Literature DB >> 35157723

Prevalence of tick infestation and molecular characterization of spotted fever Rickettsia massiliae in Rhipicephalus species parasitizing domestic small ruminants in north-central Nigeria.

Nusirat Elelu1, Shola David Ola-Fadunsin2, Adefolake Ayinke Bankole3, Mashood Abiola Raji4, Ndudim Isaac Ogo5, Sally Jane Cutler3.   

Abstract

Ticks are of great menace to animal and human health. They serve as vectors to both animals and human pathogens including Rickettsia species. Tick-borne rickettsiosis in West Africa remains incompletely understood. We determined the prevalence of tick infestation among small ruminants and molecularly described a clinically significant spotted fever Rickettsia massiliae from Rhipicephalus ticks collected from North-Central, Nigeria. A total of 352 small ruminants comprising of 152 sheep and 200 goats that were brought for slaughter at the major small ruminant slaughterhouse in Ilorin were examined for the presence of ticks. The collected Rhipicephalus species were subjected to molecular studies to detect and characterize Rickettsia massiliae. Of the small ruminants examined, 21 sheep and 46 goats were infested with ticks representing 13.82% and 23.00% respectively. Eight and nine different species of ticks were detected in sheep and goats respectively, with Rhipicephalus (Boophilus) decoloratus being the most prevalent tick species in both sheep and goats. There was a significant difference (p <0.01) in the prevalence of the different tick species collected in sheep and in goats. Based on the PCR amplification of the 23S-5S intergenic spacer (IGS), only 2 of the 142 Rhipicephalus tick samples screened for R. massiliae were positive (1.41%; 95% CI = 0.39-4.99). Rickettsia massiliae was detected from Rhipicephalus turanicus collected from sheep. Sequences obtained from the PCR carried out by amplifying Rickettsia 23S-5S IGS showed 99-100% close identity with members of the R. massiliae group. This study has for the first time confirmed the presence of spotted fever group Rickettsia massiliae from feeding ticks in Nigerian small ruminants. Further investigations to determine the possible pathogenic role of human R. massiliae infection in Nigeria would be beneficial.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35157723      PMCID: PMC8843212          DOI: 10.1371/journal.pone.0263843

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Small ruminants (sheep and goat) rearing is one of the most important aspects of agriculture in most parts of the world [1]. This has contributed greatly to the growth and development of many economies worldwide [1, 2]. Small ruminants are a major component of the ruminant industry in Nigeria, with an estimated population of sheep and goats at 22.1 million and 34.5 million, respectively [3, 4]. Small ruminants maintain an available economic and ecological niche in Nigerian agriculture, as they represent about one-third of the country’s agricultural gross domestic product [3, 5]. Sheep and goats are very vital sources of protein to man in terms of meat and milk in both developed and developing economies [4, 6], they are also useful for the provision of manure, skin, and for household income and socio-cultural purposes [4, 7]. Ticks are the second most important arthropod parasite after mosquitoes, that affect mammals and birds [8, 9]. They are ranked as the most economically important ectoparasites of livestock in the tropics, including sub-Saharan Africa [10, 11]. A number of tick species can act as vectors of pathogens causing a number of tick-borne diseases, which causes a serious impairment to the health, welfare, production, and reproduction of ruminants including sheep and goats [9, 12]. Tick-borne rickettsiosis is among the oldest known vector-borne zoonotic diseases in the world [13]. Although still largely neglected, human rickettsiosis is the second most frequent cause of febrile illnesses after malaria in travelers returning from sub-Saharan Africa [14]. Several human tick-borne Rickettsia are classified as members of the spotted fever groups (SFG). So far, the recognized species of the SFG include: R. conorii, the agent of Mediterranean spotted fever; R. rickettsii, agent of Rocky Mountain spotted fever; R. africae, agent of African tick bite fever; R. sibirica, agent of Siberian tick typhus. Others include: R. slovaca, R. honei, R. japonica, R. australis, R. akari, R. felis, R. helvetica, R. parkeri, R. peacockii as well as the newly emerging human pathogen: R. massiliae and its closely related species that make up the R. massiliae group which consists of R. massiliae, Rickettsia sp. Bar29, R. rhipicephali, R. motanensis and R. aeschlimannii [13, 15–17]. Rickettsia massiliae, although first isolated from ticks in Marseille, is a confirmed human pathogen [16]. Subsequently, human cases of spotted fever group R. massiliae infection have been reported in Europe [18]; and South America [19]. Members of the R. massiliae group have been established to be some of the Rickettsia species that are naturally resistant to rifampicin by a Phe-to-Leu mutation within the rpoB gene [20]. In Europe and Africa, members of the Rhipicephalus tick complex are the documented vectors of R. massiliae [21]. This tick transmitting zoonotic pathogens has been reported to cause fever, palpable purpuric rash on the upper and lower extremities, skin lesion (eschar) on the right leg in humans [19]. Chorioretinitis with macular involvement was also reported in human cases with R. massiliae [22]. Limited molecular studies exist describing ticks and associated Rickettsia spp. affecting cattle and dogs in Nigeria [23, 24]. In fact, only a single study reported R. massiliae in questing Rhipicephalus evertsi ticks collected from vegetations in Southern Nigeria [25]. In contrast, no such studies have been conducted on feeding ticks among small ruminants from northern Nigeria. We report our findings in small ruminants from North-Central Nigeria using sensitive molecular methods to identify the tick-borne Rickettsia species present in small ruminants.

Materials and methods

Study location

Ethical approval for the study was granted by the University of Ilorin ethical review committee (Approval number: UERC/ASN/2018/1387). This study was conducted at the Ipata municipal abattoir in Ilorin, Kwara State, North-Central Nigeria. This abattoir is one of the largest small ruminant abattoirs in the sub-region.

Collection and identification of ticks

Between May and August 2019, 352 apparently healthy small ruminants (152 sheep and 200 goats) were screened for the presence of ticks. Two hundred and forty adult ticks were collected from 67 small ruminants (21 sheep and 46 goats). Ticks were collected at the point of slaughter with the use of forceps thorough body search. The collected ticks were placed in 70% ethanol and transported to the laboratory. All of the ticks were morphologically identified by previous reported standard keys (based on: size, mouthparts, scutum, presence or absence of pale rings on legs, presence or absence eyes, etc.) as documented by Mathison and Pritt [26] and Walker et al. [27].

Deoxyribonucleic acid (DNA) extraction and PCR amplification

Genomic DNA was extracted from each tick that was morphologically identified as Rhipicephalus species (been the predominant tick species; n = 142) using the QIAamp tissue DNA kit (Qiagen, Hilden, Germany), according to the protocols prescribed by the manufacturers. Before the extraction of DNA, the individual tick was washed with phosphate-buffered saline (PBS), then air-dried for about 10 min on tissue paper and the tick was separately sliced into small pieces by using a sterile scalpel blade, afterward, it was manually homogenized with a sterile micro pestle, and resuspended in 200 μl of lysis buffer and 20 μl of proteinase K and incubated overnight at 56°C with continuous gentle shaking. The eluted ticks DNA was screened for the presence of Rickettsia by polymerase chain reaction (PCR) targeting the 350 bp DNA non-coding region of the Rickettsia 23S-5S intergenic spacer (IGS), and the PCR preparations were done as described by Kakumanu et al. [28] with modifications whereby only the secondary primer sets were used in a final volume of 25 μl. DNA from R. hoogstraali served as positive control while nuclease-free water was used as negative control in all PCR reactions. The set of oligonucleotide primers, the targeted fragment, thermocyclic protocols, and amplicon sizes (bp) for this study are summarized in Table 1.
Table 1

Rickettsia massiliae oligonucleotide primers used for PCR amplification and its thermocyclic protocols.

Primer NamePrimer sequence (5′–3′)FragmentThermocyclic protocolsAmplicon size (bp)
RCK/23-5N1F TGTGGAAGCACAGTAATGTGTG 23S-5S IGSID: 95°C / 10 min350
(No of repeat: 1)
RCK/23-5N1R TCGTGTGTTTCACTCATGCT D: 94°C / 30 sec
A: 56°C / 30 sec
E: 72°C / 90 sec
(No of cycles 35)
FE: 72°C / 10 min
HT°: 4°C

Themocyclic protocol is as used for this study.

ID = initial denaturing of DNA, D = denaturing of DNA, A = annealing of primers, E = extension of DNA, FE = finial extension of DNA, HT° = holding temperature, bp = base pair.

Themocyclic protocol is as used for this study. ID = initial denaturing of DNA, D = denaturing of DNA, A = annealing of primers, E = extension of DNA, FE = finial extension of DNA, HT° = holding temperature, bp = base pair. The resultant amplicons were electrophoresed and visualized on 1.5% agarose gel that was stained with ethidium bromide ethidium to check the quality of amplification.

Gel purification and confirmation of the 23S-5S intergenic spacer (IGS) region of Rickettsia groups

Representative positive amplicons from the PCR were purified for sequencing using the Qiaquick® PCR purification kit (Qiagen®) according to the manufacturer’s instructions. Sequencing of the PCR products and confirmation of the 23S-5S intergenic spacer (IGS) region of Rickettsia groups was carried out at DBS Genomics, Durham.

Data and phylogenetic analyses

The Statistical Package for Social Sciences (SPSS) version 23.0 (SPSS Inc., Chicago, Illinois) was used for the statistical analysis. The prevalence and corresponding 95% confidence interval (CI) were used to measure the level of infestation among sheep and goats. The Chi-square () test was used to evaluate the level of each tick species infestation on sheep and goats. Statistical significance was set at p < 0.05. Sequences obtained from this study were searched for homologous sequences in the GenBank® using BLASTn (www.ncbi.nlm.nih.gov/BLAST). Sequences were aligned by using the Clustal W program. Based on these alignments, nucleotide alignments were performed and phylogenetic analyses were conducted in MEGA version 7.0 (https://www.megasoftware.net/). The phylogenetic tree was constructed by the Maximum Likelihood method, 1000 replicates bootstrap. The sequence obtained from this study has been deposited in GenBank® under the accession number OK350078.

Results

Of the 152 sheep and 200 goats sampled, 21 sheep and 46 goats were infested with ticks, representing 13.82% and 23.00% respectively. Sixty-seven of the total 352 small ruminants sampled were infested with ticks. The prevalence of tick infestation was significantly higher in goats compared to sheep (χ2 = 4.73; p = 0.03) (Table 2).
Table 2

Prevalence of tick infestation among small ruminants in Ilorin, Nigeria.

Small ruminantsNumber sampledNumber infestedPrevalence (%)95% CI
Sheep1522113.829.00–20.00
Goats2004623.0017.56–29.21
Total 352 67 19.03 15.19–23.39

CI = Confidence interval.

χ2 (Chi Square value) = 4.73.

DF (Degrees of Freedom) = 1.

p-value = 0.03.

CI = Confidence interval. χ2 (Chi Square value) = 4.73. DF (Degrees of Freedom) = 1. p-value = 0.03. Eight different tick species (belonging to 3 genera) were detected in sheep, while 9 species (belonging to 4 genera) were detected in goats. Eighty-one ticks were collected from sheep, while 159 ticks were collected from goats. Rhipicephalus species were the most numerous species infesting sheep (55/81; 67.90%; 95% CI = 57.17–77.37) and goats (87/159; 54.72%; 95% CI = 46.93–62.33). In sheep, Rhipicephalus (Boophilus) decoloratus (n = 22; 27.16%) was the most prevalent tick species, followed by Amblyomma variegatum (n = 15; 18.52%), while Rhipicephalus lunulatus was the least prevalent with a 2.47%. Rhipicephalus (Boophilus) decoloratus and Amblyomma variegatum were the most prevalent tick species in goats, while Rhipicephalus evertsi was the least prevalent. There was a significant difference (p <0.01) in the prevalence of the different tick species collected in sheep and in goats (Table 3).
Table 3

Diversity and prevalence of tick species infesting small ruminants in Ilorin, Nigeria.

Tick speciesNumber (%) χ 2 DFp-value
Sheep (n = 81)
Rhipicephalus turanicus 5 (6.17)32.617<0.01¥
Rhipicephalus sanguineus 12 (14.81)
Rhipicephalus lunulatus 2 (2.47)
Rhipicephalus evertsi 5 (6.17)
Rhipicephalus (Boophilus) decoloratus22 (27.16)
Rhipicephalus (Boophilus) geigyi9 (11.11)
Amblyomma variegatum 15 (18.52)
Hyalomma rufipes 11 (13.58)
Goats (n = 159)
Rhipicephalus turanicus 2 (1.26)167.108<0.01¥
Rhipicephalus sanguineus 27 (16.98)
Rhipicephalus lunulatus 3 (1.89)
Rhipicephalus evertsi 1 (0.63)
Rhipicephalus (Boophilus) decoloratus51 (32.08)
Rhipicephalus (Boophilus) geigyi3 (1.89)
Amblyomma variegatum 39 (24.53)
Hyalomma truncatum 15 (9.43)
Hyalomma rufipes 18 (11.32)

n = Number of ticks collected in each small ruminant.

= Chi square.

DF = Degrees of Freedom.

¥ = Significant at p < 0.05.

n = Number of ticks collected in each small ruminant. = Chi square. DF = Degrees of Freedom. ¥ = Significant at p < 0.05. Based on the PCR amplification of the 23S-5S IGS, 2 of the 5 Rhipicephalus turanicus tick species collected from sheep were positive for R. massiliae (40.00%; 95% CI = 11.76–76.93). The molecular prevalence of R. massiliae in relation to the total number of Rhipicephalus tick (142) screened was 1.41%; 95% CI = 0.39–4.99. Sequences obtained from the PCR carried out by amplifying Rickettsia 23S-5S intergenic spacer (IGS) showed 99% close identity with members R. massiliae group. Phylogenetic analysis carried out based on the IGS showed that samples from this study clustered together with other reported R. massiliae available in the gene bank (Fig 1).
Fig 1

Molecular phylogenetic analysis inferred by Maximum Likelihood of Rickettsia massiliae based on the 350bp partial 23S-5S IGS sequences of Rickettsia species taken from the NCBI database and sequence amplified from Rhipicephalus species tick collected from Nigerian small ruminants.

Discussion

The overall ticks prevalence of 19.03% we recorded among small ruminants in this study is higher than the 8.10% total prevalence reported among small ruminants in Makurdi, North-Central Nigeria [29] and the 14.85% reported in Uli, southeast Nigeria [5]. Although a higher total prevalence of tick infestation among small ruminants has been documented in Pakistan (51.02%) [30] and Ethiopia (79.70%) [31]. The differences could be attributed to seasonal, environmental, and ecological factors. A higher prevalence of tick infestation was observed in goats compared to sheep. This may be linked to the more roaming nature of goats compared to sheep, making goats more exposed to questing ticks in vegetations. It could also be due to the high wool level of sheep, making it difficult for ticks to attach on them. Ticks are usually present in vegetations, awaiting suitable host(s) to attach onto [32], thus goats become more vulnerable due to their more roaming nature. Higher prevalence of tick infestation has been reported in goats compared to sheep in Nigeria [33] and outside Nigeria (Pakistan) [30]. Eight different species of ticks were detected among sheep in our study. This number is higher than the two, five, and six different species of ticks detected among sheep in Nigeria by Alayande et al. [34], Kaze et al. [33] and Maidala [35] respectively. Lower number of tick species (4) have been reported to infest sheep in Ethiopia [36]. In like manner, a lower number of tick species was reported among goats in Nigeria [33, 34, 35] and outside Nigeria (Ethiopia) [31] compared to the number (9) we observed in our study. These observations may suggest that tick infestation is of concern among small ruminants in the study area. Rhipicephalus was the most predominant genus of ticks infesting sheep and goats, with Rhipicephalus (Boophilus) decoloratus being the most prevalent species among both animal species in our study. Rhipicephalus species has been reported to be the most prevalent genus infesting small ruminants in Nigeria [1, 29, 33, 35] and Ethiopia [37]. The high prevalence of Rhipicephalus species among other tick genera was the reason we used the genus in our molecular study of Rickettsia massilae. The 23S-5S IGS is a conserved, non-coding region of DNA that is useful in Rickettsia molecular taxonomy [28]. Here, we are able to confirm the presence of Rickettsia massilae in ticks collected from domestic small ruminants. These tick-borne pathogens appear common in South Africa and have been reported from Cameroon [38], Central African Republic [39], and Ivory Coast [40]. The 40.00% molecular prevalence of R. massiliae among Rhipicephalus turanicus ticks collected from sheep in our study is far higher than the 3.51% of Rickettsia massiliae reported among Rhipicephalus turanicus ticks collected from sheep in China [41]. This significant level of high molecular prevalence of R. massiliae among Rhipicephalus turanicus collected from sheep in our study, calls for great public health concerns. Rickettsia massiliae is a known pathogenic Rickettsia causing spotted fever in humans [42]. Rickettsia massiliae was detected only from Rhipicephalus turanicus collected from sheep in the study area. In a similar vein, Wei et al. [41] and Ereqat et al. [43] detected R. massiliae in Rhipicephalus turanicus infesting sheep in China and the Palestinian territories respectively. Rhipicephalus turanicus is a three-host tick [27], with both transovarial and transstadial transmission of R. massiliae reported in the tick vector [44]. This shows there may be possibilities of R. massiliae infection in other animals infested by this tick species during the developmental stages of its lifecycle. There was a close relationship seen with the R. massiliae of this study and that seen in South Africa, suggesting a universal spread of the organism. Rickettsia massiliae, strain Bar29, has been previously reported to be detected in engorged female Rhipicephalus turanicus tick collected in Corsica [44] and from many other members of the Rhipicephalus ticks from different parts of the world [21]. Rickettsia massiliae was previously isolated from questing R. evertsi ticks in cattle grazing areas from Southern Nigeria [25]. However, Ricketssia massiliae has not been reported in ticks infesting highly domesticated sheep and goats kept in Nigeria. Detection of R. massiliae in feeding tick on sheep is of zoonotic concern. This is of significance because, sheep are one of the most widespread animals kept by humans in sub-Saharan Africa owing to their high fertility, short generation interval, adaptation to harsh environments, and are considered as a source of investments for rural households [45]. They are mostly kept as free-range and often tethered at night close to human dwellings. This provides a suitable environment for both contacts with disease vectors such as ticks thus facilitating their transfer of infections including Rickettsia massiliae to humans.

Conclusions

Rhipicephalus species was the most prevalent tick genus infesting small ruminants in the study area, with Rhipicephalus (Boophilus) decoloratus being the most prevalent species in both sheep and goats. This study has for the first time confirmed the presence of the spotted fever group Rickettsia massiliae from feeding ticks in Nigerian small ruminants. Rickettsia massiliae was detected in two Rhipicephalus turanicus ticks collected from sheep. So far it is not recognized as a potential human pathogen in Nigeria and is not likely to be considered during the evaluation of clinical cases. Confirmed life-threatening human cases elsewhere in the world emphasize the need to consider this diagnosis and investigate among clinical patients most at risk. Further investigations with more extensive tick samples as well as human studies determining the possible pathogenic role of human R. massiliae infection in Nigeria would be beneficial. (XLSX) Click here for additional data file. 14 Nov 2021
PONE-D-21-31323
Prevalence of tick infestation and Molecular characterization of spotted fever Rickettsia massiliae in Rhipicephalus species parasitizing domestic small ruminants in North-Central Nigeria
PLOS ONE Dear Dr. Ola-Fadunsin, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses all of the points raised during the review process. Please submit your revised manuscript by Dec 29 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Brian Stevenson, Ph.D. Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Thank you for including the following ethics statement on the submission details page: 'University of Ilorin, Nigeria.' Please amend your current ethics statement to confirm that your named institutional review board or ethics committee specifically approved this study. 3. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match. When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section. 4. We note that Figure 1 in your submission contain [map/satellite] images which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software (Google Maps, Street View, and Earth). For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright. We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission: a. You may seek permission from the original copyright holder of Figure 1 to publish the content specifically under the CC BY 4.0 license. We recommend that you contact the original copyright holder with the Content Permission Form (http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text: “I request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0 (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.” Please upload the completed Content Permission Form or other proof of granted permissions as an "Other" file with your submission. In the figure caption of the copyrighted figure, please include the following text: “Reprinted from [ref] under a CC BY license, with permission from [name of publisher], original copyright [original copyright year].” b. If you are unable to obtain permission from the original copyright holder to publish these figures under the CC BY 4.0 license or if the copyright holder’s requirements are incompatible with the CC BY 4.0 license, please either i) remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only. The following resources for replacing copyrighted map figures may be helpful: USGS National Map Viewer (public domain): http://viewer.nationalmap.gov/viewer/ The Gateway to Astronaut Photography of Earth (public domain): http://eol.jsc.nasa.gov/sseop/clickmap/ Maps at the CIA (public domain): https://www.cia.gov/library/publications/the-world-factbook/index.html and https://www.cia.gov/library/publications/cia-maps-publications/index.html NASA Earth Observatory (public domain): http://earthobservatory.nasa.gov/ Landsat: http://landsat.visibleearth.nasa.gov/ USGS EROS (Earth Resources Observatory and Science (EROS) Center) (public domain): http://eros.usgs.gov/# Natural Earth (public domain): http://www.naturalearthdata.com/ 5. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: No Reviewer #3: Partly Reviewer #4: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: No Reviewer #2: Yes Reviewer #3: Yes Reviewer #4: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: No Reviewer #4: No ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes Reviewer #4: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: It will be good to see other statistical analysis on the manuscript. The authors need to use scientific words. There must also be consistency throughout the manuscript (structure, language used). It would be good to also get result on the other ticks species that were collected, even though in low numbers but they must also be tested for the pathogen. For interest sake were there any other pathogens tested or any co infection observed. Reviewer #2: Nusirat Elelu., et al, reported in the present manuscript entitled: “Prevalence of tick infestation and Molecular characterization of spotted fever Rickettsia massiliae in Rhipicephalus species parasitizing domestic small ruminants in North Central Nigeria” a survey on tick infesting sheep and goats in the Ipata municipal. The authors have collected the tick from the animals at the local slaughterhouse. The authors report that ticks belonging the Rhipicephalus genre were the most collected from the small ruminants. PCR amplification targeting the 350 bp DNA of the Rickettsia 23S-5S intergenic spacer followed by sequencing have revealed the presence of R. massiliae in two Rhipicephalus turanicus ticks. The data collected and presented in the manuscript lack originality. All the results have been already reported in Nigeria regarding the presence of the different tick species identified in the study. In addition, R. massiliae were also reported in Nigeria. Albeit, the authors claim that the manuscript is the first report of the amplification of the DNA of R. massiliae from tick infesting small animals. Even if the primers used in the study targeting the 23S-5S region of Rickettsia were reported able to amplify the DNA of R. massiliae, the shortness of the amplicon (350 bp DNA) is a limitless to compare between related species of Rickettsia. Using other genes like gltA and rpoB were suitable to clarify the genetic position of the species amplified in these study compared to other closet species. Finally, it was suitable that the authors investigate the presence the presence of Rickettsia species in the other tick species rather than Rhipicephalus ticks. Authors can also consider a molecular survey of other related Rickettsiaceae species like Anaplasmataceae to add more valuable data. Minor revision Add tick identification methodology to the material and method section. Reviewer #3: Major comments - Why was DNA extracted only in ticks that were identified as Rhipicephalus? Number of ticks is not a scientific reason. Hyalomma ticks can also be infected with Rm. - The bootstrap values in the Rickettsia massieliae grouping is really poor. Only 40, which in most cases would not be reported. This may be due to using different lengths of sequences. Were the sequences trimmed to represent the same 350 bp piece amplified in the PCR? Also, how do the authors explain that their potential strain is closer to USA strains than strains in Tunisia. - The authors should show the alignment and blast results. The authors do not report performing any BLAST analysis, however, this should be the first step before moving into the ClustalW alignment and MEGA analysis. - Likewise, the sequences obtained after Sanger sequencing should be deposited into NCBI and the Genbank numbers should be made available to the scientific community. - The role of sheep as “reservoir” host is a stretch (see minor comments). Unless, several animals are found infected. The significance of two infected ticks in whether an animal may serve as a “reservoir” is unknown. That statement should be deleted. - Although the reviewer believes that studies in the epidemiology of diseases are very beneficial. It would be better to start by determining the actual incidence of the pathogen among ticks in the area since only two ticks were found. Minor comments - Although the issues in grammar and English are not substantial, the reviewer recommends that the authors consult a colleague for editing. - Lane 75 – rather than regarded, the Rickettsia belong to the SFG or are classified. - Be consistent, sometimes the authors use “μl” and sometimes “ul”. - Ticks tend to be seasonal. May the differences reported in this study differ from other studies due to the seasons when they were carried out? - Lane 261. Given that only two Rht were collected from sheep and the two were infected with Rm that is a 100% infection rate. By comparing to the rest of the Rhipicephalus sp in the study, the authors are underestimating the infection rates. If fact this study has much higher infection rates that the cited work. Are these sheep from a particular farm? What information is available. Were the two ticks collected from the same animal? And what other ticks were collected from this particular animal? Was it only these two ticks? If so, was the animal infected? Reviewer #4: This manuscript determined the prevalence of tick infestation among small ruminants and molecularly described a clinically significant spotted fever Rickettsia massiliae from Rhipicephalus ticks collected from North-Central, Nigeria, which means regional study of a pathogen and its host. Title and keywords title must use different words. Are the sheep where the ticks were found hairless? or not? Discuss regarding the life cycle of these ticks if it is from one or more hosts? Concerning the 23S-5S IGS Rickettsia molecular taxonomy it will be important to provide a database on the sequences found. as in the reference in line 19. García-García JC ......., review all references ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No Reviewer #4: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
26 Jan 2022 Response to reviewers Academic Editor’s comments Response: Comments by Academic Editor has been carried out. Figure 1 has been deleted. Reviewer #1: Comment 1-It will be good to see other statistical analysis on the manuscript. The authors need to use scientific words. There must also be consistency throughout the manuscript (structure, language used). It would be good to also get result on the other ticks species that were collected, even though in low numbers but they must also be tested for the pathogen. For interest sake were there any other pathogens tested or any co infection observed. Response: The manuscript has been further edited appropriately. We were unable to test other ticks species and other pathogen because of paucity of funds. Reviewer #2: Comment 1- Nusirat Elelu., et al, reported in the present manuscript entitled: “Prevalence of tick infestation and Molecular characterization of spotted fever Rickettsia massiliae in Rhipicephalus species parasitizing domestic small ruminants in North Central Nigeria” a survey on tick infesting sheep and goats in the Ipata municipal. The authors have collected the tick from the animals at the local slaughterhouse. The authors report that ticks belonging the Rhipicephalus genre were the most collected from the small ruminants. PCR amplification targeting the 350 bp DNA of the Rickettsia 23S-5S intergenic spacer followed by sequencing have revealed the presence of R. massiliae in two Rhipicephalus turanicus ticks. The data collected and presented in the manuscript lack originality. All the results have been already reported in Nigeria regarding the presence of the different tick species identified in the study. In addition, R. massiliae were also reported in Nigeria. Albeit, the authors claim that the manuscript is the first report of the amplification of the DNA of R. massiliae from tick infesting small animals. Even if the primers used in the study targeting the 23S-5S region of Rickettsia were reported able to amplify the DNA of R. massiliae, the shortness of the amplicon (350 bp DNA) is a limitless to compare between related species of Rickettsia. Using other genes like gltA and rpoB were suitable to clarify the genetic position of the species amplified in these study compared to other closet species. Finally, it was suitable that the authors investigate the presence the presence of Rickettsia species in the other tick species rather than Rhipicephalus ticks. Authors can also consider a molecular survey of other related Rickettsiaceae species like Anaplasmataceae to add more valuable data. Response: Our study appears to be the first in Northern Nigeria and not the entire Nigeria. The amount of funds we had at our disposal was responsible for the scope of the work (Rickettsia massiliae alone with other Rickettsiaceae species not been considered). Minor revision Comment 1- Add tick identification methodology to the material and method section. Response: The methodology for the identification of ticks has been included in the material and method section. Reviewer #3: Comment 1 - Why was DNA extracted only in ticks that were identified as Rhipicephalus? Number of ticks is not a scientific reason. Hyalomma ticks can also be infected with Rm. Response: The low amount of funds received was a limitation to the intended scope of the study to detect for Rickettsia massiliae in all tick species. Comment 2 - The bootstrap values in the Rickettsia massieliae grouping is really poor. Only 40, which in most cases would not be reported. This may be due to using different lengths of sequences. Were the sequences trimmed to represent the same 350 bp piece amplified in the PCR? Also, how do the authors explain that their potential strain is closer to USA strains than strains in Tunisia. Response: This has been addressed accordingly. Comment 3 - The authors should show the alignment and blast results. The authors do not report performing any BLAST analysis, however, this should be the first step before moving into the ClustalW alignment and MEGA analysis. Response: Report on BLAST analysis has been included in the manuscript. Comment 4 - Likewise, the sequences obtained after Sanger sequencing should be deposited into NCBI and the Genbank numbers should be made available to the scientific community. Response: Sequences obtained has been deposited in the GenBank and the assertion number (OK350078) has been included in the manuscript. Comment 5 - The role of sheep as “reservoir” host is a stretch (see minor comments). Unless, several animals are found infected. The significance of two infected ticks in whether an animal may serve as a “reservoir” is unknown. That statement should be deleted. Response: This statement of sheep as reservoir for Rickettsia massiliae has been deleted. Minor comments Comment 6 - Although the issues in grammar and English are not substantial, the reviewer recommends that the authors consult a colleague for editing. Response: The manuscript has been better edited. Comment 7 - Lane 75 – rather than regarded, the Rickettsia belong to the SFG or are classified. Response: This correction has been carried out. Comment 8 - Be consistent, sometimes the authors use “μl” and sometimes “ul”. Response: This has been corrected accordingly. Comment 9 - Ticks tend to be seasonal. May the differences reported in this study differ from other studies due to the seasons when they were carried out? Response: This has been stated in the discussion section. Comment 10 - Lane 261. Given that only two Rht were collected from sheep and the two were infected with Rm that is a 100% infection rate. By comparing to the rest of the Rhipicephalus sp in the study, the authors are underestimating the infection rates. If fact this study has much higher infection rates that the cited work. Are these sheep from a particular farm? What information is available. Were the two ticks collected from the same animal? And what other ticks were collected from this particular animal? Was it only these two ticks? If so, was the animal infected? Response: Two of the five Rhipicephalus turanicus collected from sheep were positive for Rickettsia massiliae and the ticks were collected from different sheep sampled at different times. This observation made has been incorporated in the manuscript. Reviewer #4: This manuscript determined the prevalence of tick infestation among small ruminants and molecularly described a clinically significant spotted fever Rickettsia massiliae from Rhipicephalus ticks collected from North-Central, Nigeria, which means regional study of a pathogen and its host. Comment 1 - Title and keywords title must use different words. Response: This has been addressed accordingly. Comment 2 - Are the sheep where the ticks were found hairless? or not? Response: No, the sheep were not hairless. Comment 3 - Discuss regarding the life cycle of these ticks if it is from one or more hosts? Response: A brief lifecycle of Rhipicephalus turanicus (the tick positive for R. massiliae) has been added in the manuscript. Comment 4 - Concerning the 23S-5S IGS Rickettsia molecular taxonomy it will be important to provide a database on the sequences found. Response: The sequences found has been deposited in the GenBank and the accession number incorporated in the manuscript. Comment 5 - as in the reference in line 19. García-García JC ......., Response: It has been checked. Comment 6 - review all references Response: The references has been reviewed. Submitted filename: Response to reviewers.docx Click here for additional data file. 28 Jan 2022 Prevalence of tick infestation and Molecular characterization of spotted fever Rickettsia massiliae in Rhipicephalus species parasitizing domestic small ruminants in North-Central Nigeria PONE-D-21-31323R1 Dear Dr. Ola-Fadunsin, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Brian Stevenson, Ph.D. Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 3 Feb 2022 PONE-D-21-31323R1 Prevalence of tick infestation and molecular characterization of spotted fever Rickettsia massiliae in Rhipicephalus species parasitizing domestic small ruminants in north-central Nigeria Dear Dr. Ola-Fadunsin: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Prof. Brian Stevenson Academic Editor PLOS ONE
  30 in total

Review 1.  Laboratory identification of arthropod ectoparasites.

Authors:  Blaine A Mathison; Bobbi S Pritt
Journal:  Clin Microbiol Rev       Date:  2014-01       Impact factor: 26.132

Review 2.  Update on tick-borne rickettsioses around the world: a geographic approach.

Authors:  Philippe Parola; Christopher D Paddock; Cristina Socolovschi; Marcelo B Labruna; Oleg Mediannikov; Tahar Kernif; Mohammad Yazid Abdad; John Stenos; Idir Bitam; Pierre-Edouard Fournier; Didier Raoult
Journal:  Clin Microbiol Rev       Date:  2013-10       Impact factor: 26.132

3.  A patient from Argentina infected with Rickettsia massiliae.

Authors:  Juan Carlos García-García; Aránzazu Portillo; Manuel J Núñez; Sonia Santibáñez; Begoña Castro; José A Oteo
Journal:  Am J Trop Med Hyg       Date:  2010-04       Impact factor: 2.345

4.  Rickettsia diversity in southern Africa: A small mammal perspective.

Authors:  Sandra Essbauer; Mirja Hofmann; Christoph Kleinemeier; Silke Wölfel; Sonja Matthee
Journal:  Ticks Tick Borne Dis       Date:  2017-11-14       Impact factor: 3.744

Review 5.  International collaborative research: significance of tick-borne hemoparasitic diseases to world animal health.

Authors:  G Uilenberg
Journal:  Vet Parasitol       Date:  1995-03       Impact factor: 2.738

6.  Gene sequence-based criteria for identification of new rickettsia isolates and description of Rickettsia heilongjiangensis sp. nov.

Authors:  Pierre-Edouard Fournier; J Stephen Dumler; Gilbert Greub; Jianzhi Zhang; Yimin Wu; Didier Raoult
Journal:  J Clin Microbiol       Date:  2003-12       Impact factor: 5.948

7.  Rickettsia africae in Amblyomma variegatum ticks, Uganda and Nigeria.

Authors:  Vincenzo Lorusso; Karolina Anna Gruszka; Ayodele Majekodunmi; Augustine Igweh; Susan C Welburn; Kim Picozzi
Journal:  Emerg Infect Dis       Date:  2013-10       Impact factor: 6.883

8.  Molecular Detection and Identification of Spotted Fever Group Rickettsiae in Ticks Collected from the West Bank, Palestinian Territories.

Authors:  Suheir Ereqat; Abedelmajeed Nasereddin; Amer Al-Jawabreh; Kifaya Azmi; Shimon Harrus; Kosta Mumcuoglu; Dimtry Apanaskevich; Ziad Abdeen
Journal:  PLoS Negl Trop Dis       Date:  2016-01-15

9.  The first detection of Rickettsia aeschlimannii and Rickettsia massiliae in Rhipicephalus turanicus ticks, in northwest China.

Authors:  Qing-Qing Wei; Li-Ping Guo; An-Dong Wang; Lu-Meng Mu; Ke Zhang; Chuang-Fu Chen; Wan-Jiang Zhang; Yuan-Zhi Wang
Journal:  Parasit Vectors       Date:  2015-12-10       Impact factor: 3.876

10.  Molecular detection of spotted fever group rickettsiae in ticks parasitizing pet dogs in Shihezi City, northwestern China.

Authors:  Wurelihazi Hazihan; Zhihui Dong; Liping Guo; Kadyken Rizabek; Dzhunysov Askar; Kulmanova Gulzhan; Mahanov Kudaibergen; Akishev Nurlan Kenjebaevich; Tolegen Talgat; Kenesbay Kairullayev; Yuanzhi Wang
Journal:  Exp Appl Acarol       Date:  2019-01-16       Impact factor: 2.132

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.