A DNA replication-independent function of pre-replication complex genes during cell invasion in C. elegans.

Cell invasion is an initiating event during tumor cell metastasis and an essential process during development. A screen of C. elegans orthologs of genes overexpressed in invasive human melanoma cells has identified several components of the conserved DNA pre-replication complex (pre-RC) as positive regulators of anchor cell (AC) invasion. The pre-RC genes function cell-autonomously in the G1-arrested AC to promote invasion, independently of their role in licensing DNA replication origins in proliferating cells. While the helicase activity of the pre-RC is necessary for AC invasion, the downstream acting DNA replication initiation factors are not required. The pre-RC promotes the invasive fate by regulating the expression of extracellular matrix genes and components of the PI3K signaling pathway. Increasing PI3K pathway activity partially suppressed the AC invasion defects caused by pre-RC depletion, suggesting that the PI3K pathway is one critical pre-RC target. We propose that the pre-RC, or a part of it, acts in the postmitotic AC as a transcriptional regulator that facilitates the switch to an invasive phenotype.

Introduction

Cell invasion, defined as the movement of cells across compartment boundaries formed by basement membranes (BMs), is an essential process during normal development. Yet, cell invasion can have fatal consequences during cancer progression [1]. During metastasis, individual cells of a primary tumor adopt an invasive phenotype, resulting in metastatic tumor spreading through the vasculature. Despite the different outcomes, developmental and cancerous cell invasion have many common features. Both types of invasion involve a phenotypic switch called epithelial to mesenchymal transition (EMT). Invasive cells adopt a mesenchymal-like phenotype characterized by the formation of actin-rich protrusions called invadopodia, the loss of cadherin-mediated cell adhesion and the expression of metalloproteinases (MMPs) that break down the BM. This phenotypic switch can be stimulated by extracellular signals, such as TGF-β, EGF, and Wnt, and is regulated by conserved zinc finger transcription factors of the Twist, Snail, and Krüppel family as well as by the Jun/Fos (AP-1) transcription factors that activate characteristic, proinvasive transcriptional programs [2].

Here, we have used C. elegans vulval development as an in vivo model to investigate the regulation of cell invasion. During the development of the vulva, the egg-laying organ of the hermaphrodite, the anchor cell (AC) in the ventral uterus breaches 2 BMs and invades the underlying vulval epithelium to establish direct contact between the developing uterus and vulva [3,4]. In the wild type, AC invasion occurs during a specific time period, beginning in mid-L3 larvae after the first round of vulval cell divisions (the Pn.p 2-cell stage) and ending after the second round of divisions has been completed (Pn.p 4-cell stage). The Netrin homolog UNC-6 secreted by neurons in the ventral nerve cord, together with an unknown cue released by the primary (1°) vulval precursor cells (VPCs) that are nearest to the AC, polarizes and guides the invading AC ventrally [5]. Activation of the UNC-40/DCC receptor in the AC induces the recruitment of several actin regulators and the αβ-integrin complex to the ventral AC cortex, thereby creating an invasive membrane [6]. At the same time, the expression of proinvasive genes is activated by the AP-1 transcription factor FOS-1A and egl-43, which encodes a zinc finger transcription factor homologous to the mammalian EVI1 proto-oncogene [7-9]. Known target genes of FOS-1A and EGL-43/EVI1 in the AC include MMP zmp-1, protocadherin cdh-3, and hemicentin him-4 [7].

Another important aspect of cell invasion is the dichotomy between the proliferative and invasive state of a cell. The AC must remain arrested in the G1 phase of the cell cycle in order to activate proinvasive gene expression and breach the BMs [8]. The histone deacetylase hda-1, the homolog of mammalian HDAC1, the nuclear hormone receptor nhr-67 and egl-43 are critical to establish the G1 arrest of the AC [9,10]. Likewise, the invasiveness of human cancer cells often correlates with proliferation arrest. For example, during metastatic progression, melanoma cells can undergo multiple rounds of phenotype switching between a proliferative and an invasive state [11]. However, the mechanisms by which cell cycle regulators affect cell invasion are poorly understood.

The conserved pre-replication complex (pre-RC) plays an essential role during the G1 phase of the cell cycle to license the DNA replication origins that will be used in the following S-phase [12-14]. The pre-RC assembles during the late M and early G1 phase of the cell cycle by the sequential recruitment of the origin recognition complex proteins ORC1–ORC6 to DNA replication origins, followed by the CDC6 protein together with the chromatin licensing and replication factor CDT1, and finally, the DNA helicase complex formed by the mini-chromosome maintenance proteins MCM2 to MCM7 [12,15]. After the pre-RC has been assembled in the G1 phase, the origins are licensed to initiate DNA replication during the following S-phase. Thereafter, CDK/Cyclin activity in the late G1 and early S-phase induces the disassembly and partial degradation of the pre-RC to prevent the relicensing of replication origins.

Using C. elegans AC invasion as a model to screen for genes controlling cell invasion, we have found that multiple components of the pre-RC are required for BM breaching by the AC. In addition, we have identified the PI3K pathway as one critical downstream target of the pre-RC promoting BM breaching by the AC. Together, these data point to a replication-independent function of the pre-RC in regulating cell invasion during the G1 phase of the cell cycle.

Results

Identification of cell invasion regulators among differentially expressed genes in invasive melanoma cells

In order to identify genes that are functionally involved in regulating cell invasion, we investigated candidate genes whose orthologs were up-regulated in human melanoma cells that had been stimulated with TGF-β, exposed to hypoxia, or which overexpressed the transcription factor SOX9, and included genes up-regulated in migrating neural crest cells that had undergone EMT [16-18]. This resulted in a list of 104 differentially expressed human genes that were up-regulated under at least 2 conditions and for which a C. elegans ortholog could be identified ().

RNAi-mediated knock-down of 32 of the 104 C. elegans orthologs resulted in a protruding vulva (Pvl) phenotype, which is characteristic of defects in vulval morphogenesis or in AC invasion. In order to specifically identify regulators of AC invasion, we scored BM breaching by the AC after RNAi-mediated knock-down. AC invasion was analyzed in L3 larvae after the 1° VPCs had divided twice, at the VPC 4-cell (Pn.pxx) stage of vulval development. If viability and fertility permitted, we scored the F1 progeny of RNAi-treated mothers, or else we scored the P0 animals that had been exposed to the dsRNA-producing bacteria from the L1 stage on. To visualize BM breaching by the invading AC, we used a LAM-1::GFP reporter that labels the 2 BMs separating the AC from the underlying vulval cells () [5]. Among the 104 candidates tested, RNAi knock-down of 18 genes perturbed AC invasion (). Notably, 3 genes required for normal AC invasion encode cell cycle regulators; cdc-6 encodes an essential component of the DNA pre-RC [12,15], cyd-1 encodes the only Cyclin D homolog in C. elegans [19], and cdk-12 encodes the Cyclin-dependent kinase required for activation of RNA polymerase II [20]. In particular, Cyclin D was shown to be a driver for invasion in a study investigating the development of thin melanoma [21]. After RNAi knock-down of cdc-6, the AC failed to invade in 32% of the cases ().

Several pre-RC components are required for AC invasion.

(A) DIC images (left panels), corresponding green fluorescence image of the LAM-1::GFP reporter (middle panels), and merged images including the AC marker mCherry::moeABD (qyIs50) in magenta (right panels). The arrowheads in the DIC and merged panels point at the AC nucleus, and the arrows indicate the sites of BM breaching. In control animals fed with the empty RNAi vector (top panels), the BM was breached at the Pn.pxx stage. RNAi knock-down of cdc-6, cdt-1, mcm-7, orc-2, and orc-5 prevented BM breaching (see Table 1 for the numbers of animals scored). A lf mutation in the pre-IC component psf-1 did not prevent BM breaching despite the VPC proliferation arrest (bottom panels; see S2 Table for the number of animals scored). (B) AC invasion and VPC proliferation defects occur independently. The 4 different combinations of phenotypes observed after empty vector control and mcm-7 RNAi are shown; (from top to bottom) normal BM breaching and VPC proliferation, no BM breaching but VPC proliferation, BM breaching but VPC proliferation arrest, no BM breaching and VPC proliferation arrest. (C) Correlation between the AC invasion and VPC proliferation defects after mcm-7 RNAi. The frequencies of the 4 combinations of phenotypes among 110 animals scored are shown inside the boxes. (D) Expression of CKI-1 in P6.p using the zhEx334[egl-17>cki-1] transgene blocked the division of P6.p as reported [24] (left panels) but did not prevent BM breaching (middle panels). BM breaching was visualized with the LAM-1::mCherry marker (qyIs127) and the 1° VPCs were labeled with the ayIs4[egl-17>gfp] reporter. An L3 larva at the Pn.pxx stage and an L4 larva during vulval morphogenesis are shown. The asterisks in the bottom panel of (A) and in (B) and (D) label the nuclei of the undivided P6.p(x) cells. The right panels show the merged DIC and LAM-1::mCherry images including the egl-17>GFP signal in green. The scale bars are 5 μm. AC, anchor cell; BM, basement membrane; DIC, differential interference contrast; pre-IC, pre-initiation complex; pre-RC, pre-replication complex; VPC, vulval precursor cell.

Table 1

Knock-down of several pre-RC components prevents BM breaching.

The genes encoding different pre-RC components were analyzed by RNAi for their potential to breach the BM at the P6.p.xx stage as described in . The observed BM breaching defects are indicated in absolute numbers. Pvl indicates a protruding vulva and Ste a sterile phenotype at the adult stage.

Sequence name	Gene name	Phenotype	Invasion defects/animals scored
Origin of replication components
Y39A1A.12	orc-1	Pvl, Ste	0/20
F59E10.1	orc-2	Pvl, Ste	26/51
Y119D3B.11	orc-3	-	1/20
Y39A1A.13	orc-4	-	1/20
ZC168.3	orc-5	Pvl, Ste	6/29
Mini chromosome maintenance complex components
Y17G7B.5	mcm-2	Ste	0/20
C25D7.6	mcm-3	Ste	0/20
Y39G10AR.14	mcm-4	Pvl, Ste	0/20
R10E4.4	mcm-5	Ste	0/20
ZK632.1	mcm-6	Ste	0/20
F32D1.10	mcm-7	Pvl, Ste	43/126
Replication-licensing factors
Y54E10A.15	cdt-1	Pvl, Ste	10/65
C43E11.10	cdc-6	Pvl, Ste	13/56

BM, basement membrane; pre-RC, pre-replication complex.

In the following, we focused our experiments on studying the role of the pre-RC genes during cell invasion.

Several components of the pre-replication complex regulate AC invasion

Since the AC remains arrested in the G1 phase of the cell cycle while it breaches the BMs [8], the identification of the pre-RC component CDC-6 as a regulator of AC invasion was unexpected. We therefore tested if other pre-RC components are also required for BM breaching by the AC. Besides cdc-6, RNAi-mediated knock-down of several orc genes, as well as of cdt-1 and mcm-7 led to BM breaching defects ( and ). The penetrance of the invasion defects ranged from 15% for cdt-1 to 51% upon orc-2 RNAi (not taking into account the single cases observed after orc-3 and orc-4 RNAi). Among the mcm genes, only mcm-7 RNAi resulted in an invasion defect in 34% of the animals ( and . However, the absence of AC invasion defects for other mcm genes tested could be due to low efficiencies of the RNAi knock-down.

Thus, several components of the pre-RC promote BM breaching by the AC. In addition to the AC invasion defects, RNAi of pre-RC complex components induced a proliferation arrest in different cells of the larvae, notably in the dividing VPCs adjacent to the AC ().

The DNA replication pre-initiation complex is not required for AC invasion

At the onset of the S-phase, the pre-RC transitions into the pre-initiation complex (pre-IC) through the recruitment of accessory proteins of the GINS complex (PSF-1, PSF-2, PSF-3, SLD-5) and additional factors, such as CDC-45, MCM-10, CDC-7, and PCN-1, which are necessary to initiate DNA replication [12,15,22]. In order to test if the initiation of DNA replication is required for AC invasion, we examined the AC invasion phenotype of a psf-1 null (lf) allele and performed RNAi against different pre-IC components. Except for a single case in cdc-45 RNAi-treated animals, we did not observe any invasion defects after RNAi knock-down or in mutants of pre-IC genes ( bottom row and ). In some animals, the gap the AC created in the BMs of psf-1(lf) mutants was not expanded as the underlying VPCs had ceased to proliferate ( bottom row), though the average size of the BM gap was not significantly changed in psf-1(lf) mutants (6.8 ± 1.8 μm in the wild type versus 7.7 ± 4.5 μm in psf-1(lf)) [23].

We conclude that components of the pre-IC are not necessary for AC invasion.

VPC proliferation is not required for AC invasion

Invasion by the postmitotic AC is linked to the differentiation and proliferation of the underlying 1° VPCs that produce guidance signals, which attract the AC ventrally [7]. It has previously been shown that arresting VPCs in S-phase by hydroxyurea (HU) treatment does not prevent AC invasion [7]. However, in that experiment, the timing of invasion could not be assessed relative to individual VPC fates, since HU treatment arrested the division of all VPCs. We therefore tested whether the AC invasion defects observed after down-regulation of pre-RC components might be caused by a proliferation arrest of the VPCs, and if preventing the 1° VPCs from entering into S-phase could inhibit AC invasion. We first examined on an animal per animal basis whether the AC invasion defects caused by mcm-7 RNAi correlated with the proliferation arrest of the VPCs. An analysis of 110 animals revealed no correlation, as mcm-7i invasion defects occurred independently of whether the VPCs had divided or not (). Next, we blocked the cell cycle of the 1° VPC (P6.p) in the G1 phase by overexpressing the CDK inhibitor cki-1 under control of the 1° lineage-specific egl-17 promoter (zhEx334[egl-17>cki-1::gfp; myo-2::mCherry] [24] and used a LAM-1::mCherry reporter to score BM breaching. In all egl-17>cki-1::gfp; lam-1>lam-1::mCherry animals with an undivided P6.p cell at the P5/7.p 4-cell (n = 16) or 8-cell stage (n = 16) the BMs were breached, indicating that AC invasion does not depend on S-phase entry of the 1° VPC ().

We conclude that entry of the 1° VPCs into S-phase is not required for AC invasion and, therefore, the AC invasion defects caused by mcm-7 RNAi are not due to a VPC cell-cycle arrest.

mcm-7 is expressed in the AC prior to invasion

In order to determine the expression pattern of the pre-RC components during AC invasion, we focused on mcm-7, because it encodes a core subunit of the MCM complex that is the last component recruited to the pre-RC. We used CRISPR/Cas9 engineering to insert a gfp tag upstream of the translational start codon in the mcm-7 locus along with 2 flippase (FLP) recognition target (FRT) sites within the gfp cassette. This permitted the tissue-specific inactivation of mcm-7 by FLP-induced recombination (zh118[frt::gfp::mcm-7], ) [25,26]. zh118[frt::gfp::mcm-7] animals exhibited GFP::MCM-7 expression in the nuclei of proliferating cells, including many uterine cells and the VPCs (). In mid-L2 larvae, GFP::MCM-7 was expressed at comparably lower levels in the newly specified AC. During the late L2 and early L3 stage, GFP::MCM-7 expression in the AC further declined but was still detectable in mid-L3 larvae just prior to invasion. In late L3 larvae, after the BM had been breached, no GFP::MCM-7 expression was detectable in the AC (). Besides MCM-7, also CDT-1::GFP expression was consistently observed in the AC nucleus prior to and during invasion (). In contrast to GFP::MCM-7, CTD-1::GFP continued to be expressed in the AC after BM breaching in late L3 larvae (Pn.pxx stage). The adjacent uterine cells showed predominantly cytoplasmic CDT-1::GFP expression.

Since GFP::MCM-7 expression levels were highest in the newly formed AC, we tested whether mcm-7 is required for the specification or function of the AC during vulval induction. We first examined the expression of the b-HLH transcription factor HLH-2, whose expression onset in early L2 larvae instructs the AC fate [27]. mcm-7 RNAi had no significant effect on HLH-2::GFP expression levels in the AC of mid-L3 larvae (). The differentiated AC then expresses the proto-cadherin cdh-3 [28] and the EGF homolog lin-3, which induces the differentiation of the adjacent VPCs [4,29]. A transcriptional cdh-3>gfp reporter was not changed after mcm-7 RNAi, while lin-3>gfp expression was reduced (). However, the lin-3 levels in the AC after mcm-7 RNAi were sufficient to induce vulval differentiation, as the 1° vulval cell fate marker egl-17>gfp [30] was expressed in the 1° VPCs of all mcm-7 RNAi animals (). Thus, MCM-7 is not necessary for the specification of the AC fate or for the normal function of the AC during the induction of vulval differentiation.

mcm-7 acts in the AC to promote BM breaching

The observation that a proliferation arrest of the VPCs did not impair BM breaching raised the possibility that mcm-7 acts cell-autonomously in the AC to promote invasion, besides its established role in replication origin licensing in proliferating cells. To test whether the low GFP::MCM-7 expression levels observed in the AC of L3 larvae promote invasion, we first performed Pn.p cell and AC-specific RNAi of mcm-7 [31-33]. Notably, 16% of the animals treated with AC-specific mcm-7 RNAi showed a BM breaching defect, whereas none of the control RNAi-treated or Pn.p cell-specific mcm-7 RNAi animals exhibited BM breaching defects (). This analysis suggested a cell-autonomous role of mcm-7 in the postmitotic AC. To independently confirm these findings, we performed FLP/FRT-induced mosaic analysis in the zh118[frt::gfp::mcm-7] strain [26]. The FLPase was expressed under control of the heat shock–inducible hs-16-48 promoter (hs>flp) and induced by a single heat shock. Two cells with the potential to become the AC (Z1.ppp and Z4.aaa) are born during the third round of gonadal cell division in the mid to late L1 stage [27]. During the L2 stage, one of these 2 precursor cells adopts the AC fate, while the other cell becomes the ventral uterine (VU) precursor cell. To test if MCM-7 functions in the AC or in its mother cell (Z1.pp or Z4.aa), freshly hatched L1 worms were grown until the late L1/early L2 stage before heat shock induction of the FLPase (see Materials and methods). This protocol resulted in the development of mosaic animals that had lost GFP::MCM-7 expression either in most uterine cells, in the VPCs, or in both lineages (). Among the VPC mosaics, we focused on animals showing loss of GFP::MCM-7 expression in the 1° lineage because the 1° VPCs are necessary to induce AC invasion [7]. Around 29% of animals with a loss of GFP::MCM-7 expression in most uterine cells and 38% of animals lacking expression in both the uterus and the 1° VPCs showed a BM breaching defect ( and white bars in ). Except for the AC, other uterine cells are not required for BM breaching [34]. By contrast, only 3.1% of the 1° VPC mosaics and 2.7% of the cases without an apparent loss of GFP::MCM-7 expression in any of the 2 tissues exhibited a BM breaching defect.

Taken together, the tissue-specific RNAi experiments and the mosaic analysis indicated that mcm-7 acts cell-autonomously in the postmitotic AC to positively regulate BM breaching. Though, the mosaic analysis could not distinguish if mcm-7 functions while the AC is adopting its fate or afterwards. It should also be noted that the highest penetrance of BM breaching defect after FLP/FRT-mediated inactivation of mcm-7 was 38%, suggesting that pre-RC activity may not be absolutely required for AC invasion.

The DNA helicase activity of the pre-RC is required for AC invasion

The MCM protein complex provides the helicase activity of the pre-RC that is necessary for DNA unwinding during the formation of a replication fork. To test if the MCM helicase activity is necessary for AC invasion, we introduced 4 point mutations (K396S397→AA and D454E455→AA) in the strongly conserved ATPase motif of MCM-7 (). These mutations have previously been shown to eliminate the helicase activity of the human MCM-4/6/7 complex [35]. By expressing the wild-type or mutant MCM-7 proteins tagged with CFP under control of the AC-specific lin-3 enhancer element (ACEL) [36] and the pes-10 minimal promoter (zhIs119[ACEL>mcm-7(wt)::cfp] and zhIs142[ACEL>mcm-7(mut)::cfp]) and simultaneously eliminating endogenous MCM-7 activity using the zh118[frt::gfp::mcm-7] allele to create hs>flp-induced mosaics, we could selectively assay MCM-7 function in the AC. MCM-7::CFP expression was first observed in late L1/early L2 larvae in the differentiating AC, and expression became more robust during the mid to late L2 stage after the AC had adopted its fate (). Remarkably, both wild-type and mutant rescue transgenes that were integrated as single copies at the same chromosomal site by MosSci [37] showed relatively faint MCM-7::CFP expression despite the use of the strong lin-3 ACEL enhancer element (). Therefore, MCM-7 expression appears to be down-regulated in the AC at the posttranscriptional level. Nevertheless, the wild-type ACEL>mcm-7(wt)::cfp transgene partially rescued the AC invasion defect of mcm-7 mosaic animals (, black bars). Since no ACEL>MCM-7::CFP expression was observed before the birth of the AC during the L1 stage, these data further support the conclusion of the mosaic analysis and tissue-specific RNAi experiments, which indicated that MCM-7 acts cell autonomously in the postmitotic AC. By contrast, the helicase-deficient transgene ACEL>mcm-7(mut)::cfp failed to restore the BM breaching activity to the AC (, gray bars).

Therefore, the MCM helicase activity is not only required for the initiation of DNA replication, but also for BM breaching by the AC. Alternatively, the ATP-binding motif in MCM-7 may perform another MCM helicase-independent function during AC invasion.

mcm-7 controls BM breaching in the G1-arrested AC

It was previously reported that the AC must remain arrested in the G1 phase of the cell cycle in order to adopt the invasive cell fate [8]. We therefore examined whether the pre-RC controls the cell cycle state of the AC by examining the expression of cell cycle reporters. A transcriptional reporter for the G1 phase marker cyd-1 cyclinD (zhIs131[cyd-1>gfp]) was expressed in the AC of mcm-7 RNAi-treated animals at similar levels as in control animals (). Conversely, the expression of the S phase marker rnr-1::gfp was undetectable in the AC of control and of mcm-7 RNAi-treated animals () [38]. Consistent with these findings, the histone deacetylase hda-1 that is induced in the AC upon G1 arrest and is required for the invasive fate remained expressed after mcm-7 knock-down () [8].

mcm-7 controls invasion in the G1-arrested AC.

(A) Expression of the G1-phase marker cyd-1>gfp in an empty vector–treated control (top row, n 19) and after mcm-7 RNAi (bottom row, n = 25). (B) Expression of the S-phase marker RNR-1::GFP in an empty vector–treated control (top row, n = 30) and after mcm-7 RNAi (bottom row, n = 22). (C) AC-specific expression of the CDK activity sensor in an empty vector–treated control (top row), after mcm-7 RNAi (middle row) and after nhr-67 RNAi (bottom row). (D) Quantification of the CDK sensor activity as the cytoplasmic to nuclear GFP intensity ratios, as described in Materials and methods. The numbers of animals scored are indicated in brackets, and the horizontal lines indicate the median values. Statistical significance was determined with a two-tailed t test for independent samples and is indicated as *** for p < 0.001. See S1 Data for the numerical values used to generate the graph. (E) Strong GFP::MCM-7 in the 3 noninvasive ACs formed after nhr-67 RNAi (bottom row) compared to the weak expression in the single AC of an empty vector–treated control animal (top row). The DIC images are shown in the left panels, the reporter expression in the middle panels, and in (C) and (E) the merged images together with the AC markers ACEL>mCherry (zhIs127) and cdh-3>mCherry::PLCδPH (qyIs23), respectively, in magenta are shown in the right panels. The arrowheads point at the AC nuclei. The scale bars are 5 μm. AC, anchor cell; DIC, differential interference contrast.

In addition to the analysis of cell cycle markers, we made use of a CDK activity sensor to directly quantify CDK activity in the AC [39]. This sensor consists of a portion of the DNA Helicase B containing 4 CDK phosphorylation sites, a nuclear export, and a nuclear import signal, N-terminally fused to an eGFP tag. Upon phosphorylation by CDKs, the sensor translocates from the nucleus to the cytoplasm. Thus, a low cytoplasmic to nuclear ratio of the eGFP signal indicates weak CDK activity. For our purpose, we expressed the CDK sensor specifically in the AC under control of the lin-3 ACEL enhancer/pes-10 minimal promoter fragment (zhIs130[ACEL>cdk sensor::egfp]). In control animals, the average cytoplasmic to nuclear fluorescence ratio in the AC was 0.51 ± 0.12 (). mcm-7 RNAi did not cause a change in sensor activity (average fluorescence ratio 0.54 ± 0.12), indicating that the pre-RC is not required for the G1 arrest of the AC. By contrast, RNAi-mediated knock-down of the nuclear hormone receptor nhr-67, which is required for the G1 phase arrest of the AC [8], resulted in a significant increase in CDK activity (average ratio 0.84 ± 0.14) (). Moreover, reducing nhr-67 levels resulted in the formation of multiple ACs that failed to invade, as reported previously [8], and expressed high levels of GFP::MCM-7 characteristic of proliferating cells ().

Hence, the down-regulation of mcm-7 did not affect the G1 arrest of the AC. Low expression levels of MCM-7 are associated with G1 arrest and AC invasion, whereas high MCM-7 expression levels accompany the loss of the invasive phenotype in proliferating ACs.

mcm-7 regulates invadopodia formation and extracellular matrix gene expression in the AC

Prior to BM breaching, the AC is polarized ventrally and extends actin-rich protrusions (invadopodia) toward the 1° VPCs, which are aligned at the ventral midline [5]. To assess whether the pre-RC controls invadopodia formation, we quantified the polarity of an F-actin reporter after RNAi knock-down of mcm-7. The probe consisted of the F-actin-binding domain of moesin fused to mCherry and was expressed under control of the AC-specific mk62-63 enhancer element of cdh-3 (mCherry::moeABD) [6]. In control animals, the mCherry::moeABD signal was polarized toward the ventral side and enriched at the tip of the invasive protrusion, where the AC breaches the BM (). Upon mcm-7 RNAi treatment, the F-actin reporter was depolarized and no properly organized invasive membrane domain was formed by the AC ().

The pre-RC regulates invadopodia formation and extracellular matrix gene expression in the AC.

(A) F-actin localization in the AC visualized with the mCherry::moeABD reporter (qyIs50) in empty vector–treated controls (top row) and after mcm-7 RNAi (bottom row). The middle panels show single frames of 3D heat-maps obtained by reconstruction of the mCherry::moeABD signal as shown in S1 Movie. (B) Quantification of mCherry::moeABD polarity. Intensity plots along the dorso-ventral axis of the AC were generated as described in Materials and methods and in [74]. The numbers of animals analyzed are indicated in brackets. (C) him-4>ΔSP::GFP expression in the AC in control RNAi (top row) and in mcm-7 RNAi-treated animals (bottom row). (D) Quantification of him-4>ΔSP::GFP expression levels in the AC. (E) zmp-1>CFP expression in the AC in control RNAi (top row) and in mcm-7 RNAi-treated animals (bottom row). (F) Quantification of zmp-1>CFP expression levels in the AC. (G) zmp-1>CFP expression in control RNAi (top row) and in cdc-6 RNAi-treated animals (bottom row). (H) Quantification of zmp-1>CFP expression levels in the AC. (I) fos-1a>FOS-1a::YFP expression in control RNAi (top row) and in mcm-7 RNAi-treated animals (bottom row). (J) Quantification of fos-1a>FOS-1a::YFP expression levels in the AC. (K) egl-43L>GFP expression in control RNAi (top row) and mcm-7 RNAi-treated animals (bottom row). (L) Quantification of egl-43L>GFP expression levels in the AC. For each reporter analyzed, the left panels show the fluorescence signal and the right panels the merged DIC/fluorescence images. The arrowheads point at the AC nuclei. The numbers in brackets in the graphs refer to the numbers of animals analyzed, and the horizontal lines indicate the median values. Statistical significance was determined with a Mann–Whitney test and is indicated as n.s. for p > 0.05, * for p < 0.05, ** for p < 0.01, and *** for p < 0.001. See S1 Data for the numerical values used to generate the graphs in (B), (D), (F), (H), (J), and (L). The scale bars are 5 μm. AC, anchor cell; DIC, differential interference contrast; n.s., not significant; pre-RC, pre-replication complex.

The invasive AC phenotype is characterized by the expression of several proinvasive genes, such as the matrix MMP zmp-1 and the hemicentin him-4, which is secreted by the AC to remodel the BM [7]. RNAi knock-down of mcm-7 decreased expression of the him-4>ΔSP::gfp and zmp-1>cfp reporters in the AC (). The reduction in proinvasive gene expression was not limited to the pre-RC component mcm-7 but was also observed after RNAi knock-down of cdc-6 (). Since zmp-1 and him-4 expression are regulated by the AP-1 transcription factor fos-1 and the zinc finger transcription factor egl-43 [28,40], we analyzed the expression patterns of these 2 transcription factors. Neither fos-1 nor egl-43 expression was changed after mcm-7 RNAi (). These data suggested that the pre-RC acts downstream of or in parallel with fos-1 and egl-43 to activate zmp-1 and him-4 expression in the AC. In order to test whether mcm-7 might be regulated by fos-1, we examined GFP::MCM-7 expression after fos-1 RNAi. Even though fos-1 RNAi led to a penetrant invasion defect, GFP::MCM-7 expression was not affected by fos-1 RNAi, indicating that MCM-7 expression in the AC is independent of FOS-1 ().

In summary, the analysis of AC-specific gene expression indicated that the pre-RC positively regulates the expression of specific extracellular matrix genes that facilitate AC invasion.

Expression profiling of human cancer cells identifies several PI3K pathway genes as candidate pre-RC targets

To systematically identify the changes in gene expression caused by inhibiting the pre-RC, we turned to human cancer cell lines. Since the pre-RC genes were originally selected based on their differential expression in human melanoma cells, we examined the changes in gene expression caused by MCM7 depletion in the A375 melanoma cell line, and to extend our study to another cancer type, included the A549 lung cancer cell line in the expression analysis. Moreover, to exclude possible effects caused by changes in cell cycle progression and focus on the replication-independent functions of MCM7, we analyzed gene expression in cells arrested at the G1/S boundary. For this purpose, we generated A375 and A549 cells stably expressing an MCM7 shRNA or a scrambled shRNA as negative control, each under control of the doxycycline (Dox)-inducible enhancer/promoter. Addition of 1 μg/ml Dox to induce shMCM7 expression resulted in a 90% to 80% reduction in MCM7 protein levels in A375 and A549 cells, respectively (). Cell cycle analysis revealed that MCM7 depletion caused a slight enrichment of cells in the G1 phase (). Using a double thymidine (Thy) synchronization protocol to arrest cells at the G1/S boundary [41], we obtained cell populations, in which over 95% of the cells were arrested in the G1 phase of the cell cycle (). From these synchronized cell populations, mRNA was extracted to obtain global expression profiles by RNAseq for both cell lines.

RNAseq analysis revealed widespread changes in the mRNA expression profile of MCM7-depleted and G1/S phase-arrested cells ( and ). Clustering of the MCM7-regulated genes revealed an enrichment of genes encoding extracellular matrix components and cell junction and plasma membrane proteins among the up-regulated genes (). To identify a core set of MCM7 target genes, we determined the overlap between the significantly up- and down-regulated genes in A375 and A549 cells (≥1.5-fold change with p < 0.01 and FDR <0.05). This analysis identified 259 genes up-regulated and 327 genes down-regulated after MCM7 depletion in both cell lines (). GO enrichment analysis of the molecular functions and biological processes of these core MCM7 target genes indicated that many of the up-regulated genes encode extracellular matrix, integrin, actin, and ß-catenin interacting proteins, while many of the down-regulated genes encode enzymes required for mitochondrial respiration and ribosomal RNA-binding proteins ().

In particular, we observed several components of the 1-phosphatidylinositol-3-kinase (PI3K) signaling pathway among the most strongly down-regulated genes ( and ). Expression of the regulatory PIK3R2 (p85β) and PIK3R3 (p55γ) subunits as well as the AKT3 kinase that acts downstream of PI3K was reduced upon MCM7 knock-down in G1/S-arrested A375 and A459 cells, and the PIK3CD (p110δ) catalytic PI3K subunit was also significantly reduced in A549, but not in A375 cells (). To examine whether the decreased expression of PI3K pathway components manifests in a diminished activity of the PI3K pathway, we quantified the levels of phosphorylated, activated AKT kinase using a phospho-specific AKT antibody for western blot analysis. Insulin or EGF stimulation of serum-starved A375 and A549 cells that had previously been depleted of MCM7 resulted in an attenuated activation of the PI3K pathway ( and ; note that A375 cells did not respond to EGF stimulation).

The pre-RC positively regulates the PI3K pathway to promote invasion.

(A) Reduced expression of PI3K pathway genes and MCM7 after MCM7 knock-down in G1/S-arrested A375 cells (left) and A549 cells (right). For each gene, the fold change in expression between Dox-treated and untreated shMCM7 cells (red bars) and Dox-treated and untreated shScramble cells (blue bars) is shown (average of 3 biological replicates; see S2 Data). (B) Phospho-AKT protein levels in serum-starved and G1/S-arrested A375 (left) and A549 cells (right) stimulated with EGF or insulin. For each condition, pAKT levels in shMCM7 and shScramble cells grown in the presence and absence of Dox were quantified on western blots. The pAKT levels were normalized to the highest value in each experiment, and the averaged values of 3 independent biological replicates are shown (see S7C and S7D Fig). (C) Endogenous AAP-1::GFP and (E) GFP::AGE-1 expression in control (top rows) and mcm-7 RNAi-treated C. elegans larvae (bottom rows) at the Pn.pxx stage. The arrowheads point to the AC labeled with the mCherry::moeABD reporter (qyIs50). For each reporter, the left panels show the GFP signal in green and the right panels the merged GFP (green) and mCherry (magenta) signals. (D) Quantification of AAP-1::GFP and (F) GFP::AGE-1 levels in the AC. (G) Fraction of animals exhibiting polarized AAP-1::GFP and GFP::AGE-1 localization. (H) BM breaching defects after control, mcm-7 or egl-43 RNAi in the indicated genetic backgrounds. The numbers in brackets in each graph refer to the numbers of animals analyzed, the horizontal lines in (D) and (F) indicate the median values and error bars the standard deviation. Statistical significance was determined by two-way ANOVA followed by two-tailed t tests for independent samples and is indicated as n.s. for p > 0.5, * for p < 0.05, ** for p < 0.01, *** for p < 0.001 and as **** for p < 0.0001. In (D), the result of an F-test for variance is indicated by #### for p < 0.0001. See S1 Data for the numerical values used to generate the graphs in (A), (B), (D), and (F-H). The scale bars are 5 μm. AC, anchor cell; BM, basement membrane; Dox, doxycycline; n.s., not significant; pre-RC, pre-replication complex.

Moreover, we found in both cell lines significantly increased expression of TIMP2, which encodes an inhibitor of different MMPs, suggesting an involvement of MCM7 in the enzymatic BM remodeling (). Mammalian cells express various MMPs, and C. elegans zmp-1 is orthologous to several of them [7]. mRNA levels of several MMPs were significantly changed after MCM7 knock-down, but there was no overlap between the 2 cell lines. MMP9 and MMP24 expression was down-regulated and MMP3 was up-regulated in A375 cells, while MMP10 expression was up-regulated only in A549 cells ().

In summary, expression profiling of 2 human cancer cell lines identified several components of the PI3K/AKT pathway and the MMP inhibitor TIMP2 as candidate MCM7 targets. Since the analysis was performed with cells arrested at the G1/S boundary, the regulation of the PI3K pathway by the pre-RC appears to occur independently of cell cycle progression.

PI3K signaling in C. elegans promotes BM breaching by the AC

To examine the significance of the regulatory effect of MCM-7 on PI3K signaling, we returned to the C. elegans AC invasion model. In contrast to mammalians, the C. elegans genome encodes single catalytic (age-1) and regulatory (aap-1) PI3K subunits, respectively [42]. To observe age-1 and aap-1 expression, we created endogenous reporters by inserting gfp tags at the N-terminus of age-1 and the C-terminus of aap-1 using CRISPR/Cas9 genome engineering (zh161[gfp::age-1] and zh178[aap-1::gfp]). In untreated or empty vector–treated control RNAi animals, GFP::AGE-1 and AAP-1::GFP were both expressed in the AC and the surrounding cells at the Pn.pxx stage before and during invasion (). Interestingly, the GFP::AGE-1 and AAP-1::GFP proteins were asymmetrically localized in the AC and appeared polarized toward the invasive membrane. The levels of the catalytic PI3K subunit AGE-1 decreased in the AC upon mcm-7 RNAi (). By contrast, we did not detect a significant change in the mean expression levels of the regulatory subunit AAP-1, but expression was more variable after mcm-7 RNAi ( p < 0.0001 in an F-test for variance). Moreover, the asymmetric distribution of AAP-1::GFP and GFP::AGE-1 in the AC was lost in most mcm-7 RNAi-treated animals (). By contrast, expression and localization of both PI3K subunits remained unchanged after fos-1 RNAi ().

Next, we tested whether overactivation of the PI3K pathway could rescue the invasion defects caused by down-regulation of mcm-7. For this purpose, we performed mcm-7 RNAi in animals carrying a gain-of-function mutation in the AKT homolog akt-1 [43] or a deletion allele of daf-18, which encodes the homolog of the PTEN tumor suppressor that antagonizes PI3K activity [42], and scored BM breaching using the LAM-1::GFP marker. The akt-1(mg144gf) and daf-18(ok480lf) mutations partially suppressed the invasion defects caused by mcm-7 RNAi, while the egl-43 RNAi invasion defects were not affected by akt-1(gf) or daf-18(lf) ().

Lastly, we examined whether PI3K signaling is necessary for AC invasion by observing BM breaching in age-1(mg44) null mutants. The first generation (F1) of homozygous age-1(mg44) animals segregated by heterozygous parents developed into healthy and fertile adults, presumably due to maternal rescue of larval AGE-1 function [44]. However, their offspring (F2) exhibited a severe developmental delay and formed sterile adults with a Pvl phenotype. In 23% (n = 61) of the F2 generation age-1(mg44) mutants carrying the lam-1::gfp marker, no BM breaching or only a very small BM gap was observed at the L4 (Pn.pxxx) stage (), suggesting that PI3K signaling is partially required for AC invasion.

Taken together, these data suggest that the positive regulation of the PI3K pathway by the pre-RC contributes to the invasive phenotype of the AC. Since hyperactivation of PI3K signaling only partially suppressed the mcm-7 invasion defects, the PI3K pathway is likely only one of several critical processes regulated by the pre-RC in the AC.

Discussion

Using C. elegans AC invasion as an in vivo model for a targeted RNAi screen, we have made the unexpected observation that multiple components of the pre-RC positively regulate cell invasion in nonproliferating cells. To further characterize the function of the pre-RC during cell invasion, we focused on the mcm-7 gene, because it encodes an essential subunit of the hexameric MCM complex that is the last component loaded onto the replication origins during their licensing [12,14]. After the MCM complex has been assembled, its helicase activity is activated to initiate the formation of a replication fork by unwinding the dsDNA at the replication origins. However, our analysis of mcm-7 in the C. elegans AC and in human cancer cells has revealed an activity of the pre-RC that is distinct from its well-characterized role during DNA replication origin licensing. First, mcm-7 acts cell autonomously in the postmitotic AC, which remains arrested in the G1 phase of the cell cycle. The proliferation arrest of the AC is a prerequisite for BM breaching and invasion [8]. Even though components of the pre-RC form a replication checkpoint in dividing cells [45], loss of mcm-7 did not interfere with the G1 arrest of the AC, suggesting that the mcm-7 invasion defects are not caused by a change in the cell cycle state of the AC. Second, the invasion defects caused by down-regulation of mcm-7 did not correlate with and were independent of the proliferation arrest caused by loss of the pre-RC in other cells. Especially, blocking the cell cycle in the adjacent 1° VPCs that are necessary to induce AC invasion did not cause an invasion defect. Third, the DNA replication initiation complex (pre-IC) that acts downstream of the pre-RC to form a DNA replication fork is not required for AC invasion. However, an mcm-7 rescue transgene with mutations that eliminate the ATPase activity of the MCM helicase failed to rescue the AC invasion defect, suggesting that the DNA unwinding activity of the MCM complex is needed for the transcriptional regulation of its proinvasive target genes. However, it is also possible that the MCM7 ATPase activity is needed for another unknown function of MCM7 besides its essential role in the pre-RC. Forth, inhibition of mcm-7 resulted in specific changes in the expression of extracellular matrix genes and a disorganized actin cytoskeleton at the invasive AC membrane. Yet, the inhibition of mcm-7 function did not cause a global change in the transcription profile of the AC, as the expression of AC fate markers and the transcription factors FOS-1 and EGL-43, which are both essential regulators of AC invasion, remained unchanged [8,28,40]. Taken together, these observations strongly support a DNA replication-independent function of the pre-RC during AC invasion ().

Replication-independent function of the pre-RC during AC invasion.

Center: In the wild type, the AC arrests in the G1 phase of the cell cycle and expresses low levels of the MCM proteins. Under these conditions, the pre-RC controls ECM gene expression and activates the PI3K pathway, allowing the AC to polarize the actin cytoskeleton (red lines), breach the BMs (green lines), and invade. Right: If the AC is induced to proliferate, e.g., by inhibiting nhr-67, MCM proteins are expressed at high levels and can license the DNA replication origins. In this case, the AC does not invade but enters S-phase and divides. Left: If the pre-RC is absent, the AC remains in the G1 phase but cannot invade because ECM gene expression is deregulated and PI3K pathway activity is reduced.

Expression profiling of 2 human cancer cell lines arrested at the G1/S-phase boundary identified several PI3K pathway components as candidate pre-RC targets. Many PI3K pathway genes are involved in the malignant progression of various cancer types [46]. Especially, increased expression of the regulatory subunit PIK3R2 has consistently been associated with an advanced tumor stage and enhanced metastasis formation [47]. Moreover, a link between MCM7 and the PI3K pathway has previously been reported for human melanoma [48] and esophagal squamous carcinoma [49], and an inhibitory role of the MCM7 locus on the PI3K antagonist PTEN was observed in a transgenic mouse model [50]. Likewise, depletion of mcm-7 in C. elegans also lead to reduced expression of the catalytic PI3K subunit age-1, while increasing PI3K pathway activity partially suppressed the AC invasion defect caused by mcm-7 depletion. The PI3K pathway may be activated in the AC by the INA-1/PAT-3 αβ-integrin complex on the invasive membrane [6] and signal via MIG-10/Lamellipodin to promote invasion, analogous to the interaction between AGE-1 and MIG-10 during axon guidance [51]. Accordingly, a loss of age-1 function caused partially penetrant BM breaching defects.

A replication-independent role of the pre-RC in the transcriptional regulation of specific targets has first been observed in budding yeast during the silencing of mating-type genes [52,53]. Also, the mammalian MCM proteins negatively regulate the transcriptional activity of the hypoxia inducible factor HIF-1α in quiescent cells [54], while MCM5 is required for Stat1-mediated transcriptional activation [55]. The genome-wide mapping of replication origins in C. elegans and in human cells revealed an enrichment of active, “firing” origins near transcription factor binding sites in the vicinity of highly transcribed genes [56,57]. It thus appears that the pre-RC has adopted a new function in the postmitotic AC to license the expression of proinvasive genes (. It should be noted that even a global inactivation of mcm-7 by FLP/FRT-mediated excision only caused a partially penetrant BM breaching defect. Hence, other factors may compensate for a loss of pre-RC activity to facilitate the switch toward an invasive fate.

Interestingly, the expression levels of MCM-7 in the AC of L3 larvae were lower than in the adjacent uterine and vulval cells that continued to proliferate, and ectopic expression of mcm-7 using a strong AC-specific enhancer element led to relatively low MCM-7 protein levels, suggesting that MCM-7 is down-regulated in the G1-arrested AC at the posttranscriptional level. Dividing cells usually express an excess of MCM proteins that assemble not only on active replication origins but are spread over the entire chromatin at sites that do not overlap with sites of DNA replication, a phenomenon termed “MCM paradox” [14]. It has been proposed that the excess of MCM complexes in dividing cells are used to license a large number of dormant origins that could be used as reserve in case of DNA replication stress [58]. The relatively low MCM-7 levels in the G1-arrested AC may confer a certain specificity to the MCM complex by allowing it to bind only to a limited number of high-affinity sites near its target genes, while being insufficient to permit the progression through S-phase.

Several components of the pre-RC are overexpressed in tumor cells and have therefore been used as biomarkers [13,14]. The pre-RC has been predominantly studied in the context of cell cycle progression and genomic instability in human cancer cells. However, there exists a handful of reports associating pre-RC genes with cancer progression and increased cell migration [49,59-62]. Notably, Lau and colleagues observed reduced migration and invasion of human medulloblastoma cells after inhibition of MCM proteins [63]. Our data using a developmental model for cell invasion provide direct evidence for a cell cycle–independent function of the pre-RC during cell invasion. For some pre-RC components, DNA replication-independent functions that involve distinct protein complexes have been reported: For example, Drosophila ORC6 forms a complex with the septin protein Peanut to drive cytokinesis [64], and CDT1 has been proposed to act as a hub for the recruitment of DNA repair proteins [65] and chromatin modifiers such as HBO1 [66], HDAC11 [67], and Geminin [68]. Thus, it is also possible that the pre-RC components we have identified in this study act outside of the canonical pre-RC complex to perform their proinvasive function by forming complexes with other cellular proteins.

In summary, the proinvasive function of the pre-RC—or some of its components—may be conserved between C. elegans and mammalian cells. The changes in extracellular matrix and PI3K gene expression after down-regulating mcm-7 in the C. elegans AC and in human cancer cells suggest that the pre-RC controls cell adhesion and BM remodeling to facilitate cell invasion. Likewise, cells entering S-phase turn over their focal adhesions, while mitotic cells must completely detach from the matrix to undergo cytokinesis [69]. Therefore, the pre-RC may coordinate cell adhesion with DNA replication in dividing cells, while invasive cells such as the AC may have uncoupled the regulation of cell adhesion and BM breaching by the pre-RC from its function in replication origin licensing.

Materials and methods

C. elegans culture and maintenance

C. elegans strains were maintained at 20°C on standard nematode growth plates as described [70]. The wild-type strain was C. elegans Bristol, variety N2. We refer to translational protein fusions with a:: symbol between the gene name and the tag, while transcriptional fusions are indicated with a > symbol between the promoter/enhancer and the tag. The genotypes of the strains used in this study are listed in . Except for strain PS4444, which was provided by CGC, all strains were generated in this study.

Scoring AC invasion

AC invasion was scored at the Pn.pxx (4-cell) stage as described [8]. We monitored the continuity of the BM by fluorescence microscopy using the qyIs10[lam-1>lam-1::gfp] or qyIs127[lam-1>lam-1::mCherry] transgenes as markers.

Global and tissue-specific RNA interference

RNAi by feeding dsRNA-producing E. coli was performed in strains carrying the indicated markers in the rrf-3(pk1426) RNAi hypersensitive background as described in [71,72]. Synchronized populations of L1 larvae were obtained by hypochlorite treatment of gravid adults. If the RNAi treatment did not cause lethality or sterility, then the F1 generation was scored after 5 days, or else the P0 animals were analyzed after 30 to 36 hours of treatment. RNAi clones targeting genes of interest were obtained from the C. elegans genome-wide RNAi library [71] or the C. elegans open reading frame (ORFeome) RNAi library (both from Source BioScience). Genes not available in either of the 2 libraries were cloned into the L4440 vector by Gibson assembly using the oligonucleotide primers indicated in . For AC- and Pn.p cell-specific RNAi, we used an rde-1(ne219); rrf-3(pk1426); qyIs10[lam-1>lam-1::gfp] strain carrying the qyIs102[fos-1a>rde-1] or the zhEx418[lin-31>rde-1] transgene, respectively [31,32]. The empty L4440 vector was used as negative control and an RNAi clone targeting egl-43 [40] was used as positive control.

Microscopy of C. elegans

Fluorescent and Nomarski images of C. elegans larvae were acquired with a LEICA DM6000B microscope equipped with a Leica DFC360 FX camera and a 63x (N.A. 1.32) oil-immersion lens, or with an Olympus BX61 wide-field microscope equipped with a X-light spinning disc confocal system using a 70-μm pinhole, a lumencor solid-state light source using a 60x Plan Apo (N.A. 1.4) lens and an iXon Ultra 888 EMCCD camera.

AC polarity and fluorescence intensity measurements

Fluorescence intensities of the different reporters were quantified using Fiji software with the built-in z-projection and measurement tools [73]. To measure the intensity of the different reporters, background subtracted summed z-projections spanning the width of the AC labeled with an mCherry marker were quantified. Quantification of mCherry::moeABD polarity in the AC was done using deconvolved wide-field or confocal image stacks spanning the width of the AC. Polarity plots were calculated from the summed z-projections of the AC as described in [74]. Quantification of the CKD sensor was done according to [39]; a mid-sagital section of the AC was filtered with Gaussian blur (sigma = 50) to reduce camera noise, and the average intensities in three randomly selected areas, each in the AC nucleus and cytoplasm, were used to calculate the cytoplasmic to nuclear intensity ratios.

Generation of reporter and rescue transgenes

For all constructs, fragments were PCRs amplified with Phusion DNA Polymerase (New England Biolabs) and were assembled by T4 ligase (New England Biolabs) or if Gibson assembly was used with Gibson assembly kit #E2611 (New England Biolabs). Details on the construction of the plasmids used to create the different transgenes are shown in . The sequences of the oligonucleotide primers used can be found in . All plasmids were verified by DNA sequencing. For each reporter, single-copy transgene insertions were created according to the MosSCI protocol [37] by microinjection of 50 ng/μl of the respective reporter plasmid together with 50 ng/μl pJL43.1 (mos-1 transposase) and 2.5 ng/μl pCFJ90 (myo-2>mCherry), 5 ng/μl pcFJ104 (myo-3>mCherry), and 10 ng/μl pGH8 (rap-3>mCherry) as coinjection markers.

Generation of the zh118[frt::gfp::mcm-7], zh161[gfp::age-1], and zh178[aap-1::gfp] alleles

The streamlined CRISPR/CAS9 method described [25] was used to generate endogenously tagged reporters. The 5′ and 3′ homology arm were amplified from N2 genomic DNA with primers indicated in . These fragments were cloned into pMW75 digested with ClaI to create the repair templates pTD16, pTD60, and pTD72. pMW75 is a derivate of pDD282, in which the gfp cassette and the ccdB negative selections markers were replaced with a gfp cassette from pDD95.75 containing FRT-sites in introns 1 and 2. About 20 ng/μl of the resulting plasmids were injected together with 50 ng/μl of the respective single-guide RNA expression plasmids pTD17 (mcm-7 sgRNA#2 (CCACCACTTACAACACAGAC), pTD61 (age-1 sgRNA#1 TTA AGA TTT TAA GAT GTC TA) and pTD62 (age-1 sgRNA#2 TAA GAT TTT AAG ATG TCT AT) and pTD63 (age-1 sgRNA#3 GGT TCG ACT TCG AAA TGT CG) or pTD73 (aap-1 sgRNA#1 AAC TAT TCC GGG ATG GAT TT) and pTD74 (aap-1 sgRNA#2 TTT AAA TAT ATA ACT ATT CC) and 2.5 ng/μl pCFJ90 (myo-2>mCherry), 5 ng/μl pcFJ104 (myo-3>mCherry), and 10 ng/μl pGH8 (rap-3>mCherry) coinjection markers. The selection of the integrated CRISPR lines was carried out according to [25].

FLP/FRT-mediated mcm-7 mosaic analysis and AC-specific rescue

Mosaic analysis in the qyIs10[lam-1>lam-1::gfp]; qyIs23[cdh-3>mCherry::PLCδPH]; zh118[frt::gfp::mcm-7] strain was performed by FLPase expression from a heat shock–inducible promoter, using the zhEx621[hs-16-48>flp] transgene as described [26]. Late L1/early L2 larvae were heat shocked for 1 hour at 34°C and allowed to recover at 20°C. GFP::MCM-7 expression and AC invasion was scored 40 hours later. For AC-specific rescue, the wild-type zhIs119 and mutant zhIs142 transgenes were introduced into the zhEx621[hs-16-48>flp]; qyIs10[lam-1>lam-1::gfp]; qyIs23[cdh-3>mCherry::PLCδPH]; zh118 [frt::gfp::mcm-7] background and BM breaching was scored after heat shock induced flp expression, as described above.

Generation of Dox-inducible shMCM7 and shControl cells

The human cell lines A375 and A549 were tested to be free of mycoplasm and cultured in Dulbecco’s Modified Eagle Medium (DMEM, Gibco 41966–029) supplemented with 10% FCS (Gibco 10500–064) and 1% Pen-Strep (Gibco 15140–122) according to standard mammalian tissue culture protocols and sterile technique.

Double stranded oligonucleotides for an shRNA targeting MCM7 (CAG AGG AGG ATT TCT ACG AAA), or a scrambled shRNA (TAA TGT ATT GGA ACG CAT ATT) were cloned into the Dox-inducible shRNA expression vector pRSIT17 (Cellecta # SVSHU6T17-L), which was then transfected in combination with pVSV-G, pMDL and pREV into HEK293T cells to produce lentiviral particles. Four days following transfection, the media from cells was collected, clarified by centrifugation, and filtered through a 0.45-μM filter to collect lentiviral particles. Subsequently, the particles were concentrated in Amicon Ultra tubes (Ultracell 100k, Millipore). A375 or A549 cells were transduced overnight with lentiviral particles (MOI of 1.4) in DMEM medium supplemented with 10 μg/ml polybrene. Three days after transduction, cells were grown in the presence of 1.2 μg/ml puromycin. One week after puromycin selection, the puromycin-resistant populations were frozen and kept as stocks used for the subsequent experiments.

Cell synchronization and cell cycle analysis

Cell synchronization with double Thy block [41] was performed by growing cells in medium supplemented with 2 mM Thy for 17 hours, followed by an 8-hour release in medium without Thy, after which cells were kept arrested in medium containing 2 mM Thy during the analysis. Cell cycle analysis by DAPI and EdU double labeling was done using the Click-iT assay (Thermo Fischer C10420) as described [75] and analyzed by flow cytometry (BD LSR II Fortessa).

RNAseq analysis of Dox-inducible shMCM7cells

Total RNA from Dox-inducible shMCM7 or parental A375 and A549 cells, each arrested in G1 by double Thy block and simultaneously treated for 72 hours with 1 μg/ml Dox, where indicated, was isolated using the RNeasy Mini Kit (#74104 Qiagen). Three biological replicates for each condition were analyzed. Quality control by Agilent Tape Station/Bioanalyzer, RNA library preparation, and whole exome sequencing were performed in triplicates by the transcriptomics service of the Functional Genomics Center Zürich (FGCZ). Using the HiSeq 2500 System (Illumina), around 200 million reads/lane were obtained. Bioinformatic analysis was done by the FGCZ using an in-house pipeline utilizing the open source tools STAR for read alignment, DESeq2 and EdgeR for differential gene expression, and GOseq for GO enrichment analysis. Bootstrap analysis with a resampling size of 1,000 was used to determine the significance of the overlap between the MCM7-regulated genes in A549 and A375 cells. The RNAseq data generated in this study are available at the NCBI Gene Expression Omnibus (GEO) (http://www.ncbi.nlm.nih.gov/geo/) under accession number GSE149523.

Western blot analysis

Cells were lysed in lysis buffer on ice (100 mM Tris/HCl, 150 mM NaCl, 1% Triton X, 1 mM EDTA, 1 mM DTT, 10 ml lysis buffer + 1 tablet protease inhibitor), scraped with a cell scraper, and snap frozen in liquid nitrogen. A volume of 100 μl of this mix was sonicated in a Bioruptor sonicator device (Diagenode), before 100 μl of 2x SDS loading dye were added. About 10 mg of protein extract were resolved by SDS-PAGE and transferred to nitrocellulose membrane. The membrane was blocked in 5% dried milk in 1x PBS plus 0.2% Tween 20 and incubated with the diluted primary antibodies overnight at 4°C. Secondary anti-rabbit or anti-mouse IgG antibodies conjugated to horseradish peroxidase (HRP) were used as the secondary antibodies. The HRP was detected by incubating the membrane with the SuperSignal West Pico or Dura Chemiluminescent Substrate (Thermo Scientific) for 4 minutes, before the signals were acquired on a digital chemiluminescence imaging system. The antibodies used for western blot analysis were anti-MCM7 (141.2 Santa Cruz), anti-Tubulin (ab18251 abcam), and anti-pAKT (44-621G Thermo Scientific). Quantification of western blots was done by measuring the band intensities in Fiji.

EGF and insulin stimulation

About 28,000 cells were seeded into 12-well plates and treated after 24 hours throughout the experiment with 1 μg/ml Dox where indicated. Around 48 hours after seeding, cells were additionally arrested at the G1/S boundary by growing cells in medium supplemented with 2 mM Thy for 17 hours, followed by an 8-hour release in medium without Thy [41]. Thereafter, growth medium was replaced with DMEM containing 2 mM Thy and lacking FCS. After 15 hours of starvation, cells were stimulated for 10 minutes with 100 ng/ml human EGF (E9644 Sigma) or with 10 nM human insulin (I9278 Sigma) before they were lysed and prepared for western blot analysis.

Structure of the frt::gfp::mcm-7(zh118) locus.

Structure of the frt::gfp::mcm-7(zh118) locus before and after FLP-mediated recombination. The gfp coding regions and protein sequence are labeled in green and the mcm-7 region in yellow. The stop codons generated by the frameshift after the excision of exon 2 are indicated in red. FLP, flippase; FRT, FLP recognition target sequence.

(PDF)

Click here for additional data file.

Cdt-1 is expressed in the AC during invasion.

GFP::CDT-1 (zhIs120) and LAM-1::GFP expression beginning at the mid-L2 stage, shortly before AC specification, until the late-L3 (P6.pxx) stage after BM breaching are shown. DIC images are shown in the left panels; CDT-1::GFP and LAM-1::GFP expression in green are shown in the middle panels. The right panels show the GFP images merged with the AC marker ACEL>mCherry (zhIs127) in magenta. The arrowheads point to the AC nuclei. The scale bar is 5 μm. AC, anchor cell; BM, basement membrane; DIC, differential interference contrast.

(PDF)

Click here for additional data file.

Expression of AC and VPC fate markers after mcm-7 RNAi.

(A) Expression of a translational reporter for the HLH-2 transcription factor together with the LAM-1::GFP BM marker in control animals (top row) and in mcm-7 RNAi-treated animals (bottom row) and (B) quantification of HLH-2 expression levels in the AC. (C) Expression of a transcriptional reporter for the CDH-3 proto-cadherin together with the LAM-1::GFP BM marker in control animals (top row) and in mcm-7 RNAi-treated animals (bottom row) and (D) quantification of cdh-3 expression levels in the AC. (E) Expression of a transcriptional reporter for the EGF homolog lin-3 in control animals (top row) and in mcm-7 RNAi-treated animals (bottom row) and (F) quantification of lin-3 expression levels in the AC. (G) Expression of the 1° fate marker egl-17 in the VPCs of control animals (top row) and in mcm-7 RNAi-treated animals (bottom row). Left panels show the GFP signals and right panels the GFP channel merged with the DIC images. The numbers in brackets in the graphs refer to the numbers of animals analyzed, and the horizontal lines indicate the median values. Statistical significance was determined with a two-tailed t test for independent samples and is indicated as n.s. for p > 0.05 and *** for p < 0.001. See for the numerical values used to generate the graphs in (B), (F), and (D). The scale bars are 10 μm in (A) and 5 μm in (C), (E), and (G). AC, anchor cell; DIC, differential interference contrast; n.s., not significant; VPC, vulval precursor cell.

(PDF)

Click here for additional data file.

AC-specific expression of wild-type and helicase-deficient MCM-7::CFP.

(A) Alignment of the ATPase motif in the helicase domain of human and C. elegans MCM-7. Conserved residues are highlighted in black. The 4 amino acid substitutions eliminating the helicase activity in the ACEL>mcm-7(mut)::cfp transgene are shown. (B) AC-specific expression of the ACEL>MCM-7::CFP wild-type and mutant proteins. The arrowheads in the DIC images point at the AC nuclei. (C) Quantification of ACEL>MCM-7(wt)::CFP expression in the somatic gonad from the L1 to the ate L2 stage. Larval stages were assigned according to the gonad lengths, as described in [76]. The x-axis shows the gonad length measured as distance between the 2 distal tip cells and the y-axis the proportion of animals showing MCM-7(wt)::CFP expression in the AC (n = 391). See S1 Data for the numerical values used to generate the graph. The scale bar in (B) is 5 μm. AC, anchor cell; DIC, differential interference contrast.

(PDF)

Click here for additional data file.

hda-1 expression after mcm-7 RNAi.

(A) HDA-1::RFP expression in the AC in control RNAi (top row) and mcm-7 RNAi-treated animals (bottom row). The scale bar is 5 μm. (B) Quantification of HDA-1::RFP expression levels in the AC. The right panels show the DIC images and the right panels the fluorescence signal. The arrowheads point at the AC nuclei. The numbers in brackets in the graphs refer to the numbers of animals analyzed, and the horizontal lines indicate the median values. Statistical significance was determined with a two-tailed t test for independent samples and is indicated as *** for p < 0.001. See S1 Data for the numerical values used to generate the graph. AC, anchor cell; DIC, differential interference contrast.

(PDF)

Click here for additional data file.

GFP::MCM-7 expression after fos-1 RNAi.

(A) GFP::MCM-7 expression in the AC in control RNAi (top row) and fos-1 RNAi-treated animals (bottom row) The scale bar is 5 μm. (B) Quantification of GFP::MCM-7 expression levels in the AC. The right panels show the DIC images overlaid with the GFP::MCM-7 and the AC::mCherry signals. The numbers in brackets in the graphs refer to the numbers of animals analyzed, and the horizontal lines indicate the median values. See S1 Data for the numerical values used to generate the graph. AC, anchor cell; DIC, differential interference contrast.

(PDF)

Click here for additional data file.

Knock-down of MCM7 in G1/S-arrested A375 and A549 cells.

(A) Cell cycle analysis by flow cytometry of A375 and (B) A549 cells expressing shScramble or shMCM7 without or with double thymidine block (+Thy). (C) Western blot analysis of phospho-AKT and MCM7 levels upon MCM7 knock-down in Thy-arrested, serum-starved EGF and insulin-stimulated A375 and (D) A549 cells. The western blots of 1 out of 3 biological replicates for each cell line are shown. See for the original images of all western blots. (E) Quantification of MCM7 protein levels in shScramble and shMCM7 expressing A375 and A549 cells. The averaged measurements of 4 biological replicates are shown. Statistical significance in (E) was determined with two-way ANOVA followed by two-tailed t tests for independent samples and is indicated as * for p < 0.05 and as **** for p < 0.0001. See for the numerical values used to generate the graph s in (A), (B), and (E). The flow cytometry data can be found in the FlowRepository (https://flowrepository.org/) under accession number FR-FCM-Z4XE. Dox, doxycycline; Thy, thymidine.

(PDF)

Click here for additional data file.

Expression profiles of MCM7-depleted and G1/S-arrested A549 and A375 cells.

(A) Differentially expressed genes after Dox-inducible MCM7 knock-down in G1/S-arrested (+Thy) A375 cells and (B) A549 cells were identified by RNAseq analysis. For each cell line, the data of 3 independent biological replicates were analyzed. A clustering analysis of up- and down-regulated genes with a >1.5-fold expression change with p < 0.01 and an FDR <0.05 is shown. Control cells were the parental A549 and A375 cell lines grown with or without Dox. For all samples, RNA was extracted from populations, in which at least 95% of the cells had been arrested in the G1/S phase boundary by double Thy block as illustrated in S7 Fig. The colored boxes on the y-axes indicate the identified gene clusters according to the cellular compartments of their gene products. The significantly changed transcripts are listed in S2 Data, and the RNAseq data generated in this study are available at the NCBI GEO (http://www.ncbi.nlm.nih.gov/geo/) under accession number GSE149523. (C) Overlap between the up-regulated and (D) down-regulated genes in the 2 cell lines. The overlap between the MCM7-regulated genes in the 2 cell lines is highly significant (p < 0.001), as the expected number of randomly overlapping genes determined by bootstrap analysis is 42 for the up- and 52 for the down-regulated genes. (E) GO enrichment analysis according to the biological processes and (F) molecular functions of the genes regulated by MCM7 in both cell lines. The red or orange bars indicate the top 10 GO terms enriched in up-regulated genes and the dark or light blue bars the top 10 GO terms enriched in down-regulated genes. The lengths of the bars correspond to the ±log10 of the p-values indicating the significances of enrichment in each cell line. Dox, doxycycline; FDR, false discovery rate; GEO, Gene Expression Omnibus; GO, Gene Ontology; Thy, thymidine.

(PDF)

Click here for additional data file.

AAP-1::GFP and GFP::AGE-1 expression after fos-1 RNAi.

(A) Quantification of AAP-1::GFP and (B) AGE-1::GFP expression levels in the AC of control and fos-1 RNAi-treated animals. (C) Fraction of animals exhibiting polarized AAP-1::GFP and GFP::AGE-1 localization. The numbers of animals scored are indicated in brackets. The horizontal lines indicate the median values. No significant differences were found in two-tailed t tests for independent samples (p > 0.2). See for the numerical values used to generate the graphs in (A-C). AC, anchor cell.

(PDF)

Click here for additional data file.

BM breaching in age-1 PI3K null mutants.

(A) BM breaching visualized with the LAM-1::GFP marker in age-1(mg)/+ heterozygous and (B) homozygous age-1(mg44) L4 larvae in the F2 generation. All heterozygous age-1(mg)/+ siblings carrying the mnC1 balancer showed normal BM breaching (n = 38), while 23% of the F2 generation age-1(mg44) animals (n = 61) exhibited no or only partial BM breaching. BM, basement membrane.

(PDF)

Click here for additional data file.

RNAi screen of C. elegans homologs of human genes differentially expressed in invasive cells.

List of human genes (first column) that changed their expression with a log2 fold change ≥1 after SOX9 overexpression, TGF-ß stimulation, under hypoxia or during NC cell migration as indicated by a +. The names of the C. elegans orthologs that were screened by RNAi for AC invasion defects are indicated in the sixth and seventh column. Pvl indicates a protruding vulva phenotype at the adult stage, which is characteristic of vulval morphogenesis or AC invasion defects. The frequencies of BM breaching defects or of delayed BM breaching (after the Pn.pxx stage) are indicated. RNAi of genes causing a BM breaching defect are highlighted in green, and the negative control RNAi with the empty vector in red. n refers to the number of animals scored. AC, anchor cell; BM, basement membrane; NC, neural crest.

(XLSX)

Click here for additional data file.

The pre-IC is not required for AC invasion.

Genes encoding different pre-IC components were analyzed by RNAi for their potential to breach the BM at the P6.p.xx stage as described in Fig 2. Observed BM breaching defects are indicated in absolute numbers. AC, anchor cell; BM, basement membrane; pre-IC, pre-initiation complex.

Fig 2

mcm-7 acts in the AC to induce BM breaching.

(A) GFP::MCM-7 (zh118) and LAM-1::GFP expression beginning at the mid-L2 stage, shortly after AC specification, until the late-L3 (P6.pxx) stage after BM breaching are shown. DIC images are shown in the left panels; GFP::MCM-7 and LAM-1::GFP expression in green are shown in the middle panels. The dashed boxes indicate the areas around the AC shown at 3-fold magnification in the center panels. The right panels show the GFP images merged with the AC marker ACEL>mCherry (zhIs127) in magenta. The arrowheads point at the AC nuclei. (B) Pn.p and AC-specific RNAi of mcm-7 was performed as described in Materials and methods. The top row shows DIC and LAM-1::GFP expression in empty vector–fed control animals and the bottom row mcm-7 RNAi-treated animals at the Pn.p xx stage. BM breaching is indicated by the arrows. The table to the right shows the occurrence of BM breaching defects in absolute numbers. (C) FLP/FRT-mediated mcm-7 mosaic analysis using the zh118(frt:gfp::mcm-7) allele with heat shock induced flp expression to excise mcm-7, as described in Materials and methods and S1 Fig. DIC images are shown in the left panels, LAM-1::GFP expression used to score BM breaching together with GFP::MCM-7 in the middle panels, and the merged images including the AC marker cdh-3> mCherry::PLCδPH (qyIs23) (magenta) in the right panels. The top row shows a control animal at the Pn.pxx stage that did not show any GFP::MCM-7 excision. Examples for the 3 major classes of mosaic animals observed are shown underneath; excision in most uterine cells, excision in the 1° VPCs, and excision in both tissues. The arrows indicate the sites of BM breaching and the arrowheads point at the AC nuclei. (D) Quantification of the AC invasion defects in the different classes of FLP-induced zh118(frt::gfp::mcm-7) mosaic animals carrying no transgene, the wild-type, or the mutant rescue transgenes. The 3 major classes of mosaic animals and control animals without mcm-7 excision were scored separately for each genotype. The data shown are the combined results obtained in 3 biological replicates. n refers to the number of mosaic animals scored, and the error bars indicate the SEM. p-Values were determined with a nonparametric Kruskal–Wallis test with Dunn’s multiple comparison correction and are indicated as ** for p < 0.01 and n.s. for p > 0.5. See S1 Data for the numerical values used to generate the graph. The scale bars are 5 μm. AC, anchor cell; BM, basement membrane; DIC, differential interference contrast; FLP, flippase; FRT, FLP recognition target sequence; VPC, vulval precursor cell.

(XLSX)

Click here for additional data file.

List of C. elegans strains used.

(XLSX)

Click here for additional data file.

List of oligonucleotide primers used.

(XLSX)

Click here for additional data file.

Construction of plasmids used to generate reporter lines.

(XLSX)

Click here for additional data file.

Numerical values used to generate the graphs, as indicated in the figures.

(XLSX)

Click here for additional data file.

Results of the RNAseq analysis in A375 and A549 cells.

Genes with a >1.5-fold expression change with p < 0.01 and an FDR <0.05 are included. The data for each individual cell line as well as the overlap between the 2 lines are shown. FDR, false discovery rate.

(XLSX)

Click here for additional data file.

Uncropped images of the western blots used for the quantifications shown in Figs 5B and S7.

(PDF)

Click here for additional data file.

3D heat-maps of moeABD expression in the AC.

3D reconstructions of the mCherry::moeABD signal in the AC after control (left) and mcm-7 RNAi (right). AC, anchor cell.

(AVI)

Click here for additional data file.

8 Jun 2021

Dear Dr Hajnal,

Thank you for submitting your manuscript entitled "A DNA Replication-Independent Function of the pre-Replication Complex during Cell Invasion in C. elegans" for consideration as a Research Article by PLOS Biology.

Your manuscript has now been evaluated by the PLOS Biology editorial staff as well as by an academic editor with relevant expertise and I am writing to let you know that we would like to send your submission out for external peer review.

However, before we can send your manuscript to reviewers, we need you to complete your submission by providing the metadata that is required for full assessment. To this end, please login to Editorial Manager where you will find the paper in the 'Submissions Needing Revisions' folder on your homepage. Please click 'Revise Submission' from the Action Links and complete all additional questions in the submission questionnaire.

Please re-submit your manuscript within two working days, i.e. by Jun 10 2021 11:59PM.

Login to Editorial Manager here: https://www.editorialmanager.com/pbiology

During resubmission, you will be invited to opt-in to posting your pre-review manuscript as a bioRxiv preprint. Visit http://journals.plos.org/plosbiology/s/preprints for full details. If you consent to posting your current manuscript as a preprint, please upload a single Preprint PDF when you re-submit.

Once your full submission is complete, your paper will undergo a series of checks in preparation for peer review. Once your manuscript has passed all checks it will be sent out for review.

Given the disruptions resulting from the ongoing COVID-19 pandemic, please expect delays in the editorial process. We apologise in advance for any inconvenience caused and will do our best to minimize impact as far as possible.

Feel free to email us at plosbiology@plos.org if you have any queries relating to your submission.

Kind regards,

Richard Hodge, PhD

Associate Editor

PLOS Biology

rhodge@plos.org

1 Jul 2021

Dear Dr Hajnal,

Thank you very much for submitting your manuscript entitled "A DNA Replication-Independent Function of the pre-Replication Complex during Cell Invasion in C. elegans" for consideration as a Research Article at PLOS Biology. Your manuscript has been evaluated by the PLOS Biology editors, an Academic Editor with relevant expertise, and by two independent reviewers.

You will see that both reviewers agree that the role for the pre-RC in promoting cell invasion is an exciting finding of broad interest, but also think that several revisions should be done before we can consider the manuscript for publication. Reviewer 1 would like you to check the timing of the genetic manipulations to show clearly at what point they affect the invading cell lineage, and wants an additional RNAi experiment to establish whether PI3K signalling is required for invasion on its own. Reviewer 2 raises some alternative interpretations of the results, in particular that the invasion phenotype could be mediated by pre-RC components interacting with other multi protein complexes. After discussing the reviews with the Academic Editor and the rest of the team, we do think these experiments should be performed.

In light of the reviews (attached below), we will not be able to accept the current version of the manuscript, but we would welcome re-submission of a revised version that takes into account the reviewers' comments. We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent for further evaluation by the reviewers.

We expect to receive your revised manuscript within 3 months.

Please email us (plosbiology@plos.org) if you have any questions or concerns, or would like to request an extension. At this stage, your manuscript remains formally under active consideration at our journal; please notify us by email if you do not intend to submit a revision so that we may end consideration of the manuscript at PLOS Biology.

**IMPORTANT - SUBMITTING YOUR REVISION**

Your revisions should address the specific points made by each reviewer. Please submit the following files along with your revised manuscript:

1. A 'Response to Reviewers' file - this should detail your responses to the editorial requests, present a point-by-point response to all of the reviewers' comments, and indicate the changes made to the manuscript.

*NOTE: In your point by point response to the reviewers, please provide the full context of each review. Do not selectively quote paragraphs or sentences to reply to. The entire set of reviewer comments should be present in full and each specific point should be responded to individually, point by point.

You should also cite any additional relevant literature that has been published since the original submission and mention any additional citations in your response.

2. In addition to a clean copy of the manuscript, please also upload a 'track-changes' version of your manuscript that specifies the edits made. This should be uploaded as a "Related" file type.

3. Resubmission Checklist

When you are ready to resubmit your revised manuscript, please refer to this resubmission checklist: https://plos.io/Biology_Checklist

To submit a revised version of your manuscript, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' where you will find your submission record.

Please make sure to read the following important policies and guidelines while preparing your revision and fulfil the editorial requests:

a) *Published Peer Review*

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details:

https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/

b) *PLOS Data Policy*

Please note that as a condition of publication PLOS' data policy (http://journals.plos.org/plosbiology/s/data-availability) requires that you make available all data used to draw the conclusions arrived at in your manuscript. If you have not already done so, you must include any data used in your manuscript either in appropriate repositories, within the body of the manuscript, or as supporting information (N.B. this includes any numerical values that were used to generate graphs, histograms etc.). For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5

Please also make sure you mention in the corresponding figure legends WHERE THE DATA CAN BE FOUND, and that your Data Statement in the submission system accurately describes where your data can be found.

c) *Blot and Gel Data Policy*

Please provide the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require these files before a manuscript can be accepted so please prepare them now, if you have not already uploaded them. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements

d) *Protocols deposition*

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosbiology/s/submission-guidelines#loc-materials-and-methods

Thank you again for your submission to our journal. We hope that our editorial process has been constructive thus far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Ines Alvarez-Garcia, PhD

Senior Editor

PLOS Biology

ialvarez-garcia@plos.org

on behalf of

Richard Hodge

Associate Editor

PLOS Biology

rhodge@plos.org

--------------------------------------------------

Reviewers’ comments

Rev. 1:

In the submitted work, "A DNA-Replication-Independent Function of the pre-Replication Complex during Cell Invasion in C. elegans" the authors present evidence for a new role for the pre-Replication Complex (pre-RC) during anchor cell invasion in C. elegans. Using an RNAi screen based on genes upregulated in human melanoma cells, they show that a number of components of the pre-RC are required for AC (anchor cell, the invading cell) invasion (CDC-6, ORC-2, ORC-5, CDT-1, MCM-7). They further demonstrate using AC-specific RNAi and AC-specific rescue that MCM-7, a component of the pre-RC, functions in the AC after its specification to promote cell invasion through basement membranes (and that it requires its enzymatic helicase activity—suggesting a role in modifying DNA). Further, they provide RNAi knockdown evidence, that components of the preinitiation Complex (pre-IC) that act downstream of pre-RC during S phase are not required for AC invasion. They go onto endogenously tag MCM-7 and show that it is expressed at low levels in the post-mitotic AC (but then is not detectable just prior to and during invasion). The authors show that MCM-7 does not alter the fate nor the cell cycle status of the AC, but instead promotes the expression of several pro-invasive genes (the MMP, ZMP-1 and the matrix protein hemicentin), as well as regulates the tight localization of F-actin at the invasive front during BM breaching. The authors go back to melanoma cells and identify the PI3K signaling pathway as a potential positively regulated transcriptional target of MCM7 in two melanoma lines and go onto show that PI3K is expressed in the AC (AGE-1 and AAP-1) and that the protein localization (and possibly gene expression for age-1) is regulated by the C. elegans MCM-7. Finally, the authors show that mutations that activate PI3K signaling in the AC partially rescue the mcm-7 RNAi mediated defect in AC invasion.

Overall, this is a well written, rigorous, and important and interesting study that uses the strengths of C. elegans to reveal an unexpected role for the pre-RC in promoting cell invasion—a finding that is important for expanding our understanding of the roles of pre-RC, as well as our understanding of cell invasion in development and cancer. I have few comments, however, that should be addressed to provide more rigor, accuracy and depth to the study.

Points to address:

1. One of the most important and interesting points of the paper is that the pre-Replication complex has a role in the post-mitotic AC to promote cell invasion. Because the lineage of the AC is complex and the timing of gene loss for most experiments in the work is not precise and likely before the AC is specified, this point needs to be clarified in the manuscript (esp., since the pre-RC has an established role in DNA replication associated with cell division). To reduce the function of mcm-7 and implicate a role in the post mitotic AC, the authors in part use a FLP/FRT-induced mosaic knockout system for mcm-7 that is induced via heat shock at the late L1/early L2 stage. One of the points the authors should state in this section of the results is that the AC is born in the early L2 stage (either Z1.ppp or Z4.aaa). Any mcm-7 knockdown before that time (such as possibly with the FLP/FRT system given the timing of induced knockout, and with whole body RNAi, which most of the work is done with) could implicate a role for mcm-7 in the mother cell that gave rise to the AC or in the cell division that gave rise to the AC rather than a role in the post-mitotic AC. This section should be organized to emphasize how the AC-specific RNAi establishes a role for mcm-7 in the post-mitotic AC itself (including describing specifically when the AC-specific strain becomes sensitive to RNAi) and not the ACs predecessor/mother cell. This point should also be emphasized in the following section with the control rescue of the mcm-7 knockout when mcm-7::cfp is driven by the lin-3 AC-specific promoter. To me this is the most important experiment in the paper, and I would have preferred an AC-specific degradation approach for MCM-7 (ZIF or AID), however, the lin-3 ACEL driven rescue is convincing, as long as early expression driven from this regulatory region is ruled out.

2. The authors should confirm when mcm-7::CFP is first seen in the AC when driven by the AC-specific LIN-3 element—especially to make certain it is not expressed in the L1 stage in the gonad and cell that gives rise to the AC.

3. The authors state, "Invasion by the post-mitotic AC is linked to the differentiation and proliferation of the underlying 1° VPCs that produce guidance signals, which attract the AC ventrally [7]. We therefore tested whether the AC invasion defects observed after down-regulation of pre-RC components are caused by a proliferation arrest of the VPCs." Notably, it has already been demonstrated that the AC can invade when the VPC divisions are blocked by Hydroxy Urea treatment. From Sherwood and Sternberg, Dev Cell 2003, "To determine if the AC invasion signal generated by the 1 vulval lineage is linked to cell division, cell division was blocked with HU, and animals were analyzed just prior to and after the normal time for AC invasion. While no invasion was observed in animals at the early-to-mid L3 (20/20 animals), at the mid-to-late L3, 95% of ACs attached to the undivided 1fated P6.p cells (19/20 animals; Figure 5E). " This original result should be cited and stated. It would be fine to test cell division with another method further in this paper, but it is important to cite the original finding.

4. How many animals were examined for the results shown in Figure 3A and 3B (cyd::GFP and RNR::GFP)? Can this be stated in the figure legend or text?

5. I'm a little confused by Figure 4B. How many AC's were examined to make this graph? Can this be stated in the figure legend or graph?

6. The authors state, "It should be noted that the gap the AC created in the BMs of psf-1(lf) mutants could not be expanded because the underlying VPCs had ceased to proliferate (Fig. 1A bottom row)" However, in Figure 1D when the authors block P6.p cell division by expressing cki-1 in the P6.p, the BM breach looks wide. Can the breach in these two conditions be quantified? Perhaps the psf-1 does have an AC invasion defect?

7. The work in melanoma cell lines examining the replication-independent functions of MCM7,

by analyzing gene expression in cells arrested at the G1/S boundary after knockdown of MCM7 is interesting. While a role for MCM7 in promoting the expression of the PI3K came from this and was confirmed in C. elegans, where reciprocal findings also found? Specifically, did the work in melanoma cells also identify a role for MCM7 in promoting MMP expression as it does in the AC? It looks like this work might have found the opposite—" GO enrichment analysis of the molecular functions and biological processes of these core MCM7 target genes indicated that many of the up-regulated genes encode extracellular matrix, integrin, actin and ß-catenin interacting proteins". Can you comment/compare on the expression of MMPs in cancer cell lines and your analysis. This is helpful for the field, as pointing out differences as well as similarities is important in building a complete picture of this important and complex problem—pre-RC and cell invasion in different contexts.

8. Does PI3K signaling loss on its own result in an AC invasion defect? It is important that the authors perform AC-specific RNAi on age-1 and aap-1 to establish the requirements of PI3K signaling in the AC on its own. Many aspects of cell biological processes are redundant or provide robustness. This will provide broader insight into the role of the pre-RC into cell invasion, even if age-1 and aap-1 loss on their own don't result in an invasion defect.

9. Discussion section: "The PI3K pathway may be activated in the AC by the INA-2/PAT-2 ab-integrin complex on the invasive membrane [6]" It should be INA-1/PAT-3. There is no INA-2/PAT-2 integrin.

Rev. 2:

This submission reports a novel role for pre-replication complex (pre-RC) proteins (Orc2 and 5, MCM7, cdc6, cdt1) in the regulation of anchor cell invasion across the basement membrane during C. elegans development. The paper provides strong evidenced that this function is distinct from the known activity of pre-RC in the early stages of genome duplication, where they associate with chromatin to provide a scaffold for the initiation of DNA synthesis. The paper reports that in the C. elegans non-proliferating cells, pre-RC proteins act as transcriptional modulators, regulating the transcription of extracellular matrix genes to activating cell invasion upstream of the PI3 kinase pathway. This novel function of pre-RC components validates previous observations proposing that replication licensing proteins have other roles unrelated to cellular preparation for DNA synthesis.

The experimental approach is based on a screen for worm orthologs of genes overexpressed in melanoma exposed to migration stimulants. The experimental analyses utilize appropriate, state-of-the-art techniques. The results strongly support the hypothesis that Orc2 and 5, MCM7, cdc6, cdt1 play a role in the transcriptional regulation of genes involved in anchor cell invasion. The paper in its current form, however, does not address the question of whether these components perform this regulatory role as a part of a pre-RC complex similar to the one used in proliferating cells, or as components of other cellular multi-protein complexes. The paper in its current form also does not resolve if the helicase activity of pre-RC, or just the ATPase activity of MCM-7, is required for AC invasion.

1. The title and abstract of the current submission imply that the pre-RC, as a complex, participates in the transcriptional regulation of AC invasion. However, some pre-RC components that are essential for replication licensing do not seem to play a role in invasion, and the paper in its present form does not provide evidence that the genes identified in the screen act within the pre-RC complex. The reported observations could imply that some members of pre-RC play independent roles as parts of other molecular machines, a concept that already has a precedent (see #2 for references) as several members of the pre-RC complexes were reported to participate in cellular multi-protein complexes other than pre-RC, mediating a variety of cellular functions. This point should at least be discussed.

2. Precedents for interactions of pre-RC components with other multi-protein complexes that play a role in regulating cellular functions have been established (for example, for Drosophila ORC6 PMID: 12878722; centromeric association of ORC2, PMID: 15215892; for CDT1 at kinetochores PMID: 22581055 and PMID: 30154187). Appropriate citations should be included.

3. The expression patterns of MCM7 analyzed in the paper are interesting and support the conclusions that this protein plays a role in invasion. It would be interesting to follow the expression of other pre-RC components in a similar manner.

4. MCM-7 was the only component of the MCM helicase required for AC invasion, and the conclusion that the helicase activity of pre-RC plays a role in the regulation of AC invasion is based on the phenotype of MCM-7 variants harboring ATPase mutations. Although the ATPase activity of MCM-7 is essential for pre-RC helicase activity, the results observed in the current study do not rule out an independent and distinct role for MCM7 ATPase activity that is unrelated to its role in facilitating the MCM2-7 helicase. Because AAA ATPases often manifest more than a single function in cellular activity, this possibility should be discussed.

1 Nov 2021

Submitted filename: Point_by_point_response.pdf

Click here for additional data file.

18 Nov 2021

Dear Dr Hajnal,

Thank you for submitting your revised Research Article entitled "A DNA Replication-Independent Function of pre-Replication Complex Genes during Cell Invasion in C. elegans" for publication in PLOS Biology. I have now obtained advice from the original reviewers and have discussed their comments with the Academic Editor.

The reviewers note that the additional data provided in the revision has further strengthened the manuscript and they appreciate the time and effort that was spent in addressing their concerns. Based on these reviews, we will probably accept this manuscript for publication, provided you satisfactorily address our remaining data and policy-related requests that I have provided below:

(A) You may be aware of the PLOS Data Policy, which requires that all data be made available without restriction: http://journals.plos.org/plosbiology/s/data-availability. For more information, please also see this editorial: http://dx.doi.org/10.1371/journal.pbio.1001797

Note that we do not require all raw data. Rather, we ask that all individual quantitative observations that underlie the data summarized in the figures and results of your paper be made available in one of the following forms:

- Supplementary files (e.g., excel). Please ensure that all data files are uploaded as 'Supporting Information' and are invariably referred to (in the manuscript, figure legends, and the Description field when uploading your files) using the following format verbatim: S1 Data, S2 Data, etc. Multiple panels of a single or even several figures can be included as multiple sheets in one excel file that is saved using exactly the following convention: S1_Data.xlsx (using an underscore).

- Deposition in a publicly available repository. Please also provide the accession code or a reviewer link so that we may view your data before publication.

Regardless of the method selected, please ensure that you provide the individual numerical values that underlie the summary data displayed in the following Figures, as they are essential for readers to assess your analysis and to reproduce it:

Figure 2D, 3D, 4B, 4D, 4F, 4H, 4J, 4L, 5A-B, 5D, 5F-H, S3B, S3D, S3F, S4C, S5B, S6B, S7E, S9A-C

NOTE: the numerical data provided should include all replicates AND the way in which the plotted mean and errors were derived (it should not present only the mean/average values).

(B) We note that Supplementary Figure S7A-B reports flow cytometry data. We ask that you please provide the raw FCS files of these data and recommend depositing the files in the FlowRepository database due to the potential size of the files (https://flowrepository.org/). If you do use the FlowRepository, please ensure that the files are publicly available at this stage and please provide the accession number/URL for the deposition.

(C) Please deposit the underlying RNA-sequencing data (Figure S8) in a public database, such as the GEO. As before, please ensure that the data is made publicly available at this stage and that you provide the accession number/URL for the deposition.

(D) Please also ensure that each of the relevant figure legends in your manuscript include information on *WHERE THE UNDERLYING DATA CAN BE FOUND*, and ensure your supplemental data file/s has a legend

(E) Please ensure that your Data Statement in the submission system accurately describes where your data can be found and is in final format, as it will be published as written there. This includes referencing where the underlying data can be found in the Supplementary Information, as well as providing the accession numbers for the data deposited in public databases.

(F) We require the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files (Fig S7C-D). We will require these files before a manuscript can be accepted so please prepare and upload them now. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements

-------------------

As you address these items, please take this last chance to review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the cover letter that accompanies your revised manuscript.

We expect to receive your revised manuscript within two weeks.

To submit your revision, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' to find your submission record. Your revised submission must include the following:

- a cover letter that should detail your responses to any editorial requests, if applicable, and whether changes have been made to the reference list

- a Response to Reviewers file that provides a detailed response to the reviewers' comments (if applicable)

- a track-changes file indicating any changes that you have made to the manuscript.

NOTE: If Supporting Information files are included with your article, note that these are not copyedited and will be published as they are submitted. Please ensure that these files are legible and of high quality (at least 300 dpi) in an easily accessible file format. For this reason, please be aware that any references listed in an SI file will not be indexed. For more information, see our Supporting Information guidelines:

https://journals.plos.org/plosbiology/s/supporting-information

*Published Peer Review History*

Please note that you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details:

https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/

*Early Version*

Please note that an uncorrected proof of your manuscript will be published online ahead of the final version, unless you opted out when submitting your manuscript. If, for any reason, you do not want an earlier version of your manuscript published online, uncheck the box. Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us as soon as possible if you or your institution is planning to press release the article.

*Protocols deposition*

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

Please do not hesitate to contact me should you have any questions.

Sincerely,

Richard

Richard Hodge, PhD

Associate Editor, PLOS Biology

rhodge@plos.org

------------------------------------------------------------------------

Reviewer remarks:

Reviewer #1: I am very impressed with the thoughtful and rigorous response to my suggestions to clarify and improve the manuscript. The authors of this study have done an outstanding job with this work. Congratulations on the beautiful story-

Reviewer #2: The revision has addressed my concerns. I have no further comments.

1 Dec 2021

Dear Dr Hajnal,

On behalf of my colleagues and the Academic Editor, Hilary Coller, I am pleased to say that we can in principle accept your Research Article "A DNA Replication-Independent Function of pre-Replication Complex Genes during Cell Invasion in C. elegans" for publication in PLOS Biology, provided you address any remaining formatting and reporting issues. These will be detailed in an email that will follow this letter and that you will usually receive within 2-3 business days, during which time no action is required from you. Please note that we will not be able to formally accept your manuscript and schedule it for publication until you have any requested changes.

Please take a minute to log into Editorial Manager at http://www.editorialmanager.com/pbiology/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production process.

PRESS

We frequently collaborate with press offices. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximise its impact. If the press office is planning to promote your findings, we would be grateful if they could coordinate with biologypress@plos.org. If you have not yet opted out of the early version process, we ask that you notify us immediately of any press plans so that we may do so on your behalf.

We also ask that you take this opportunity to read our Embargo Policy regarding the discussion, promotion and media coverage of work that is yet to be published by PLOS. As your manuscript is not yet published, it is bound by the conditions of our Embargo Policy. Please be aware that this policy is in place both to ensure that any press coverage of your article is fully substantiated and to provide a direct link between such coverage and the published work. For full details of our Embargo Policy, please visit http://www.plos.org/about/media-inquiries/embargo-policy/.

Thank you again for choosing PLOS Biology for publication and supporting Open Access publishing. We look forward to publishing your study.

Sincerely,

Richard

Richard Hodge, PhD

Associate Editor, PLOS Biology

rhodge@plos.org

PLOS

Empowering researchers to transform science

Carlyle House, Carlyle Road, Cambridge, CB4 3DN, United Kingdom

ORCiD I plosbio.org I @PLOSBiology I Blog

California (U.S.) corporation #C2354500, based in San Francisco