Literature DB >> 35126731

Identification of the hub genes and transcription factor-miRNA axes involved in Helicobacter pylori-associated gastric cancer.

Peng Zhao1, Xianxiong Ma2, Jiancheng Cheng3, Hengyu Chen4,5, Lei Li6.   

Abstract

It has been previously reported that transcription factor-microRNA (TF-miRNA) axes play a significant role in the carcinogenesis of several types of malignant tumor. However, there is a lack of research into the differences in the mechanism of Helicobacter pylori (HP)-positive [HP(+)] and HP-negative [HP(-)] gastric cancer. The aim of the present study was to identify the hub genes and TF-miRNA axes, and to determine the potential mechanisms involved in HP-associated gastric cancer. HP-associated mRNA and miRNA data, as well as the corresponding clinical information, was downloaded from The Cancer Genome Atlas database. Differentially expressed genes (DEGs) and DE miRNAs (DEMs) were then identified from the HP(+) and HP(-) cancer mRNA and miRNA datasets, respectively. Subsequently, gene set enrichment analysis and the protein-protein interaction (PPI) networks were investigated using the ClusterProfiler packages. Lastly, TF-miRNA-DEG networks were constructed using the miRWalk online tool. A total of 1,050 DEGs and 13 DEMs were identified from the normalized mRNA and miRNA expression datasets, respectively. In addition, 180 Gene Ontology terms and 30 Kyoto Encyclopedia of Genes and Genomes pathways were found to be enriched, while 6 hub genes were identified from the PPI analysis. Furthermore, 7 TF-miRNA interactions and 181 TF-miRNA-DEG axes were constructed using an integrated bioinformatics approach, while 2 TF-miRNA interactions (ZEB1-miRNA-144-3p and PAX2-miRNA-592) were confirmed using reverse transcription-quantitative PCR in samples from enrolled patients. Moreover, the ZEB1-miRNA-144-3p axis was further validated based on dual luciferase reporter assay results. In summary, an integrated bioinformatics approach was used to screen the significant molecular and regulatory axes, which may provide a novel direction to investigate the pathogenesis of gastric cancer associated with HP. Copyright: © Zhao et al.

Entities:  

Keywords:  Helicobacter pylori; The Cancer Genome Atlas; bioinformatics; gastric cancer; microRNA; transcription factor

Year:  2022        PMID: 35126731      PMCID: PMC8805177          DOI: 10.3892/ol.2022.13209

Source DB:  PubMed          Journal:  Oncol Lett        ISSN: 1792-1074            Impact factor:   2.967


Introduction

Helicobacter pylori (HP) has been classified as a group I carcinogen by The International Agency for Research on Cancer (1). A previous study revealed that chronic gastritis and gastric ulcers were caused by HP, which may be a factor to increase the risk of gastric cancer (2). However, the exact mechanism of how HP is involved in the development of gastric cancer has not been elucidated. MicroRNAs (miRNAs/miRs) are short non-coding RNAs that can regulate the translation of genes by binding to the 3′-untranslated regions of the target gene (3). miRNAs are involved in various important biological processes in the development of gastric cancer, such as cell proliferation, invasion and metastasis (4). Previous studies have found that miRNAs play significant roles in the regulation of tumor biology (5–7), and in the regulation of the physiology and pathology of the immune system (8). Some miRNAs serve as therapeutic targets or as prognostic biomarkers of gastric cancer (9,10). For example, poor prognosis and advanced features in patients with non-small cell lung cancer could be predicted by the downregulation of miR-503 expression (11). Transcription factors (TFs) are significant regulatory factors that can serve as oncogenes or tumor suppressors by binding to the target genes in the gene expression pathway (12,13). TFs serve as regulators that act at the transcriptional level, while miRNAs function at the post-transcriptional level (3,12). A large number of studies (14–16) have shown that transcriptional and post-transcriptional regulators of gene expression interact with each other in the molecular pathology of numerous diseases, such as the role of FBL in epithelial mesenchymal transition and cardiogenesis (17). miRNAs and TFs are regulated by each other in feedback loops (17). Previous studies have reported that miRNAs are regulated by TFs (TF-miRNA regulation); for example, the identification of a TF-miRNA network was found in esophageal adenocarcinoma using bioinformatics analysis (18). However, associations between the TF-miRNA-mRNA network and HP-associated gastric cancer have not been investigated. The aim of the present study was to identify the hub genes and TF-miRNA axes, and to identify the potential mechanisms involved in HP-associated gastric cancer.

Materials and methods

Patients and tissue specimens

A total of 30 tumor tissues [10 HP-negative (−) and 20 HP-positive (+)] were collected from patients with gastric cancer who underwent gastrectomy at the Department of Gastrointestinal Surgery, Union Hospital of Huazhong University of Science and Technology (Wuhan, China). All procedures were approved by the Ethics Committee of the Union Hospital of Huazhong University of Science and Technology, and conducted according to Declaration of Helsinki principles. Prior written and informed consent was obtained from each patient or their guardians. The clinicopathological information of the patients is shown in Table SI.

Data sourcing and processing

Genes and miRNA expression profiles, as well as the corresponding clinical information, from patients with gastric cancer, were downloaded from The Cancer Genome Atlas (TCGA) database using TCGA biolinks package (19). Samples containing clear HP infection information were included. Samples with unavailable HP infection information, samples of paracancer tissue and samples of normal tissue were removed. The HP status of the tissue samples from the enrolled patients was confirmed using a 13C-urea breath test with 75 mg urea (UREA 13C breath test Heliforce kit; Beijing Richen-Force Science & Technology Co. Ltd.). A total of 141 gastric samples [16 cases were HP(+) and 125 cases were HP(−)] were selected for the following bioinformatics analysis. The differentially expressed genes (DEGs) with significant differential expression between the HP(+) and HP(−) groups were selected. A gene would be selected using the following conditions: i) Expression level 1.2 times higher in 20% of the total number of samples compared with the median expression level in the total number of samples; and ii) the variance in the expression level in every sample was higher than the median level. Subsequently, log2 transformation and Z correction were performed to normalize the expression value of each gene.

Identification of DEGs and DE miRNAs (DEMs)

Limma package (20) was applied to compute DEGs and DEMs based on the aforementioned normalized mRNA and miRNA expression data. Bayes test was used to identify DEGs with ≥2 fold-change and a P-value cutoff of 0.05 was defined as statistically significant.

Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of DEGs

Genes and gene products were annotated using GO analysis, which is a common and useful method for identifying characteristic biological attributes of transcriptome data or from high-throughput genomic data. KEGG serves as a knowledge base for systematic analysis of gene functions, and linkage between genomic information and higher-order functional information. Comprehensively mapping a set of genes to the associated biological annotation is an important foundation for the success of the gene functional analysis of any high-throughput data. KEGG pathway analysis and GO enrichment was performed using the ClusterProfiler package (21) to analyze the DEGs at the functional level. P<0.05 was considered to indicate a statistically significant difference.

Construction and integration of the PPI network

The PPI network was investigated using the Search Tool for the Retrieval of Interacting Genes (STRING) online database (22). STRING (v11.0) was used, which covers 24,584,628 proteins from 5,090 organisms. The DEGs were mapped using the STRING database to determine the interactive associations among DEGs, and then, the experimentally validated interactions with a significant combined score >0.4 were selected for further analysis. PPI networks were then constructed with the CytoScape software (v3.6.1) (23). Subsequently, the sub-network modules were screened using the plug-in molecular complex detection (MCODE) in CytoScape. The following screening criteria was used: MCODE score >3 and node number >6. In addition, the function and pathway enrichment analysis of DEGs in the sub-module was also determined. P<0.05 was considered to indicate a statistically significant difference.

Construction of TF-miRNA-gene axis

The TFs and DEMs were selected to construct TF-miRNA regulatory networks using the miRWalk2.0 database (24). The TF-miRNAs were identified as hub interactions, as predicted by the miRWalk2.0 database, TargetScan6.2 database (25), miRanda database (26) and RNA22 database (27) simultaneously. The miRNA-DEG regulatory networks were constructed across the aforementioned method. Finally, TF-miRNA-gene axes were constructed to identify a transcriptional regulation model and reveal significant networks involved in HP-associated gastric cancer.

Cell culture

The gastric cancer MKN45 cell line was purchased from the American Type Culture Collection. The MNK-450 cells were cultured in RPMI 1640 medium (HyClone; Cytiva) with 10% FBS and 1% penicillin-streptomycin under a humidified atmosphere with 5% CO2 at 37°C.

Validation of TF and targeted DEMs

DE TFs and DEMs were confirmed using reverse transcription-quantitative PCR (RT-qPCR) in samples from enrolled patients. To confirm the results from the integrated bioinformatics analysis, 20 fresh HP(+) and 10 fresh HP(−) gastric cancer tissues were collected and examined by experienced pathologists at the Department of Gastrointestinal Surgery, Union Hospital of Huazhong University of Science and Technology between September 1 and December 30, 2019. The tissue samples were frozen and stored immediately in liquid nitrogen following surgical resection. Total cellular RNA was extracted from the gastric samples using RNAiso Plus (Takara Bio, Inc.). For miRNA quantification, synthesis of cDNA was performed using the PrimeScript™ RT reagent kit (GeneCopoeia, Inc.) according to the manufacturer's protocols. The purity and concentration of RNA was measured using a Nanodrop2000 (Thermo Fisher Scientific, Inc.). qPCR was performed using the Real-time PCR Detection System (SLAN; Shanghai Hongshi Medical Technology, Co., Ltd.) and the SYBR Premix Ex Taq II kit (Takara Bio, Inc.). The conditions of PCR cycling were as following: Activation of TaqMan at 95°C for 10 min, and then 40 cycles of denaturation at 95°C for 10 sec, and annealing/extension at 60°C for 60 sec. Relative miRNA expression levels were normalized to U6, while mRNA was normalized to GAPDH, and quantification was performed using the 2−ΔΔCq method (28). The primer sequences are shown in Table I. R language (https://www.r-project.org/) was used to analyze the RT-qPCR data. All reactions were performed in triplicate.
Table I.

Sequences of reverse transcription-quantitative PCR primers.

PrimersSequences (5′-3′)
HIC1
  ForwardGCGCCGCTGCTCCCCTCTTTGTG
  ReverseACCCAGGCCCGGCTCGTGCTTCAT
LHX3
  ForwardGCCCAGCCCAGCCCAGCATAGC
  ReverseGAGAAGGGGCGCCAGGCATTTTTG
LMX1B
  ForwardGGGGGTGCTGCTGGGCTCCGACTG
  ReverseCCCCGCTGCCCTTGCTCTGACTGC
MAFB
  ForwardGCTCGGCGCCCAAATCTCATCAGT
  ReverseCGGTTTGGCGGGGCGGGTATTTA
PAX2
  ForwardGGGCGCGGGCGGAGCACAC
  ReverseGGGTAGGGGCCGGCCGTTCACAA
SLA2
  ForwardTCATCCGGGAGAGCCAGACCAG
  ReverseGGGCCTAGGCATCATCCAAAGA
U6
  ForwardCTCGCTTCGGCAGCACA
  ReverseAACGCTTCACGAATTTGCGT
hsa-miR-144-3p
  ForwardGCGCGCGACAGTATAGATGAT
  ReverseCAGTGCGTGTCGTGGAGT
hsa-miR-3176
  ForwardGCGACTGGCCTGGGAC
  ReverseCAGTGCGTGTCGTGGAGT
hsa-miR-592
  ForwardGCGCTTGTGTCAATATGCGA
  ReverseCAGTGCGTGTCGTGGAGT
hsa-miR-659
  ForwardGCGAGGACCTTCCCTGAAC
  ReverseCAGTGCGTGTCGTGGAGT
ZEB1
  ForwardCGCAGTCTGGGTGTAATCGT
  ReverseTTGCAGTTTGGGCATTCATA
GAPDH
  ForwardTTAAAAGCAGCCCTGGTGAC
  ReverseTGTGGTCATGAGTCCTTCCA

Western blot analysis

Tissue lysates were extracted using the RIPA lysis buffer (Beyotime Institute of Biotechnology) supplemented with 1% phenylmethylsulfonyl fluoride (Sigma-Aldrich; Merck KGaA) according to the manufacturer's instructions. The protein concentration was measured using the Pierce bicinchoninic acid protein assay kit (Thermo Fisher Scientific, Inc.). The same amount of protein (30 µg) from all patients with gastric cancer was separated on 10% gels using SDS-PAGE (Bio-Rad Laboratories, Inc.) and transferred onto a PVDF membrane (EMD Millipore) After that, the membrane was blocked for 1 h with 5% non-fat milk and 1X TBST (0.05%) at room temperature. Next, the primary antibodies were used to incubate the membrane at 4°C overnight followed by incubation with secondary antibodies for 2 h at room temperature. β-actin was used as a loading control. The following primary antibodies were used: Rabbit anti-ZEB1 (1:1,000; cat. no. 021544-1-AP; ProteinTech Group, Inc.), rabbit anti-LHX3 (1:1,000; cat. no. 20745-1-AP, ProteinTech Group, Inc.), rabbit anti-PAX2 (1:2,000; cat. no. ab79389; Abcam) and mouse anti-β-actin (1:5,000; cat. no. 60008-1-Ig; ProteinTech Group, Inc.). Anti-mouse IgG (1:5,000; cat. no. ab208001; Abcam) and anti-rabbit IgG (1:5,000; cat. no. ab207999; Abcam) were used as the secondary antibodies. Proteins bands were visualized using electrochemiluminescence (ECL Western Blotting Substrate; cat. no. 32106; Pierce; Thermo Fisher Scientific, Inc.) and analyzed using the ChemiDoc™ XRS Molecular Imager 3.0 system (Bio-Rad Laboratories, Inc.).

Transfection

ZEB1-small interfering (si)RNA (siZEB1), PAX2-siRNA (siPAX2) and corresponding negative control (NC-siRNA) (Table II) were purchased from Guangzhou RiboBio Co., Ltd. ZEB1 and PAX2 pcDNA3.1 plasmid (ZEB1 and PAX2 overexpression plasmid) and the control vector were purchased from Shanghai GeneChem Co., Ltd. All siRNAs were transfected at a final concentration of 50 nmol/l, and the plasmid was transfected at final concentration using 1.6 µg for a 12-well plate. Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) was used for cell transfection at 37°C for 48 h according to the manufacturer's instructions and then subsequent experiments were immediately performed. The promoter reporter construct (ΔE-box) was constructed with the QuikChange site-directed mutagenesis kit (Stratagene; Agilent Technologies, Inc.).
Table II.

Sequences of siRNAs.

siRNA targetsSequences (5′-3′)
PAX2-siRNA
  SenseCGACUAUGUUCGCCUGGGATT
  AntisenseUCCCAGGCGAACAUAGUCGGG
ZEB1-siRNA
  SenseGCGGCGCAAUAACGUUACAAA
  AntisenseUGUAACGUUAUUGCGCCGCGG
NC-siRNA
  SenseUAUAAGUGUGACUACUAACTT
  AntisenseGUUAGUAGUCACACUUAUATT

siRNA, small interfering RNA; NC, negative control.

Luciferase reporter assay

The JASPAR database (http://jaspar.genereg.net) was used to predict the binding region of the miRNA-144 according to the manufacturer's protocols (29). To determine whether ZEB1 targeted the promoter region of the miR-144 gene, using Lipofectamine 3000, the gastric adenocarcinoma MKN-45 cell line was transfected with the recombinant pGL4.1 plasmid (Promega Corporation), including the wild-type or mutant miR-144 gene promoter, empty vector, ZEB1 overexpression plasmid and siZEB1 and NC (siNC). The empty vector and siNC were used as the negative controls for the luciferase reporter gene assay. After 48 h, firefly and Renilla luciferase activities were detected using the dual-luciferase reporter assay system (Promega Corporation). Renilla luciferase activity was used for normalization.

Statistical analysis

Statistical analyses were performed applying R software (4.0.0; http://www.r-project.org/) unless otherwise noted. All results are presented as the mean ± SD and were assessed via Graphpad Prism 7 (Graphpad Software, Inc.). The significance of differences between two groups was evaluated via Student's unpaired t-test, and the comparison among multiple groups was conducted via one-way ANOVA followed by the LSD post hoc test. All experiments were performed 3 times. P<0.05 was used to indicate a statistically significant difference.

Results

Identification of DEGs and DEMs

There were 24,991 gene and 1,881 miRNA expression profiles from 141 gastric cancer samples obtained from TCGA mRNA and miRNA datasets, respectively. A total of 1,050 genes and 13 miRNAs were found to be DE in the HP-associated gastric cancer samples, as shown in Fig. 1. The top 20 DEGs are shown in Fig. 2A, while the 13 DEMs are listed in Fig. 2B.
Figure 1.

Flow chart of the bioinformatics analysis process. DEG, differentially expressed gene; TCGA, The Cancer Genome Atlas; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; PPI, protein-protein interaction; HP, Helicobacter pylori; TF, transcription factor; miRNA, microRNA; RT-qPCR, reverse transcription-quantitative PCR.

Figure 2.

Expression heatmap of top (A) 20 differentially expressed genes and (B) 13 differentially expressed miRNAs based on The Cancer Genome Atlas Helicobacter pylori-associated mRNA and miRNA expression data. miRNA, microRNA.

Gene set enrichment analysis

All of the 1,050 DEGs identified, which were based on the normalized mRNA expression data, were screened for gene set enrichment analysis. A total of 180 significant enrichments were identified using the GO analysis, including in the three main categories of biological process, cell component and molecular function. The top three GO terms were ‘T cell activation’, ‘leukocyte proliferation’ and ‘leukocyte migration’. The top 12 GO terms according to the P-values and the top 5 GO enrichments with the gene linkages are displayed in Fig. 3A and B, respectively. Pathway analysis using the KEGG database found that these genes were significantly enriched in ‘Staphylococcus aureus infection’, ‘systemic lupus erythematosus’ and ‘hematopoietic cell lineage’. The top 12 KEGG pathways and the top 5 pathways with the gene linkages are displayed in Fig. 3C and D, respectively.
Figure 3.

Gene set enrichment analysis and PPI analysis. (A) The top 10 GO enrichment terms for the 1,050 DEGs. The original P-value was transformed to ‘-log(P-value)’ to plot the curve. (B) The top 5 GO enrichment terms with their gene linkages. (C) The top 10 enriched KEGG pathways for the 1,050 DEGs. (D) The top 5 KEGG pathways with their gene linkages. (E) Construction of the PPI network of the top 400 DEGs associated with Helicobacter pylori-related gastric cancer. The big nodes represented the hub genes. (F) The top 2 sub-modules from the PPI network. PPI, protein-protein interaction; GO, Gene Ontology; DEGs, differentially expressed genes; KEGG, Kyoto Encyclopedia of Genes and Genomes.

PPI network and sub-network analyses

The top 400 DEGs were imported into the STRING database to identify the interactive association between the proteins. Only the genes with a combined score >0.4 were selected to create the network. Finally, 1,434 pairs of protein associations were identified following removal of the unmatched genes. In addition, genes with >60 edges were considered as hub genes. A total of 6 significant genes were identified based the annotated information from the STRING database: TYROBP, CCR5, C3AR1, LCP2, CCL5 and SPI1 (Fig. 3E). A total of 252 nodes and 1,434 edges were analyzed using the plug-in, MCODE. The top 2 significant modules were selected for the gene functional annotation involved in the modules. Enrichment analysis showed that the genes in those 2 modules were primarily associated with phytochelatin metabolic process and positive regulation of apoptosis (Fig. 3F).

Construction of the TF-miRNA-mRNA network

Using the mRNA and miRNA expression data from TCGA database, 1,050 DEGs and 13 DEMs were identified. From these, 31 DE TFs were identified from the Trrust database (Fig. 4A). Next, the regulatory associations were constructed using the 31 TFs and 13 miRNAs and the miRWalk database, and finally, 7 TF-miRNA pairs (including 7 genes and 4 miRNAs) were constructed (Fig. 4B). Subsequently, 107 pairs of miRNA-DEG interactions were also constructed using the 4 miRNAs and 1,050 DEGs, and the miRWalk database (Fig. 4C). Combining the aforementioned regulatory associations, 181 TF-miRNA-DEG regulatory associations were finally identified (Fig. 4D) (Table III).
Figure 4.

(A) A Venn diagram illustrating the overlap between the 1,050 DEGs and 785 TFs from the Trrust database. (B) A total of 7 TF-miRNA interactions were found. The blue and yellow nodes represent the TFs and their targeted miRNAs, respectively. (C) The 107 miRNA-DEG interactions were constructed. The yellow and blue nodes represent the miRNA and their targeted DEGs, respectively. (D) The 181 TF-miRNA-DEG networks are shown. Yellow, red and blue nodes represent the TFs, miRNAs and DEGs, respectively. TF, transcription factor; miRNA, microRNA; DEGs, differentially expressed genes.

Table III.

Regulatory relations of 181 TF-miRNA-differentially expressed genes.

TFmiRNATarget gene
HIC1hsa-miR-659ADCY5, CRHR1, CYP1B1, DPYSL3, KCNMA1, MYH11, PRKG1, SFRP1, SLIT2, TLR7, GPR88, CYS1, NRK, C7, HIC1, KCNC1, MYLK, NFATC4, CXCL12, USH2A, SDPR, MPDZ, MAFB, CD96, SMOC2, TNFAIP8L2, MACC1
LHX3hsa-miR-592C7, CYP1B1, PAX2, CDK14, DAAM2, PPP1R16B, GREM1, HAVCR2, SHE, PODN, ZCCHC24, CXCL9, PFKFB2, RAG2, TOP2A, USH2A, LHX3, MS4A4A, RHPN2, GIMAP8, CYS1, SKA1
LMX1Bhsa-miR-3176CD6, STOM, KCNC1, LMX1B, RAC2, CXCL12, TIMP3, TLL1, CD300A, RASD2, GLIPR2, ZBTB7C, CD4, CRHR1, FKBP5, MYH11, PCOLCE, SLC22A14, CELF2, ADAP1, LZTS1, PPP1R16B, RGMA, SLA2, GLIS2
MAFBhsa-miR-659ADCY5, CRHR1, CYP1B1, DPYSL3, KCNMA1, MYH11, PRKG1, SFRP1, SLIT2, TLR7, GPR88, CYS1, NRK, C7, HIC1, KCNC1, MYLK, NFATC4, CXCL12, USH2A, SDPR, MPDZ, MAFB, CD96, SMOC2, TNFAIP8L2, MACC1
PAX2hsa-miR-592C7, CYP1B1, PAX2, CDK14, DAAM2, PPP1R16B, GREM1, HAVCR2, SHE, PODN, ZCCHC24, CXCL9, PFKFB2, RAG2, TOP2A, USH2A, LHX3, MS4A4A, RHPN2, GIMAP8, CYS1, SKA1
SLA2hsa-miR-3176CD6, STOM, KCNC1, LMX1B, RAC2, CXCL12, TIMP3, TLL1, CD300A, RASD2, GLIPR2, ZBTB7C, CD4, CRHR1, FKBP5, MYH11, PCOLCE, SLC22A14, CELF2, ADAP1, LZTS1, PPP1R16B, RGMA, SLA2, GLIS2
ZEB1hsa-miR-144-3pCAV2, EFEMP1, MAP1B, CXCL11, CXCL12, SFRP1, ZEB1, KIF14, AKT3, CELF2, PPP1R16B, RAB9B, NAV3, ANTXR2, SHE, AXL, DSG2, CXCL9, MSN, NAP1L3, TNS1, SDPR, MPDZ, LEFTY1, CPED1, CHRM2, KCNC1, NFATC4, DAAM2, APOLD1, BOC, CYP2U1

TF, transcription factor; miRNA/miR, microRNA.

Confirmation using RT-qPCR and western blot analysis, and ZEB1-miRNA-144 axis validation

RT-qPCR was used to investigate the expression level of the 7 TF-miRNAs (Table III). It was revealed that the expression level of 3 genes and 2 miRNAs were dysregulated [Figs. 5 and 6; HP(+) is represented by the case group and HP(−) is represented by the control group]. Among these genes and miRNAs, the expression levels of PAX2, LHX3, miRNA-144-3p, miRNA-592 were downregulated, while that of ZEB1 was upregulated, which was consistent with the screening results. Furthermore, western blot analysis was used to determine the protein expression levels of the associated proteins in the normal (HP(−) tissues, as well as the tumor groups, and the clinicopathological information of the patients with gastric cancer is shown in Table SI. LHX3 was found to be downregulated and ZEB1 was upregulated, while there was no difference in PAX2 expression levels (Fig. 6H). To verify whether ZEB1 binds to the promoter region of miR-144-3p, to suppress transcriptional activity, the JASPAR database was used to predict the binding region of the miRNA-144, which was subsequently amplified and cloned into the luciferase reporter vector (Fig. 6I). As shown in Fig. 6J, ZEB1 knockdown enhanced the luciferase activity, while the overexpression of ZEB1 markedly inhibited transcriptional activity in the presence of the wild-type E-box construct only, which confirmed that ZEB1 directly targeted the E-box of the miR-144-3p gene promoter to trigger its expression. In order to further investigate whether there was significant regulatory association between ZEB1 and miR-144-3p, an siRNA for ZEB1 (siZEB1) and an overexpression plasmid (ZEB1-OE) for ZEB1 were designed and applied to attenuate or increase the expression of ZEB1 (Fig. 6J). Fig. 6K shows that miR-144-3p expression was significantly decreased in ZEB1 overexpression cells, while being significantly increased in ZEB1 knockdown cells, which further confirmed the regulatory relationship between ZEB1 and miR-144-3p. Additionally, Fig. 6L shows that luciferase activity in the WT miR-144-3p promoter was upregulated under ZEB1 deficiency, while the opposite result was observed when ZEB1 was overexpressed. No significant difference was observed when the binding site was mutated. After silencing and overexpressing PAX2 (Fig. 6M), it was found that there was no significant regulatory association between PAX2 and miR-592 (Fig. 6N). In addition, the results of the luciferase reporter assay showed that there was no significant transcriptional regulation between PAX2 and miR-592 (Fig. 6O).
Figure 5.

Reverse transcription-quantitative PCR confirmation of the expression levels of (A) hsa-miR-144, (B) hsa-miR-659, (C) hsa-miR-592 and (D) hsa-miR-3176 in Helicobacter pylori-associated gastric cancer. Data are presented as the mean ± SD of at least three independent experiments, and statistical comparisons are case vs. control. The term ‘case’ represents gastric cancer HP-positive samples and the term ‘control’ represents gastric cancer HP-negative samples. miR, microRNA.

Figure 6.

RT-qPCR was used to analyze the expression levels of (A) PAX2, (B) LMX1B, (C) HIC1, (D) ZEB1, (E) LHX3, (F) SLA2 and (G) MAFB in HP-associated gastric cancer. HP(+) is represented by the case group, while HP(−) is represented by the control group. (H) Western blot confirmation of the ZEB1, LHX3 and PAX2 protein expression levels in gastric cancer tissue and β-actin was used as the internal control. (I) Schematic construction of the luciferase reporter constructs containing the wild-type or mutated miR-144 gene promoter region. (J and K) After transfection with pcDNA-ZEB1 plasmid (ZEB1-OE) or si-ZEB1, as well as their own respective negative controls, the expression of ZEB1 and miR-144-3p in MKN-45 cells was measured by western blotting and RT-qPCR. (L) Luciferase activity assays were also performed in those treated MKN-45 cells, which were further transfected with miR-144-3p-MUT or miR-144-3p-WT. After 48 h, firefly luciferase activity was detected and normalized by Renilla luciferase activity. (M and N) After transfection with pcDNA-PAX2 plasmid (PAX2-OE) or si-PAX2, as well as their own respective negative controls, the expression of PAX2 and miR-592 in MKN-45 cells was measured by western blotting and RT-qPCR. (O) Luciferase activity assays were also performed in those treated MKN-45 cells, which were further transfected with miR-592-MUT or miR-592-WT. After 48 h, firefly luciferase activity was detected and normalized by Renilla luciferase activity. Data are presented as the mean ± SD of at least three independent experiments. *P<0.05 and **P<0.01. The term ‘case’ represents gastric cancer HP(+) samples and the term ‘control’ represents gastric cancer HP(−) samples. HP, Helicobacter pylori; HP(+)/+, HP-positive; HP(−)/-, HP-negative; si-, siRNA; miR, microRNA; RT-qPCR, reverse transcription-quantitative PCR; OE, overexpression; NC, negative control; MUT, mutant; WT, wild-type.

Discussion

HP, a type-1 carcinogen, serves as the primary cause of gastric cancer (30). In 2008, 32.5% of new cancer cases, caused by a particular infectious agent, were attributed to HP globally (31). However, the precise pathological mechanism of HP-associated gastric cancer remains unclear. Therefore, identification of the mechanisms of HP-associated gastric cancer is required to prevent progression and improve survival times. In recent years, high-throughput technology has been widely utilized to investigate gene expression levels in various types of tumor, such as colorectal (32) and ovarian cancer (33), providing a novel method to identify significant genes and determine their effects on tumor progression and initiation (34,35). In the present study, 1,050 DEGs were identified between HP(+) and HP(−) groups based on TCGA stomach cancer mRNA dataset, including 418 downregulated and 632 upregulated genes. Subsequently, enrichment and PPI analyses were used to identify the potential functions of these key genes. The top 400 DEGs, out of the total 1,050, were selected for PPI network analysis and the top key 6 genes (TYROBP, CCR5, C3AR1, LCP2, CCL5 and SPI1) were associated with HP(+) and HP(−). TYROBP and CCR5 were identified as upregulated genes by integrative analysis, which indicated that the expression of TYROBP and CCR5 could be increased in HP-associated gastric cancer. A previous study revealed that gene co-expression networks identified TREM2 and TYROBP as major hubs in human APOE expressing mice following traumatic brain injury (36). TYROBP may also play a key role in the formation of chronic gastritis and gastric ulcers. One study suggested that the inhibition of the CCL5/CCR5 axis inhibited the progression of gastric cancer (37). Thus, CCR5 may play a significant role in the tumorigenesis of gastric cancer associated with HP. In the present study, TFs from the DEGs were subsequently identified using the Trrust database. Typically, not all DEGs corresponded to TFs. A total of 31 TFs were identified by a series of comprehensive analyses. Recently, numerous studies (38–40) have demonstrated that TFs regulate gene expression by interacting with miRNAs. Thus, the associations between the miRNAs and TFs were further investigated using the miRWalk database. Next, a TF-miRNA-target gene network was constructed to identify the potential molecular mechanisms. It was found that the ZEB1-miR-144-3p and PAX2-miR-592 networks might play key roles in the different mechanisms of HP(+) and HP(−) gastric cancer. A previous study found that ZEB1 could activate the hsa-miR-99b/let-7e/miR-125a cluster and promote the invasion of liver cancer cells (41). ZEB1 may promote the invasion of liver cancer cells by regulating miR-144-3p. In addition, miR-144-3p has been shown to inhibit tumor proliferation and invasion (42). On the other hand, several studies reported that miR-144 regulated ZEB1 expression directly (43–47) and no studies explored the role of ZEB1 on miR-144-5p. No studies have shown a regulatory association between PAX2 and miR-592. In the present study, ZEB1 was identified as an upregulated gene in the HP(+) group, which was confirmed using RT-qPCR. Thus, ZEB1-miR-144-3p may play a key role in the pathogenesis of gastric cancer associated with HP. PAX2 was shown to play a significant role in cancer cell invasion (42). PAX2 was identified as a downregulated gene using integrative analysis. This suggested that the downregulation of PAX2 may play a significant role in the pathogenesis of gastric cancer associated with HP, by regulating miR-592. In the present study, the ZEB1-miR-144-3p was hypothesized to play key roles in the mechanism of gastric cancer associated with HP (+), which has not been previously investigated. Thus, RT-qPCR was used to confirm the results of the bioinformatics analysis and suggested that the expression of the miRNAs and key genes was consistent with the analysis. Furthermore, the ZEB1-miR-144-3p axis was confirmed using western blot analysis and luciferase reporter assay. However, several limitations still exist in the present study. Firstly, the ZEB1-miR-144-3p axis was verified using a gastric cancer cell line that was HP(−), due to the difficulty of obtaining the co-cultured cell lines of HP. Secondly, the validation in another gastric cancer cell line other than MKN-45 is needed. Thirdly, the data sizes of TCGA and the collected sample data were too small to be suitable for survival analysis. More samples will be collected in further studies to explore the association between HP infection and patient prognosis. In conclusion, in the present study, a TF-miRNA-mRNA network was constructed to analyze the potential molecular mechanisms of gastric cancer associated with HP. A total of 31 TFs, 6 key genes (TYROBP, CCR5, C3AR1, LCP2, CCL5 and SPI1), 7 TF-miRNAs and 181 TF-miRNA-mRNA sets were identified. RT-qPCR, western blot analysis and a luciferase reporter assay were used to confirm the results. The present study may provide a novel direction for further experiments, and the TF-miRNA axes may be underlying targets for precision treatment.
  48 in total

Review 1.  Competing endogenous RNA networks and gastric cancer.

Authors:  Lei-Lei Guo; Chun-Hua Song; Peng Wang; Li-Ping Dai; Jian-Ying Zhang; Kai-Juan Wang
Journal:  World J Gastroenterol       Date:  2015-11-07       Impact factor: 5.742

2.  The role of site accessibility in microRNA target recognition.

Authors:  Michael Kertesz; Nicola Iovino; Ulrich Unnerstall; Ulrike Gaul; Eran Segal
Journal:  Nat Genet       Date:  2007-09-23       Impact factor: 38.330

3.  Introduction to "a handbook of transcription factors".

Authors:  T R Hughes
Journal:  Subcell Biochem       Date:  2011

Review 4.  Transcription factors: an overview.

Authors:  D S Latchman
Journal:  Int J Biochem Cell Biol       Date:  1997-12       Impact factor: 5.085

5.  miR-144-3p increases radiosensibility of gastric cancer cells by targeting inhibition of ZEB1.

Authors:  Z Y Gao; H Liu; Z Zhang
Journal:  Clin Transl Oncol       Date:  2020-07-01       Impact factor: 3.405

6.  Down-regulation of miR-503 expression predicate advanced mythological features and poor prognosis in patients with NSCLC.

Authors:  Lei Liu; Weiqing Qu; Zhaokun Zhong
Journal:  Int J Clin Exp Pathol       Date:  2015-05-01

7.  Most mammalian mRNAs are conserved targets of microRNAs.

Authors:  Robin C Friedman; Kyle Kai-How Farh; Christopher B Burge; David P Bartel
Journal:  Genome Res       Date:  2008-10-27       Impact factor: 9.043

8.  JASPAR 2018: update of the open-access database of transcription factor binding profiles and its web framework.

Authors:  Aziz Khan; Oriol Fornes; Arnaud Stigliani; Marius Gheorghe; Jaime A Castro-Mondragon; Robin van der Lee; Adrien Bessy; Jeanne Chèneby; Shubhada R Kulkarni; Ge Tan; Damir Baranasic; David J Arenillas; Albin Sandelin; Klaas Vandepoele; Boris Lenhard; Benoît Ballester; Wyeth W Wasserman; François Parcy; Anthony Mathelier
Journal:  Nucleic Acids Res       Date:  2018-01-04       Impact factor: 16.971

Review 9.  MicroRNAs as non-invasive diagnostic biomarkers for gastric cancer: Current insights and future perspectives.

Authors:  Alexander Link; Juozas Kupcinskas
Journal:  World J Gastroenterol       Date:  2018-08-14       Impact factor: 5.742

10.  TCGAbiolinks: an R/Bioconductor package for integrative analysis of TCGA data.

Authors:  Antonio Colaprico; Tiago C Silva; Catharina Olsen; Luciano Garofano; Claudia Cava; Davide Garolini; Thais S Sabedot; Tathiane M Malta; Stefano M Pagnotta; Isabella Castiglioni; Michele Ceccarelli; Gianluca Bontempi; Houtan Noushmehr
Journal:  Nucleic Acids Res       Date:  2015-12-23       Impact factor: 16.971

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.