Molecular detection of spotted fever group rickettsiae in ticks parasitizing pet dogs in Shihezi City, northwestern China.

A total of 178 adult ticks were collected from 32 pet dogs from five veterinary clinics in Shihezi City, Xinjiang Uygur Autonomous Region (XUAR), northwestern China. All the ticks were identified by comprehensive morphological and genetic analyses, and rickettsiae were detected by seven Rickettsia-specific genetic markers in the ticks. The ticks collected were identified as Rhipicephalus sanguineus sensu lato. Twenty-one of the 178 samples (11.8%) were positive for rickettsiae. Among these, in 13 (61.9%) samples Candidatus R. barbariae were identified, in five (23.8%) samples R. massiliae, and in three (14.3%) samples R. conorii. This study indicates that more attention should be paid to rickettsial infection in pet dogs and their ticks, because the latter may pose an epidemiological risk for tick-borne transmission of rickettsiae to human beings.

Introduction

Ticks are among the most common ectoparasites of dogs, also involved in the transmission of a number of major diseases in both dogs and humans (Chomel 2011; Dantas-Torres and Otranto 2016). Tick-borne rickettsioses are caused by the spotted fever group rickettsiae (SFGR) of the genus Rickettsia, which contains approximately 20 species, and many of which are established or emerging human pathogens (Wood et al. 2012). Besides, more and more new SFGR species have been found across the world, as a result of range expansion of tick populations, changes in landscape and climate, and more accurate diagnostic testing (Trotta et al. 2012; Yunik et al. 2015).

Due to the emerging and re-emerging nature of tick-borne diseases in humans, increasing focus has been placed on research of ticks parasitizing domestic animals (Hiraoka et al. 2005). As in many other countries, in China the dog has become a bonded family member. Regardless the benefits of having pet dogs, pathogens carried by ticks are potentially transmissible to humans, which may represent a health risk, especially to children, elderly people and immunocompromised individuals (Dantas-Torres and Otranto 2014). To date, at least three protozoan (Theileria, Babesia and Hepatozoon) and five bacterial (Anaplasma, Ehrlichia, Rickettsia, Coxiella and Bartonella) tick-borne genera have been reported in domestic dogs around the globe (Beck et al. 2009; Brown et al. 2006; Buhariwalla et al. 1996; Camacho et al. 2001; Conrad et al. 1991; Kaewkong et al. 2014; Kamani et al. 2013; Levin et al.2012; Mokhtar et al. 2013; Yabsley et al. 2008). In Jiangxi Province, mid-eastern China, Babesia canis vogeli and Babesia gibsoni were molecularly detected in 780 dog ticks (749 Rhipicephalus sanguineus, 16 Haemaphysalis campaulata and 15 Haemaphysalis verticalis), while all sampled dog ticks were negative for rickettsial agents (Zheng et al. 2017). In Xinjiang Uygur Autonomous Region (XUAR), northwestern China, rickettsial agents were prevalent in ticks infesting both domestic animals and wildlife (Guo et al. 2015, 2016). However, there is limited knowledge on the species of ticks infesting dogs. Here a molecular investigation was carried out for rickettsial agents in pet dog ticks.

Materials and methods

Collection and identification of ticks

In 2016–2017, ticks were sampled from 32 pet dogs presented at five veterinary clinics with symptoms of depression, weight loss and anorexia in Shihezi City (483 m above sea level, at 44°268129ʹN 86°0627148ʹE), the northwestern China. The ticks were placed in tubes with 75% ethanol and stored at − 80 °C. All of the ticks were identified morphologically according to previous reports (Filippova 1997; Dantas-Torres et al. 2013a, b). Twenty-nine representative ticks, with 4–6 ticks at each veterinary clinic, were used to analyze tick species and genetic diversity based on partial mitochondrial 16S rRNA (460 bp), 12S rRNA (400 bp) and coxI (889 bp) gene sequences (Szabó et al. 2005; Chen et al. 2014).

DNA extraction and molecular detection

After detailed morphological analysis, genomic DNA was extracted from each individual tick using the TIANamp Genomic DNA Kit (TianGen, Beijing, China). The ticks were mechanically crushed twice in sterile water for 15 min and then dried on sterile paper, suspended in 200 µl tissue lysis buffer and 40 µl proteinase K (100 µg/ml), and incubated overnight at 56 °C. The final elution volume was 60 µl. Subsequently, the polymerase chain reaction (PCR) technology was used to detect rickettsial agents with seven genetic markers for DNA fragments [434-, 1332-, 1060-, 488-, 920-, 491-, and 812-bp products of the genes encoding the 17 kilodalton antigen (17-kDa), 16S rRNA(rrs), citrate synthase (gltA), surface cell antigen 1 (sca1), PS120-protein-encoding gene (gene D), and outer membrane proteins A and B (ompA and ompB)] (Anstead and Chilton 2013; Chilton 2013; Sekeyova et al. 2001; Wei et al. 2015). (Table 1). Rickettsia aeschlimannii from Rh. turanicus and double-distilled water were used, respectively, as positive and negative controls (Wei et al. 2015). The PCR products were purified using the TIANgel Midi Purification Kit (TIANGEN, Beijing, China), and then subjected to sequencing (BGI, Shenzhen, China). Phylogenetic analyses were conducted used MEGA version 6.0 based on the 17 kDa-rrs-gltA-ompA-ompB-gene D concatenated sequence data of the rickettsiae by Maximum Likelihood (ML) and Neighbor-Joining (NJ) methods (Tamura et al. 2013).

Table 1

Primers used in this study for amplifying tick mitochondrial genes and Rickettsia spp. in ticks from pet dogs, in Shihezi City, northwestern China

Target	Gen	Primer (reference)	Sequences (5′–3′)	Fragment length (bp)
Tick	16S rRNA	T-16S(F)T-16S(R) (Chen et al. 2014)	CTGCTCAATGATTTTTTAAATTGCTGTGGCCGGTCTGAACTCAGATCAAGT	460
	12S rRNA	12S(F)12S(R) (Szabó et al. 2005)	AAACTAGGATTAGATACCCTATTATTTTAGCTATGTAACGACTTATCTTAATAAAGAGTG	400
	coxI	TY-J-1,449C1-N-2,312 (Chen et al. 2014)	AATTTACAGTTTATCGCCTCATACAATAAAGCCTAATA	889
Rickettsia spp.	rrs	R-16S(F)R-16S(R) (Anstead and Chilton 2013)	ATCAGTACGGAATAACTTTTATGCCTCTTGCGTTAGCTCAC	1284
	17-kDa	17-kDa(5F)17-kDa(3R)17-kDa(1F)17-kDa(2R) (Anstead and Chilton 2013)	GCTTTACAAAATTCTAAAAACCATATATGTCTATCAATTCACAACTTGCCGTTGCTCTTGCAACTTCTATGTTCATTGTTCGTCAGGTTGGCG	434
	gltA	gltA(F)gltA(R) (Anstead and Chilton 2013)	ATGACCAATGAAAATAATAATATTGCAAAAAGTACAGTGAACA	1078
	sca1	sca1(F)sca1(R) (Anstead and Chilton 2013)	GGTGATGAAGAAGAGTCTCCTCTTTAAAATTATGTTCTAC	657
	gene D	gene D(F)gene D(R)(Sekeyova et al. 2001; Wei et al. 2015)	CGGTAACCTAGATACAAGTGATATAAGCTATTGCGTCATCTC	920
	ompA	ompA(F)ompA(R) (Anstead and Chilton 2013)	ATGGCGAATATTTCTCCAAAAAGTGCAGCATTCGCTCCCCCT	530
	ompB	ompB(F)OmpB(R) (Anstead and Chilton 2013)	TACTTCCGGTTACAGCAAAGTAAACAATAATCAAGGTACTGT	812

Results

A total of 178 adult ticks (76 males and 102 females) were collected and morphologically identified as Rh. sanguineus sensu lato. (Fig. 1). The sequencing data from the 29 representative ticks confirmed the morphological results based on Basic Local Alignment Search Tool (BLAST) analyses of 16S rRNA, 12S rRNA and cox1. Rhipicephalus sanguineus s.l. in this study had 93.3–93.8% pairwise nucleotide sequence identity to genome sequences of the reference strains Rh. sanguineus (GenBank: JX416325) for three genes analyzed. Our data were deposited in the GenBank database (16SrRNA: KY069269, 12S rRNA: KY069270, and cox1: KY069271).

Fig. 1

Morphological analysis of Rhipicephalus sanguineus sensu lato collected from pet dogs. a Male, dorsal; b male, ventral; c female, dorsal; d female, ventral

Twenty-one of the 178 samples (11.8%) were positive for SFG rickettsiae. Of which, thirteen (61.9%) were identified as Candidatus R. barbariae, five (23.8%) as R. massiliae, and three (14.3%) as R. conorii subsp. indica. (Additional Table 2; Fig. 2). Rickettsia massiliae and R. conorii subsp. indica had 99.8–100% and 99.3–100% pairwise nucleotide sequence identities to the corresponding sequences of the reference strains R. massiliae MTU5 (GenBank: CP000683) and R. conorii str. Malish 7 (GenBank: AE006914) for seven genetic markers, respectively. Candidatus R. barbariae in dog ticks showed 100% pairwise nucleotide sequence identity to the corresponding sequences of Candidatus R. barbariae in the flea Vermipsylla alakurt (according to the seven genetic markers, in GenBank: KT284715, KU645283, KT284716, KU645284, KT284717, KT284718, KU645286, respectively). Detailed similarities of the sequences in this study are shown in Additional Table 1. All the sequences of Rickettsia spp. obtained in this study were deposited in GenBank [17 kDa: KY069262–KY069264; rrs: KY069266–KY069268; gltA: KY069259–KY069261; sca1: KY069254–KY069255, KY069265; ompA: KY069256–KY069258; ompB: KY069248–KY069250; gene D: KY069251–KY069253].

Fig. 2

Phylogenetic relationships of Rickettsia spp. inferred from 17 kDa-rrs-gltA-ompA-ompB-gene D using the Maximum-Likelihood method (left) and Neighbor-Joining method (right). The bootstrap consensus tree inferred from 1000 replicates and bootstrap replicates with value less than 50% were collapsed. Phylogenetic analyses were conducted in MEGA6.0. Rickettsiae obtained in this study were marked as “▲”, and sequences for rickettsia species retrieved from the GenBank database, Rickettsia bellii was used as the outgroup (see Additional Table 2).The scale bar represents the inferred substitutions per nucleotide site

Discussion

In the present study, ticks collected from pet dogs were used to identify rickettsial agents in Shihezi City, northwestern China. Candidatus R. barbariae, R. conorii subsp. indica and R. massiliae were molecularly detected. Importantly, these rickettsial agents were shown to be present both in pet dog ticks (reported here) and in sheep ticks (Guo et al 2016), which data raise both veterinary and public health concerns in northwestern China.

Candidatus R. barbariae was originally reported from Rhipicephalus bursa ticks in Portugal (de Sousa et al. 2006), and later confirmed and characterized by five genetic markers (gltA, ompA, ompB, sca4 and rrs) from Rh. turanicus in Italy (Mura et al. 2008). Subsequently, Candidatus R. barbariae was also detected in Rh. turanicus from Cyprus and in Rh. sanguineus from Israel (Chochlakis et al. 2012; Waner et al. 2014). In 2016, our investigation revealed that Candidatus R. barbariae is present in Vermipsylla alakurt fleas and Rh. turanicus ticks from grazing sheep (Guo et al. 2016; Zhao et al. 2016). Here, molecular evidence of Candidatus R. barbariae is provided in pet dog ticks (Rh. sanguineus s.l.).

The other two Rickettsia species, R. conorii subsp. indica and R. massiliae, had lower rates of positivity [1.7% (3/178) and 2.8% (5/178), respectively] compared to the data from grazing sheep (Wei et al. 2015; Guo et al. 2016), which might be explained by differences in tick numbers per host, as well as by varying susceptibility to rickettsiae among host species. To the best of our knowledge, however, the clinical cases were caused by R. conorii subsp. indica and R. massiliae (Cavagnaro et al. 2008; Vitale et al. 2006). Although there is no documented clinical case of rickettsia infection from pet dog ticks in China to date, more measures should be carried out to prevent its risk to dog owners, taking into account the synanthropic nature of Rh. sanguineus s.l. A diversity of tick-borne pathogens, including Anaplasma, Babesia, Borrelia, Ehrlichia and Theileriai spp. has recently been molecularly detected in Russia (Livanova et al. 2018). This, together with the present findings, draw the attention to not-yet known risks associated with tick-borne rickettsiae in several regions of Asia.

Conclusions

Three SFGR members, the R. conorii subsp. indica, Candidatus R. barbariae and R. massiliae, were molecularly detected in Rh. sanguineus s.l. ticks from pet dogs in Shihezi City, northwestern China. The study expands the range of tick-borne pathogens in pet dog ticks in Central Asia. Effective measures should be taken into consideration to prevent tick-borne transmission of rickettsiae to human beings.

Below is the link to the electronic supplementary material.

Supplementary material 1 (DOCX 29 KB)

Supplementary material 2 (DOC 72 KB)