to the malaria parasite and ecology. Reply: Corrected. 3. To identify the species complex of our An. stephensi insectary colony - change to - To identify the members of the species complex in our An. stephensi insectary colony. Reply: Corrected. 4. Eggs were collected from individual mosquito - change to - Eggs were collected from individual mosquitoes. Reply: Corrected. 5. sequences in GenBank using MEGA vx. - change to - sequences in GenBank using MEGA 7. Reply: Corrected. 6. An. stephensi sibling C - change to - An. stephensi sibling species C Reply: Corrected. Main text: 1. Despite efficient controlling strategies for malaria, An. stephensi is increasing in its geographic range (add reference). Reply: reference added. 2. chromosome karyotypes [30,31,32,33], cytogenetic properties [30,31]. Recently, AnsteObp1 is reported as a new marker for identification of the Asian main malaria vector, An. stephensi (add reference) Reply: Reference added. 3. amino acids sequences of AnsteObp1 among these members - change to - amino acids sequences of AnsteObp1 among these members. Reply: Corrected. 4. Wolbachia-based, Gene drive etc. - change to - Wolbachia-based, gene drive, etc. Reply: Corrected. 5. Others demonstrated variations in the reproductive capacity within these biological forms of An. stephensi [34]. - change to - Others demonstrated variations in the reproductive capacity within An. stephensi [34]. Reply: Corrected. Table 1: Size of ANSTEOBP1 is 900 bp, but it should be 845 bp. Reply: Corrected. Submitted filename: Response to Reviewers.docx Click here for additional data file. 28 Jan 2022 Identification of a biological form in the Anopheles stephensi laboratory colony using the odorant-binding protein 1 intron I sequence PONE-D-21-36790R1 Dear Dr. Khan, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Igor V. Sharakhov Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 10 Feb 2022 PONE-D-21-36790R1 Identification of a biological form in the Anopheles stephensi laboratory colony using the odorant-binding protein 1 intron I sequence Dear Dr. Khan: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr Igor V. Sharakhov Academic Editor PLOS ONE
  29 in total

1.  Intraspecific variation in the reproductive capacity of Anopheles stephensi (Diptera: Culicidae).

Authors:  M Suleman
Journal:  J Med Entomol       Date:  1990-09       Impact factor: 2.278

2.  The dominant Anopheles vectors of human malaria in the Asia-Pacific region: occurrence data, distribution maps and bionomic précis.

Authors:  Marianne E Sinka; Michael J Bangs; Sylvie Manguin; Theeraphap Chareonviriyaphap; Anand P Patil; William H Temperley; Peter W Gething; Iqbal R F Elyazar; Caroline W Kabaria; Ralph E Harbach; Simon I Hay
Journal:  Parasit Vectors       Date:  2011-05-25       Impact factor: 3.876

3.  Chromosomal inversions in Anopheles stephensi.

Authors:  M Coluzzi; M Di Deco; G Cancrini
Journal:  Parassitologia       Date:  1973 Apr-Aug

4.  The genetics of three larval mutants in Anopheles stephensi.

Authors:  S G Suguna
Journal:  Indian J Med Res       Date:  1981-01       Impact factor: 2.375

5.  Variation in cuticular hydrocarbons among strains of Anopheles (Cellia) stephensi Liston possibly related to prior insecticide exposure.

Authors:  G I Anyanwu; D H Davies; D H Molyneux; A Phillips
Journal:  Ann Trop Med Parasitol       Date:  1997-09

6.  Spiracular indices in Anopheles stephensi: a taxonomic tool to identify ecological variants.

Authors:  B N Nagpal; A Srivastava; N L Kalra; S K Subbarao
Journal:  J Med Entomol       Date:  2003-11       Impact factor: 2.278

7.  Molecular characterization, biological forms and sporozoite rate of Anopheles stephensi in southern Iran.

Authors:  Ali Reza Chavshin; Mohammad Ali Oshaghi; Hasan Vatandoost; Ahmad Ali Hanafi-Bojd; Ahmad Raeisi; Fatemeh Nikpoor
Journal:  Asian Pac J Trop Biomed       Date:  2014-01

8.  The Anopheles superpictus complex: introduction of a new malaria vector complex in Iran.

Authors:  M A Oshaghi; M R Yaghobi-Ershadi; K Shemshad; M Pedram; H Amani
Journal:  Bull Soc Pathol Exot       Date:  2008-12

9.  Speculation on the possibility for introducing Anopheles stephensi as a species complex: preliminary evidence based on odorant binding protein 1 intron I sequence.

Authors:  Samira Firooziyan; Navid Dinparast Djadid; Saber Gholizadeh
Journal:  Malar J       Date:  2018-10-16       Impact factor: 2.979

10.  Comparative susceptibility of different biological forms of Anopheles stephensi to Plasmodium berghei ANKA strain.

Authors:  Hamid R Basseri; Habib Mohamadzadeh Hajipirloo; Mulood Mohammadi Bavani; Miranda M A Whitten
Journal:  PLoS One       Date:  2013-09-23       Impact factor: 3.240

View more
  1 in total

1.  Evaluation of intron-1 of odorant-binding protein-1 of Anopheles stephensi as a marker for the identification of biological forms or putative sibling species.

Authors:  Om P Singh; Shobhna Mishra; Gunjan Sharma; Ankita Sindhania; Taranjeet Kaur; U Sreehari; Manoj K Das; Neera Kapoor; Bhavna Gupta
Journal:  PLoS One       Date:  2022-07-21       Impact factor: 3.752

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.