| Literature DB >> 35174166 |
Xiang Liu1,2,3, Yijia Shao4,5, Jiazichao Tu1,2,3, Jiapan Sun6, Bing Dong4,5, Zhichao Wang4,5, Jianrong Zhou1,2,3, Long Chen7, Jun Tao4,5, Jimei Chen1,2,3.
Abstract
Objective: Trimethylamine-N-oxide (TMAO) was found to play crucial roles in vascular endothelial function. However, the exact molecular mechanisms are not yet entirely clear. Recently, we found that exosomes (Exos) isolated from TMAO-treated hepatocytes (TMAO-Exos) contained a distinctive profile of miRNAs compared to those from the TMAO-free group (Control-Exos). Furthermore, TMAO-Exos could notably promote inflammation, damage vascular endothelial cells (VECs), and impair endothelium-dependent vasodilation. This study aimed to further evaluate the effects of TMAO-Exos on VECs and explore the underlying mechanisms.Entities:
Keywords: C-X-C motif chemokine receptor 4; alternative polyadenylation; angiogenesis; endothelial function; hepatocyte-derived exosomes; trimethylamine-N-oxide
Year: 2022 PMID: 35174166 PMCID: PMC8841965 DOI: 10.3389/fcell.2021.804049
Source DB: PubMed Journal: Front Cell Dev Biol ISSN: 2296-634X
qPCR primers for mRNA used in the study.
| Species | Name | Forward sequence | Reverse sequence |
|---|---|---|---|
|
| CXCR4 | TCTTCCTGCCCACCATCTACTC | GTAGATGACATGGACTGCCTTGC |
|
| GAPDH | TGCACCACCAACTGCTTAGC | GGCATGGACTGTGGTCATGAG |
|
| CXCR4 | CGTCATCCTCTCCTGTTACTGC | GTCGATGCTGATCCCCACATAA |
|
| GAPDH | ACTCTTCCACCTTCGATGCC | TGGGATAGGGCCTCTCTTGC |
CXCR4, C-X-C motif chemokine receptor 4; GAPDH, glyceraldehyde phosphate dehydrogenase.
FIGURE 1Isolation and characterization of exosomes from hepatocyte culture supernatant. (A) Nanovesicles with diameters around 100 nm were isolated and purified from the AML12 cell culture supernatant, which possessed the characteristic size range of exosomes (Exos) under electron microscopes. Bar: 200 nm. (B) The size distribution of the Exos showed no significant difference between trimethylamine-N-oxide (TMAO)-free group (Control-Exos) and TMAO-Exos. (C) Exosomal markers of CD9 and TSG101 were enriched in Exos groups, and the negative markers of calnexin were detected only in whole cell lysate. (D) TMAO was undetectable in Control-Exos, but a small quantity of TMAO remained in TMAO-Exos. Data were expressed as mean ± standard error of the mean (SEM). n = 3, independent t-test was performed for comparisons; **p < 0.01 versus Control-Exos. (E) Exosomes were labelled with DiI and co-cultured with human aortic endothelial cells (HAECs) for 24 h, and it was shown that DiI-labeled Exos could be taken up by cells (×400 magnification).
FIGURE 2TMAO-Exos reduced C-X-C motif chemokine receptor 4 (CXCR4) expression independently of alternative splicing. (A) The tandem 3′-UTR lengths of genes in HAECs were not significantly regulated by Exos. (B) The genes in the “cytokine–cytokine receptor interaction” gene set were visualized on a heatmap. (C) CXCR4 was identified as a key gene according to the relative dark shade, with a degree of 30. Each node represents a gene, and the lines between nodes illustrate interactions between genes. The color of the nodes represents the degree of gene interaction. (D−G) The levels of CXCR4 in sequencing were further validated at the mRNA and protein levels. All data were expressed as mean ± SEM. n = 3, independent t-test was performed for comparisons; **p < 0.01, *p < 0.05 versus Control-Exos.
FIGURE 3TMAO-Exos distributed and reduced CXCR4 levels in the aorta. (A) Representative photographs of the localization of DiI-labelled Exos in the aorta. Exos from both groups were mainly enriched in endothelial cells. Nuclei were stained with DAPI. Bar: 10 μm. (B,C) TMAO-Exos significantly reduced CXCR4 expressions. Nuclei were stained with DAPI. Bar: 10 μm. All data were expressed as mean ± SEM. n = 3, independent t-test was performed for comparisons; *p < 0.05 versus Control-Exos.
FIGURE 4TMAO-Exos impaired cell migration and tube formation via down-regulation of CXCR4. (A) The GFP signals were detectable in HAECs transfected with LV-NC and LV-CXCR4 (×100 magnification). (B–D) Transfection of LV-CXCR4 significantly increased CXCR4 expression at the mRNA and protein levels. n = 3, independent t-test was performed for comparisons; **p < 0.01, *p < 0.05 versus the LV-NC group. (E,F) Cell migration (×100 magnification) and (G,H) tube formation (×40 magnification) were dramatically inhibited by TMAO-Exos, which could be rescued by overexpression of CXCR4. n = 3, one-way ANOVA followed by least significant difference (LSD) test for pairwise comparisons were applied; *p < 0.05, #p < 0.05 versus the TMAO-Exos group and the TMAO-Exos + LV-NC group. All data were expressed as mean ± SEM.
FIGURE 5TMAO-Exos suppressed angiogenesis in hindlimb ischemic mice via repressing CXCR4. (A) The schematic representation for experimental workflow. (B) Representative photographs of the localization of DiI-labelled Exos in gastrocnemius muscles. Exos from both groups were mainly enriched in endothelial cells, where they were co-located with CXCR4. Nuclei were stained with DAPI. Bar: 10 μm. (C,D) TMAO-Exos significantly impeded revascularization at 21 days after ligation of the femoral artery. n = 6, one-way ANOVA followed by LSD test for pairwise comparisons were applied; *p < 0.05, #p < 0.05 versus the TMAO-Exos group and the TMAO-Exos + AAV-NC group. All data were expressed as mean ± SEM.
FIGURE 6TMAO-Exos reduced the capillary density and CXCR4 expression in vivo. (A) The GFP signals of AAV-NC and AAV-CXCR4 were still detectable in gastrocnemius muscles after 21 days. Bar: 10 μm. (B) Transfection of AAV-CXCR4 efficiently increased the mRNA expression of CXCR4. n = 3, independent t-test was performed for comparisons; **p < 0.01. The CXCR4 expressions detected by western blot (C,D) and immunofluorescence analysis (E,F) were notably decreased by TMAO-Exos and restored by overexpression of CXCR4. n = 6 for western blot, n = 3 for immunofluorescence analysis, one-way ANOVA followed by LSD test for pairwise comparisons were applied; *p < 0.05, #p < 0.05 versus the TMAO-Exos group and the TMAO-Exos + AAV-NC group. Bar: 50 μm. (E,G) The capillary densities (indicated by CD31+ cells) were significantly down-regulated but rescued by amplifying the expression of CXCR4. n = 3, one-way ANOVA followed by LSD test for pairwise comparisons were applied; *p < 0.05, #p < 0.05 versus the TMAO-Exos group and the TMAO-Exos + AAV-NC group. Bar: 50 μm. All data were expressed as mean ± SEM.